1. Epigenetics
  2. MicroRNA
  3. MicroRNA Agomir Negative Control

MicroRNA Agomir Negative Control is a chemically-modified double-strand miRNA mimic, and can be used as a negative control.

For research use only. We do not sell to patients.

RNA, (UUGUACUACACAAAAGUACUG), complex with RNA, (GUACUUUUGUGUAGUACAANN) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

MicroRNA Agomir Negative Control Chemical Structure

Size Price Stock Quantity
5 nmol USD 225 Get quote 1-2 weeks 1-2 weeks 1-2 weeks
20 nmol USD 560 Get quote 1-2 weeks 1-2 weeks 1-2 weeks
Synthetic products have potential research and development risk.

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Customer Review

Based on 1 publication(s) in Google Scholar

Other Forms of MicroRNA Agomir Negative Control:

Top Publications Citing Use of Products
  • Biological Activity

  • Purity & Documentation

  • Customer Review

Description

MicroRNA Agomir Negative Control is a chemically-modified double-strand miRNA mimic, and can be used as a negative control.

Molecular Weight

13973.44

Unlabeled CAS

Appearance

Solid

Color

Colorless to off-white

SMILES

[MicroRNA Agomir Negative Control]

Shipping

Room temperature in continental US; may vary elsewhere.

Storage

-20°C, sealed storage, away from moisture

*In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

Purity & Documentation
  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.

MicroRNA Agomir Negative Control Related Classifications

  • Molarity Calculator

  • Dilution Calculator

The molarity calculator equation

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass   Concentration   Volume   Molecular Weight *
= × ×

The dilution calculator equation

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)
× = ×
C1   V1   C2   V2
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Your Recently Viewed Products:

Inquiry Online

Your information is safe with us. * Required Fields.

Product Name

 

Salutation

Applicant Name *

 

Email Address *

Phone Number *

 

Organization Name *

Department *

 

Requested quantity *

Country or Region *

     

Remarks

Bulk Inquiry

Inquiry Information

Product Name:
MicroRNA Agomir Negative Control
Cat. No.:
HY-R04602A
Quantity:
MCE Japan Authorized Agent: