1. Epigenetics
  2. MicroRNA
  3. hsa-miR-4432 agomir

hsa-miR-4432 agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

For research use only. We do not sell to patients.

RNA, (AAAGACUCUGCAAGAUGCCU), complex with RNA, (GCAUCUUGCAGAGUCUUUNN) (1:1) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

hsa-miR-4432 agomir Chemical Structure

Size Price Stock Quantity
5 nmol USD 225 Get quote 1-2 weeks 1-2 weeks 1-2 weeks
20 nmol USD 560 Get quote 1-2 weeks 1-2 weeks 1-2 weeks
Synthetic products have potential research and development risk.

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Customer Review

Based on 2 publication(s) in Google Scholar

Other Forms of hsa-miR-4432 agomir:

Top Publications Citing Use of Products

1 Publications Citing Use of MCE hsa-miR-4432 agomir

IF

    hsa-miR-4432 agomir purchased from MedChemExpress. Usage Cited in: Biology (Basel). 2023 Mar 16.

    miR-4432 mimic significantly reduces the mitochondrial oxidative stress in hBMECs.
    • Biological Activity

    • Purity & Documentation

    • Customer Review

    Description

    hsa-miR-4432 agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo.

    Molecular Weight

    13789.56

    miRBase Accession Number
    Mature miRNA Sequence

    AAAGACUCUGCAAGAUGCCU

    Stem-loop ID

    hsa-mir-4432

    Stem-loop Sequence

    GCAUCUUGCAGAGCCGUUCCAAUGCGACACCUCUAGAGUGUCAUCCCCUAGAAUGUCACCUUGGAAAGACUCUGCAAGAUGCCU

    Species

    Human

    Shipping

    Room temperature in continental US; may vary elsewhere.

    Storage

    Please store the product under the recommended conditions in the Certificate of Analysis.

    Purity & Documentation
    • No file chosen (Maximum size is: 1024 Kb)
    • If you have published this work, please enter the PubMed ID.
    • Your name will appear on the site.

    hsa-miR-4432 agomir Related Classifications

    • Molarity Calculator

    • Dilution Calculator

    The molarity calculator equation

    Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

    Mass   Concentration   Volume   Molecular Weight *
    = × ×

    The dilution calculator equation

    Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

    This equation is commonly abbreviated as: C1V1 = C2V2

    Concentration (start) × Volume (start) = Concentration (final) × Volume (final)
    × = ×
    C1   V1   C2   V2
    Help & FAQs
    • Do most proteins show cross-species activity?

      Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

    Your Recently Viewed Products:

    Inquiry Online

    Your information is safe with us. * Required Fields.

    Product Name

     

    Salutation

    Applicant Name *

     

    Email Address *

    Phone Number *

     

    Organization Name *

    Department *

     

    Requested quantity *

    Country or Region *

         

    Remarks

    Bulk Inquiry

    Inquiry Information

    Product Name:
    hsa-miR-4432 agomir
    Cat. No.:
    HY-R01031A
    Quantity:
    MCE Japan Authorized Agent: