1. Search Result
Search Result
Results for "

viral proteins

" in MedChemExpress (MCE) Product Catalog:

65

Inhibitors & Agonists

5

Screening Libraries

1

Biochemical Assay Reagents

1

Peptides

1

Inhibitory Antibodies

11

Natural
Products

Targets Recommended:
Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-109045A

    BTA074 hydrochloride; AP 611074 hydrochloride

    E1/E2/E3 Enzyme HPV Infection
    Teslexivir (BTA074) hydrochloride is a potent antiviral agent. Teslexivir hydrochloride is a potent and selective inhibitor of the interaction between two essential viral proteins, E1 and E2, an association that is a necessary step in the DNA replication and thus viral production for Human Papilloma Virus (HPV) 6 and 11. Teslexivir hydrochloride can be used for condyloma research .
    Teslexivir hydrochloride
  • HY-19874

    RSV Infection
    RFI-641 is a selective inhibitor of the respiratory syncytial virus (RSV), with an IC50 of 50 nM. RFI-641 inhibit binding and fusion of enveloped virus via interaction with the viral fusion protein .
    RFI-641
  • HY-105721

    SARS-CoV Infection
    Aranotin strongly binds to Nsp15 viral protein. Aranotin can be used as promising SARS-CoV-2 replication strong inhibitor. Aranotin has the potential for COVID-19 research .
    Aranotin
  • HY-109045

    BTA074; AP 611074

    E1/E2/E3 Enzyme HPV Infection
    Teslexivir (BTA074) is a potent antiviral agent. Teslexivir is a potent and selective inhibitor of the interaction between two essential viral proteins, E1 and E2, an association that is a necessary step in the DNA replication and thus viral production for Human Papilloma Virus (HPV) 6 and 11. Teslexivir can be used for condyloma research .
    Teslexivir
  • HY-157236

    Others Others
    AEX Anion-exchange resin 1 is a strong anion exchange chromatography resin, based on monodisperse polystyrene/divinylbenzene (PS-DVB), with a particle size of 50 μm and an ionic ligand of –CH2N + (CH3)3. AEX Anion-exchange resin 1 can be used for the separation and purification of biological macromolecules such as proteins, antibodies, and viral vaccines.
    AEX Anion-exchange resin 1
  • HY-152027

    HSP Apoptosis Infection Neurological Disease Inflammation/Immunology Cancer
    HSP90-IN-18 is an effective heat shock protein 90 (Hsp90) inhibitor. HSP90-IN-18 has effective Hsp90 inhibitory activity with an IC50 value of 0.39 μM. HSP90-IN-18 can be used for the research of viral infection, neurodegenerative disease, and inflammation .
    HSP90-IN-18
  • HY-152028

    HSP Infection Neurological Disease Inflammation/Immunology Cancer
    HSP90-IN-19 is an effective heat shock protein 90 (Hsp90) inhibitor. HSP90-IN-19 has effective Hsp90 inhibitory activity with an IC50 value of 0.27 μM. HSP90-IN-19 can be used for the research of viral infection, neurodegenerative disease, and inflammation .
    HSP90-IN-19
  • HY-145850

    Enterovirus Infection
    EV-A71-IN-1 is a human enterovirus A71 (EV-A71) capsid protein inhibitor with an EC50 of 0.27 μM against EV-A71. EV-A71-IN-1 is a capsid binder that blocks the interaction between the viral VP1 and the host receptor hSCARB2. EV-A71-IN-1 inhibits a series of different human enteroviruses without significant cytotoxicity (CC50>56.2 μM) .
    EV-A71-IN-1
  • HY-148170

    EBV DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Infection
    L-I-OddU, a L-5'-halo- dioxolane nucleoside analogue, is a potent and selective anti-Epstein-Barr virus (EBV) agent with an EC50 value of 0.03μM. L-I-OddU has low cytotoxicity with a CC50 value of 1000 nM. L-I-OddU has antiviral activity by suppressing replicative EBV DNA and viral protein synthesis .
    L-I-OddU
  • HY-146226

    Enterovirus Infection
    Viral 2C protein inhibitor 1 (compound 6aw) is a potent and broad-spectrum enterovirus antiviral agent, inhibiting viral 2C protein. Viral 2C protein inhibitor 1 inhibits multiple strains of EV-D68, EV-A71 and CVB3 with EC50s of 0.1~3.6 µM, and exhibits high selectivity index and relatively low cytotoxicity .
    <em>Viral</em> 2C <em>protein</em> inhibitor 1
  • HY-124512

    Pentaacetylquercetin

    RSV Infection Inflammation/Immunology
    Quercetin pentaacetate could interact with F-protein with lower binding energy and better stability to block viral adhesion. Quercetin pentaacetate interacts with RSV and inhibit the viral adhesion on cell surface .
    Quercetin pentaacetate
  • HY-162512

    CCR HIV Infection
    CB-0821 is a high affinity CCR5 inhibitor with a Ki of 0.04 nM. CB-0821 binds efficiently to the hydrophobic pocket of the CCR5 protein, to inhibit the interactions between viral protein and CCR5, thereby inhibiting viral entry. CB-0821 has the potential for anti-HIV research .
    CB-0821
  • HY-106312A

    LY122772

    Enterovirus Infection
    Enviroxime (LY122772) is an antiviral compound that inhibits the replication of rhinoviruses and enteroviruses. Enviroxime blocks the replication of plus-strand viral RNA by targeting the viral 3A coding region. Enviroxime can be a useful tool for investigating the natural function of the 3A protein .
    Enviroxime
  • HY-148348

    HBV Infection
    AB-836 is an orally active HBV capsid inhibitor. AB-836 inhibits viral replication by interacting with HBV core protein .
    AB-836
  • HY-163029

    Cathepsin SARS-CoV Infection
    CTSLCTSB-IN-1 (compound 212-148) is a bispecific inhibitor of host viral spike cleaver proteins CTSL/CTSB and TMPRSS2 with IC50s of 2.13/64.07 nM and 1.38 μM, respectively. CTSLCTSB-IN-1 blocks two relevant SARS-CoV-2 viral entry pathways by inhibiting the viral spike cleavage and can be applied to anti-SARS-CoV-2 research .
    CTSL/B-IN-1
  • HY-139850

    HIV Infection
    GPS491 (EC50 = 0.47 μM) suppresses expression of the HIV-1 structural protein Gag and alters HIV-1 RNA accumulation, decreasing the abundance of RNAs encoding the structural proteins while increasing levels of viral RNAs encoding the regulatory proteins.
    GPS491
  • HY-147314

    HIV Src Infection
    HIV-IN-6 is a HIV-Ⅰ viral replication inhibitor by targeting Src family kinases (SFK) that interact with Nef protein of the virus, such as Hck .
    HIV-IN-6
  • HY-119210

    HIV Infection
    ZINC04177596 is a potent HIV-negative factor (HIV-Nef) protein inhibitor. Nef is an accessory gene product of HIV and has an imperative role in viral replication and AIDS pathogenesis .
    ZINC04177596
  • HY-113761

    Filovirus Infection
    ASN03576800 could be a potent inhibitor for Ebola virus matrix protein VP40 in process of viral assembly and budding process. ASN03576800 occupies the RNA binding region of VP40 .
    ASN03576800
  • HY-102077

    HIV Infection
    SAMT-247 is a microbicide that selectively inactivate the viral nucleocapsid protein NCp7, causing zinc ejection and preventing RNA encapsidation. SAMT-247 shows good antiviral activity .
    SAMT-247
  • HY-107745

    Opioid Receptor Flavivirus Infection Neurological Disease
    SDM25N hydrochloride, a δ-opioid receptor antagonist, is also a potent DENV inhibitor. SDM25N hydrochloride targets the viral NS4B protein and restricts genomic RNA replication .
    SDM25N hydrochloride
  • HY-118870

    Endogenous Metabolite Inflammation/Immunology
    γ-Globulins from human blood are a class of proteins in the blood. γ-Globulin is a protein fraction of blood serum containing many antibodies that protect against bacterial and viral infectious diseases. γ-Globulins from human blood is used for common variable immunodeficiency
    γ-Globulins from human blood
  • HY-N2000

    HIV Infection Inflammation/Immunology Cancer
    Bellidifolin is a xanthone isolated from the stems of Swertia punicea, with hepatoprotective, hypoglycemic, anti-oxidation, anti-inflammatory and antitumor activities . Bellidifolin also acts as a viral protein R (Vpr) inhibitor .
    Bellidifolin
  • HY-148768

    HBV Inflammation/Immunology
    AB-506 is an orally active inhibitor of HBV replication targeting the viral core protein. AB-506 can bind to HBV core protein, accelerate capsid assembly and inhibit HBV pgRNA encapsidation. AB-506 can be used in chronic hepatitis B (CHB) research .
    AB-506
  • HY-N2036

    Enterovirus Bacterial Infection
    Mosloflavone is a flavonoid isolated from Scutellaria baicalensis Georgi with  anti-EV71 activity. Mosloflavone  inhibits VP2 virus replication and protein expression during the initial stage of virus infection and inhibits viral VP2 capsid protein synthesis. Mosloflavone is a promising biocide and inhibits P. aeruginosa virulence and biofilm formation.
    Mosloflavone
  • HY-138941

    C12E8

    Influenza Virus Infection
    Octaethylene glycol monododecyl ether (C12E8) is an non-ionic detergent that can be used for membrane protein extraction. Octaethylene glycol monododecyl ether can solubilize the viral membrane of intact influenza virus .
    Octaethylene glycol monododecyl ether
  • HY-W555382

    2-Nonylquinolin-4(1H)-one

    HCV Infection
    Pseudane IX, a compound isolated from the leaves of Ruta angustifolia, has strong anti-HCV activity with an IC50 value of 1.4 μg/mL. Pseudane IX reduces HCV RNA replication and viral protein synthesis levels .
    Pseudane IX
  • HY-B1268
    Docusate Sodium
    1 Publications Verification

    Dioctyl sulfosuccinate sodium salt

    HSV Others
    Docusate Sodium (Dioctyl sulfosuccinate sodium salt) is one of the main components in stool softeners. Docusate Sodium is a sulfated surfactant and may inactivate viral pathogens by disrupting viral envelopes and/or denaturing/disassociating proteins. Docusate Sodium is effective in vitro against wild type and drug-resistant strains of HSV type 1 and 2. Docusate Sodium is an obesogen. Docusate Sodium with developmental exposure leads to increased adult adiposity, inflammation, metabolic disorder and dyslipidemia in offspring fed a standard diet in mice .
    Docusate Sodium
  • HY-B0751

    Amebacilin; NSC9168

    Parasite HIV Antibiotic Infection
    Fumagillin(NSC9168) is an antimicrobial compound first isolated in 1949 from the fungus Aspergillus fumigatu. Fumagillin can inhibits HIV‐1 infection through the inhibition of HIV-1 viral protein R (Vpr) activity.
    Fumagillin
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-147217A

    ISIS 505358 sodium

    HBV Infection
    Bepirovirsen sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-P99346

    CT-P59

    SARS-CoV Angiotensin-converting Enzyme (ACE) Infection
    Regdanvimab (CT-P59) is a human monoclonal antibody that targets the receptor-binding domain of SARS-CoV-2 spike protein, blocking interaction with ACE2 for viral entry. Regdanvimab can be used for the research of COVID-19 .
    Regdanvimab
  • HY-136782

    Flavivirus Dengue virus Infection
    ST-148 maleate is a potent and orally active DENV inhibitor. ST-148 maleate shows antiviral efficacy and low cell toxicity. ST-148 alters the interaction between lipid droplets and the C protein, thereby inhibiting viral replication. .
    ST-148 maleate
  • HY-148328

    Casein Kinase Infection Inflammation/Immunology Cancer
    CK2-IN-4 (compound 5) is a protein kinase (CK2) inhibitor (IC50=8.6 µM). CK2-IN-4 has good potential for research in the areas of cancer, viral infections and glomerulonephritis .
    CK2-IN-4
  • HY-16957

    HCV HIV Infection
    LJ001 is a broad-spectrum and orally active antiviral agent. LJ001 exerts antiviral activities by binding to viral membranes. LJ001 inhibits TGEV and PDCoV infection. LJ001 decreases TGEV N and PDCoV N-protein expression .
    LJ001
  • HY-W650842

    Caspase Cancer
    Boc-Asp(OBzl)-CMK is an inhibitor for IL-1 converting enzyme (ICE, caspase1). Boc-Asp(OBzl)-CMK prevents death of CHP100 neuroblastoma cell, and IL-1β release elicited by the viral coat protein .
    Boc-Asp(OBzl)-CMK
  • HY-148837

    c-Myc Casein Kinase Infection Cardiovascular Disease Cancer
    c-Myc inhibitor 7 is a c-Myc inhibitor and a multiple target protein degrader. c-Myc inhibitor 7 effective degrades c-MYC, CK1α, GSPT1 and IKZF1/2/3 proteins in a variety of tumor cells. c-Myc inhibitor 7 can be used for c-Myc high expression related disease research, such as cancer, cardiovascular and cerebrovascular diseases, and viral infection .
    c-Myc inhibitor 7
  • HY-148836

    c-Myc Infection Cardiovascular Disease Cancer
    c-Myc inhibitor 6 (compound A102) is a c-Myc inhibitor. c-Myc inhibitor 6 decreases cancer cell viability and degrades c-Myc protein. c-Myc inhibitor 6 can be used for the research of c-Myc imbalance, such as cancer, cardiovascular diseases, and viral infection .
    c-Myc inhibitor 6
  • HY-108717
    Proteinase K
    5 Publications Verification

    Protease K

    Ser/Thr Protease Others
    Proteinase K (Protease K) is a nonspecific serine protease that is useful for general digestion of proteins. Proteinase K is active in the presence of SDS or urea and over a wide range of pH (4-12), salt concentrations, and temperatures. Proteinase K can be use for promoting methods of viral nucleic acid extraction, and detection .
    Proteinase K
  • HY-145871

    HBV Infection
    BA38017 is a potent HBV core protein assembly modulator. BA38017 inhibits HBV replication with an EC50 of 0.20 μM .
    BA38017
  • HY-N1535
    Ponicidin
    2 Publications Verification

    Rubescensine B

    Apoptosis Inflammation/Immunology Cancer
    Ponicidin (Rubescensine B) is a diterpenoid derived from Rabdosia rubescens, and exhibits immunoregulatory, anti-inflammatory, anti-viral and anti-cancer activity. Ponicidin (Rubescensine B) induces apoptosis of gastric carcinoma cell, decreases the phosphorylation of JAK2 and STAT3, and shows no effect on protein levels of JAK2 and STAT3 .
    Ponicidin
  • HY-B0751R

    Parasite HIV Antibiotic Infection
    Fumagillin (Standard) is the analytical standard of Fumagillin. This product is intended for research and analytical applications. Fumagillin(NSC9168) is an antimicrobial compound first isolated in 1949 from the fungus Aspergillus fumigatu. Fumagillin can inhibits HIV‐1 infection through the inhibition of HIV-1 viral protein R (Vpr) activity.
    Fumagillin (Standard)
  • HY-154968

    RSV Infection
    RSV L-protein-IN-5 (compound E) is a potent inhibitor of Respiratory syncytial virus (RSV) (EC50=0.1 μM). RSV L-protein-IN-5 inhibits Polymerase (IC50=0.66 μM),and blocks RSV mRNA synthesis by inhibiting guanylation of viral transcripts. RSV L-protein-IN-5 shows moderate cytotoxicity (CC50=10.7 μM,HEp-2),also exhibits activity and lowers virus titers in mouse models of RSV infection .
    RSV L-protein-IN-5
  • HY-115574

    RSV Infection
    RSV L-protein-IN-1 (compound D) is a potent inhibitor of Respiratory syncytial virus (RSV) (EC50=0.021 μM). RSV L-protein-IN-1 inhibits Polymerase (IC50=0.089 μM),and blocks RSV mRNA synthesis by inhibiting guanylation of viral transcripts. RSV L-protein-IN-1 shows moderate cytotoxicity (CC50=8.4 μM,HEp-2),also exhibits activity and lowers virus titers in mouse models of RSV infection .
    RSV L-protein-IN-1
  • HY-124806

    Enterovirus DNA/RNA Synthesis HCV Infection
    TTP-8307 is a potent inhibitor of the replication of several rhino- and enteroviruses. TTP-8307 inhibits coxsackievirus B3 (CVB3; EC50=1.2 μM) and poliovirus by interfering with the synthesis of viral RNA. TTP-8307 exerts antiviral activity through oxysterol-binding protein (OSBP) .
    TTP-8307
  • HY-N3187

    Flavivirus Dengue virus Fungal Bacterial Histamine Receptor Infection Neurological Disease Inflammation/Immunology Cancer
    Nimbin is a intermediate limonoid isolated from Azadirachta. Nimbin prevents tau aggregation and increases cell viability. Nimbin is effective inhibits the envelope protein of dengue virus. Nimbin has anti-inflammatory, antipyretic, antifungal, antihistamine, antiseptic, antioxidant, anti-cancer and anti-viral properties. Nimbin can across blood-brain barrier .
    Nimbin
  • HY-144260

    SARS-CoV Infection
    3CPLro-IN-1 (compound A17) is a potent and orally active inhibitor of SARS-CoV-2 3CLpro with an IC50 of 5.65 μM. 3-Chymotrypsin-like cysteine protease (3CLpro) is an indispensable protein in viral replication and represents an attractive agent target for fighting COVID-19 .
    3CPLro-IN-1
  • HY-156346

    SARS-CoV Infection
    HCoV-OC43-IN-1 (Compound IV-16) is a coronavirus HCoV-OC43 inhibitor. HCoV-OC43-IN-1 has antiviral efficacy (EC50: 90 nM). HCoV-OC43-IN-1 inhibits the mRNA level and expression of viral nucleocapsid protein (NP) .
    HCoV-OC43-IN-1
  • HY-111233

    WIN-51711

    Enterovirus Infection
    Disoxaril (WIN-51711) is a polioviruses inhibitor. Disoxaril inhibits the replication of polioviruses types 1 and 2 in cells. Disoxaril binds directly to the virion capsid proteins and inhibits viral uncoating by stabilizing the virus capsid. Disoxaril still allows the virus to enter the cell by receptor-mediated endocytosis. Disoxaril also inhibits enterovirus replication .
    Disoxaril
  • HY-120072
    PF-3450074
    3 Publications Verification

    PF-74

    HIV Infection
    PF-3450074 (PF-74) is a specifical inhibitor of HIV-1 capsid protein (CA) and displays a broad-spectrum inhibition of HIV isolates with submicromolar potency (EC50=8-640 nM). PF-3450074 (PF-74) acts at an early stage of HIV-1 infection, inhibits viral replication by directly competing with the binding of CPSF6 and NUP153, and blocks the uncoating, assembly, and the reverse transcription steps of the viral life cycle . CPSF6: nuclear host factors cleavage and polyadenylation specific factor 6; NUP153: nucleoporin 153.
    PF-3450074

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: