Search Result
Results for "
antisense oligonucleotide
" in MedChemExpress (MCE) Product Catalog:
2
Biochemical Assay Reagents
| Cat. No. |
Product Name |
Target |
Research Areas |
Chemical Structure |
-
- HY-W570887
-
-
-
- HY-108753
-
|
AVI 4658
|
Others
|
Metabolic Disease
|
|
Eteplirsen (AVI 4658) is a synthetic antisense oligonucleotide. Eteplirsen can be used for Duchenne muscular dystrophy research .
|
-
-
- HY-132582C
-
|
BIIB080 sodium; ISIS 814907 sodium
|
Tau Protein
|
Neurological Disease
|
|
IONIS-MAPTRx sodium is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx sodium has the potential for the research of Alzheimer Disease .
|
-
-
- HY-132593A
-
|
WVE-120101 sodium
|
Huntingtin
|
Neurological Disease
|
|
Rovanersen sodium is an antisense oligonucleotide that specifically targets mutated mRNA copies of the huntington (HTT) gene without affecting healthy mRNA of HTT gene, thereby preventing the production of faulty Huntingtin protein. Rovanersen sodium can be used for huntington’s disease research .
|
-
-
- HY-P3392
-
|
ION373
|
FAP
|
Neurological Disease
|
|
Zilganersen (ION373) is a glial fibrillary acidic protein (GFAP) inhibitor, an antisense oligonucleotide. Zilganersen can be used in Alexander disease (AxD) research .
|
-
-
- HY-132582
-
|
BIIB080; ISIS 814907
|
Tau Protein
|
Neurological Disease
|
|
IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease .
|
-
-
- HY-132593
-
|
WVE-120101
|
Huntingtin
|
Neurological Disease
|
|
Rovanersen (WVE-120101) is an antisense oligonucleotide that specifically targets mutated mRNA copies of the huntington (HTT) gene without affecting healthy mRNA of HTT gene, thereby preventing the production of faulty Huntingtin protein. Rovanersen can be used for huntington’s disease research .
|
-
-
- HY-151123A
-
|
AKCEA-APO(a)-LRx sodium; ISIS 681257 sodium; TQJ230 sodium
|
Others
|
Cardiovascular Disease
|
|
Pelacarsen sodium is a liver-specific antisense oligonucleotide against apolipoprotein(a) that reduces lipoprotein(a) up to 80% with good tolerability .
|
-
-
- HY-148647
-
|
ISIS 301012 free base
|
HCV
|
Infection
|
|
Mipomersen (ISIS 301012 free base) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
|
-
-
- HY-132581
-
|
BIIB078; IONIS-C9Rx
|
Others
|
Neurological Disease
|
|
Tadnersen (BIIB078), an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
|
-
-
- HY-151123
-
|
AKCEA-APO(a)-LRx; ISIS 681257; TQJ230
|
Others
|
Cardiovascular Disease
|
|
Pelacarsen (AKCEA-APO(a)-LRx) is a liver-specific antisense oligonucleotide against apolipoprotein(a) that reduces lipoprotein(a) up to 80% with good tolerability .
|
-
-
- HY-136151
-
|
|
Others
|
Others
|
|
UNC10217938A is a 3-deazapteridine analog with strong oligonucleotide enhancing effects. UNC10217938A enhances oligonucleotides effects by modulating their intracellular trafficking and release from endosomes. UNC10217938A also enhances the effects of antisense and siRNA oligonucleotides .
|
-
-
- HY-132579A
-
|
RG6042 sodium; IONIS-HTTRx sodium
|
Huntingtin
|
Neurological Disease
|
|
Tominersen sodium is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen sodium can be used for the research of Huntington’s disease (HD) .
|
-
-
- HY-132579
-
|
RG6042; IONIS-HTTRx
|
Huntingtin
|
Neurological Disease
|
|
Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD) .
|
-
-
- HY-145721
-
|
GED-0301
|
TGF-beta/Smad
|
Inflammation/Immunology
|
|
Mongersen (GED-0301) is a specific and orally active SMAD7 antisense oligonucleotide. Mongersen restores TGF-β1 activity leading to inhibition of inflammatory signals. Mongersen can attenuate Crohn's disease-like experimental colitis in mice .
|
-
-
- HY-109528
-
|
ISIS-2922
|
CMV
|
Infection
|
|
Fomivirsen (ISIS-2922) sodium is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen sodium is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen sodium binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation .
|
-
-
- HY-112958
-
|
ISIS-2922 free base
|
CMV
|
Infection
|
|
Fomivirsen (ISIS-2922 free base) is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen is an antiviral agent that is used CMV research, incluiding in AIDs. Fomivirsen binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation .
|
-
-
- HY-132608
-
|
ISIS-420915 sodium
|
Transthyretin (TTR)
|
Neurological Disease
|
|
Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
|
-
-
- HY-132580
-
|
BIIB067; ISIS-SOD1Rx
|
DNA/RNA Synthesis
|
Neurological Disease
|
|
Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS) .
|
-
-
- HY-21997
-
|
|
DNA/RNA Synthesis
|
Others
|
|
Dmt-2'fluoro-da(bz) amidite, an uniformly modified 2'-deoxy-2'-fluoro phosphorothioate oligonucleotide, is a nuclease-resistant antisense compound with high affinity and specificity for RNA targets. Dmt-2'fluoro-da(bz) amidite is also an intermediate for 5’-DMT-3’-phosphoramidite synthesis .
|
-
-
- HY-132586
-
|
NS-065/NCNP-01
|
Nucleoside Antimetabolite/Analog
|
Metabolic Disease
|
|
Viltolarsen (NS-065/NCNP-01) is a phosphorodiamidate morpholino antisense oligonucleotide. Viltolarsen binds to exon 53 of the dystrophin mRNA precursor and restores the amino acid open-reading frame by skipping exon 53, resulting in the production of a shortened dystrophin protein that contains essential functional portions. Viltolarsen has the potential for Duchenne muscular dystrophy (DMD) research .
|
-
-
- HY-132586A
-
|
NS-065/NCNP-01 sodium
|
Nucleoside Antimetabolite/Analog
|
Metabolic Disease
|
|
Viltolarsen (NS-065/NCNP-01) sodium is a phosphorodiamidate morpholino antisense oligonucleotide. Viltolarsen sodium binds to exon 53 of the dystrophin mRNA precursor and restores the amino acid open-reading frame by skipping exon 53, resulting in the production of a shortened dystrophin protein that contains essential functional portions. Viltolarsen sodium has the potential for Duchenne muscular dystrophy (DMD) research .
|
-
-
- HY-148089
-
|
|
Transthyretin (TTR)
|
Neurological Disease
|
|
Eplontersen is a triantennary N-acetyl galactosamine (GalNAc3-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases .
|
-
-
- HY-148089A
-
|
|
Transthyretin (TTR)
|
Neurological Disease
|
|
Eplontersen sodium is a triantennary N-acetyl galactosamine (GalNAc3-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases .
|
-
-
- HY-W570885
-
|
|
DNA/RNA Synthesis
|
Others
|
|
2'-O-MOE-rC is a 2'-O-MOE modified nucleoside. 2'-O-MOE-rC can be used for synthesis of DNA .
|
-
-
- HY-W440752
-
|
|
Liposome
|
Cancer
|
|
BP Lipid 113 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-W800749
-
|
|
Liposome
|
Cancer
|
|
BP Lipid 223 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-W800786
-
|
|
Liposome
|
Cancer
|
|
16:0 PE MCC is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-W800787
-
|
|
Liposome
|
Cancer
|
|
18:1 PE MCC is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-W440748
-
|
|
Liposome
|
Cancer
|
|
BP Lipid 109 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-W800737
-
|
|
Liposome
|
Cancer
|
|
BP Lipid 126 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-W440698
-
|
|
Liposome
|
Cancer
|
|
Cholesterol-PEG-Acid (MW 2000) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-W440743
-
|
|
Liposome
|
Cancer
|
|
BP Lipid 103 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-W440751
-
|
|
Liposome
|
Cancer
|
|
BP Lipid 112 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-W440981
-
|
|
Liposome
|
Cancer
|
|
SPPC is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-W440803
-
|
|
Liposome
|
Cancer
|
|
BP Lipid 218 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-W440800
-
|
|
Liposome
|
Cancer
|
|
BP Lipid 226 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-W440766
-
|
|
Liposome
|
Cancer
|
|
BP Lipid 209 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-W440957
-
|
|
Liposome
|
Cancer
|
|
PMPC is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-P2073
-
|
|
Liposome
|
Cancer
|
|
Cyclo(δ-Ala-L-Val) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-P10442
-
|
|
Liposome
|
Cancer
|
|
Cinnamosyn is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-137798
-
|
|
Liposome
|
Cancer
|
|
Chromozym PL is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-P10446
-
|
|
Liposome
|
Cancer
|
|
TAT-PiET-PROTAC is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-P10447
-
|
Fengycin IX; SNA-60-367-3
|
Liposome
|
Cancer
|
|
Plipastatin A1 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-P3100
-
|
|
Liposome
|
Cancer
|
|
Orfamide A is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-P3118
-
|
|
Liposome
|
Cancer
|
|
Bz-IEGR-pNA (acetate) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-P10443
-
|
|
Liposome
|
Cancer
|
|
ppTG20 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-P10445
-
|
|
Liposome
|
Cancer
|
|
TAT-PiET is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-161671
-
|
|
Liposome
|
Cancer
|
|
GAT2711 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
-
- HY-161672
-
|
|
Liposome
|
Cancer
|
|
G-5758 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W440985
-
|
|
Liposome
|
Cancer
|
|
DLPS is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W441005
-
|
|
Liposome
|
Cancer
|
|
Amino-Gly-Gly-DSPE (hydrochloride) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W590535
-
|
|
Liposome
|
Cancer
|
|
19:0 PC is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W590536
-
|
|
Liposome
|
Cancer
|
|
PLPC is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W590538
-
|
|
Liposome
|
Cancer
|
|
HAPC-Chol is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W590593
-
|
|
Liposome
|
Cancer
|
|
mPEG-Cholesterol,MW 2000 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W591332
-
|
1,2-Dimyristoyl-rac-glycero-3-PE-methoxy-polyethyleneglycol-2000; 1,2-DMPE-MPEG(2000)
|
Liposome
|
Cancer
|
|
DMPE-mPEG, MW 2000 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800733
-
|
|
Liposome
|
Cancer
|
|
DLPG is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800788
-
|
|
Liposome
|
Cancer
|
|
18:1 MPB PE is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800789
-
|
|
Liposome
|
Cancer
|
|
16:0 MPB PE is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800790
-
|
|
Liposome
|
Cancer
|
|
18:1 Caproylamine PE is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800791
-
|
|
Liposome
|
Cancer
|
|
16:0 Caproylamine PE is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800792
-
|
|
Liposome
|
Cancer
|
|
18:1 Succinyl PE is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800793
-
|
|
Liposome
|
Cancer
|
|
16:0 Succinyl PE is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800794
-
|
|
Liposome
|
Cancer
|
|
16:0 Glutaryl PE is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800795
-
|
|
Liposome
|
Cancer
|
|
18:1 Dodecanyl PE is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800796
-
|
|
Liposome
|
Cancer
|
|
18:1 Biotinyl PE is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800797
-
|
|
Liposome
|
Cancer
|
|
16:0 Biotinyl PE is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800798
-
|
|
Liposome
|
Cancer
|
|
16:0 Cyanur PE is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800802
-
|
|
Liposome
|
Cancer
|
|
BP Lipid 227 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800805
-
|
|
Liposome
|
Cancer
|
|
DOPE-Mal is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800812
-
|
|
Liposome
|
Cancer
|
|
BP Lipid 308 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800825
-
|
|
Liposome
|
Cancer
|
|
Octadecanedioic Acid Mono-L-carnitine ester is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800827
-
|
|
Liposome
|
Cancer
|
|
BP Lipid 229 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800841
-
|
|
Liposome
|
Cancer
|
|
BP Lipid 314 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800849
-
|
|
Liposome
|
Cancer
|
|
BP Lipid 315 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-112974
-
|
GSK-2998728; ISIS-420915
|
Transthyretin (TTR)
|
Others
|
|
Inotersen is an antisense oligonucleotide that inhibits hepatic production of transthyretin (TTR).
|
-
- HY-139788
-
|
ION-957943 free acid; BAY-3563450; IONIS-FXI-LRx
|
Others
|
Cardiovascular Disease
|
|
Fesomersen is an antisense oligonucleotide designed to inhibit the production of Factor XI.
|
-
- HY-139788A
-
|
ION-957943; BAY-2976217; IONIS-FXI-LRx sodium
|
Others
|
Cardiovascular Disease
|
|
Fesomersen (sodium) is an antisense oligonucleotide designed to inhibit the production of Factor XI.
|
-
- HY-132594A
-
-
- HY-W440711
-
|
|
Liposome
|
Cancer
|
|
Cholesterol-PEG-Biotin (MW 2000) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800777
-
|
|
Liposome
|
Cancer
|
|
6-(3-Hydroxypropylamino)hexyl 2-hexyldecanoate is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800785
-
|
|
Liposome
|
Cancer
|
|
16:0-23:2 Diyne PC is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W440706
-
|
|
Liposome
|
Cancer
|
|
Cholesterol-PEG-alcohol (MW 2000) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W440719
-
|
|
Liposome
|
Cancer
|
|
Cholesterol-PEG-MAL (MW 2000) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W440694
-
|
|
Liposome
|
Cancer
|
|
Cholesterol-PEG-Azide (MW 2000) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W440690
-
|
|
Liposome
|
Cancer
|
|
Cholesterol-PEG-Amine (MW 2000) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-138913
-
|
|
Liposome
|
Cancer
|
|
2H-Cho-Arg (TFA) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W340832
-
|
|
Liposome
|
Cancer
|
|
18:1 Biotinyl Cap PE is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800778
-
|
|
Liposome
|
Cancer
|
|
Bis(2-butyloctyl) 10-oxononadecanedioate is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W591913
-
|
|
Liposome
|
Cancer
|
|
Cholesterol-PEG-methoxy, MW 2000 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-153725
-
|
|
Liposome
|
Cancer
|
|
17:1 Lyso PC is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W440727
-
|
|
Liposome
|
Cancer
|
|
Cholesterol-PEG-Vinylsulfone (MW 2000) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W440724
-
|
|
Liposome
|
Cancer
|
|
Cholesterol-PEG-Thiol (MW 3400) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W440820
-
|
|
Liposome
|
Cancer
|
|
Bis(bis(2-carboxyethyl)aminopropyl)methylamine is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W440931
-
|
|
Liposome
|
Cancer
|
|
MPEG2000-DMG is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-138152
-
|
Benzyl-D-Arg-Gly-Arg-pNA dihydrochloride
|
Liposome
|
Cancer
|
|
Z-D-Arg-Gly-Arg-pNA (dihydrochloride) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-P10444
-
|
|
Liposome
|
Cancer
|
|
DOTA Conjugated JM#21 derivative 7 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-P10448
-
|
Boc-LGR-pNA acetate
|
Liposome
|
Cancer
|
|
Boc-Leu-Gly-Arg-pNA is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-P2435
-
|
|
Liposome
|
Cancer
|
|
Bz-Nle-Lys-Arg-Arg-AMC is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-161669
-
|
|
Liposome
|
Cancer
|
|
NLRP3-IN-40 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-161673
-
|
|
Liposome
|
Cancer
|
|
CDC14A/B-IN-1 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-161674
-
|
|
Liposome
|
Cancer
|
|
Monoamine Oxidase B inhibitor 4 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W591461
-
|
|
Liposome
|
Cancer
|
|
DSPE-PEG-COOH, MW 2000 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W440991
-
|
|
Liposome
|
Cancer
|
|
DOPE-PEG-Amine (MW 2000) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W440995
-
|
|
Liposome
|
Cancer
|
|
DOPE-PEG-Mal (MW 2000) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W590555
-
|
|
Liposome
|
Cancer
|
|
Thiol-PEG-DMG, MW 2000 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W591449
-
|
|
Liposome
|
Cancer
|
|
DOPE-PEG-Azide, MW 2000 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-157261
-
|
|
Others
|
Others
|
|
UNC2383 is an oligonucleotide enhancing compound that can enhance effects of antisense oligonucleotides (ASOs), and splice switching oligonucleotides (SSOs) .
|
-
- HY-W140488
-
|
|
Liposome
|
Cancer
|
|
1,2-Didecanoyl-sn-glycero-3-phosphoethanolamine is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800784
-
|
|
Liposome
|
Cancer
|
|
23:2 Diyne PE [DC(8,9)PE] is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
![23:2 Diyne PE [DC(8,9)PE]](//file.medchemexpress.com/product_pic/hy-w800784.gif)
- HY-134174
-
|
|
Liposome
|
Cancer
|
|
1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphate is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-161670
-
|
|
Liposome
|
Cancer
|
|
NSD2-PWWP1 ligand 1 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W587499
-
|
|
Liposome
|
Cancer
|
|
2-Arachidonoyl-sn-glycero-3-phosphocholine (>90%) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-132594
-
-
- HY-153481
-
|
ISIS-107248
|
Integrin
|
Others
|
|
ATL 1102 is a novel second-generation antisense oligonucleotide to CD49d mRNA
|
-
- HY-153481A
-
|
ISIS-107248 sodium
|
Integrin
|
Others
|
|
ATL 1102 sodium is a novel second-generation antisense oligonucleotide to CD49d mRNA
|
-
- HY-W800734
-
|
MPPC
|
Liposome
|
Cancer
|
|
1-Myristoyl-2-palmitoyl-sn-glycero-3-phosphocholine (MPPC) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-115435
-
|
DMPS-Na; Dimyristoyl phosphatidylserine sodium
|
Liposome
|
Cancer
|
|
1,2-Dimyristoyl-sn-glycero-3-phospho-L-serine sodium (DMPS-Na; Dimyristoyl phosphatidylserine sodium) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W440958
-
|
|
Liposome
|
Cancer
|
|
1-Palmitoyl-2-stearoyl-sn-glycero-3-phosphocholine is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W800843
-
|
|
Liposome
|
Cancer
|
|
tert-Butyl 3-(7-((undecan-3-yloxy)carbonyl)heptylamino)propylcarbamate is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-153488
-
|
|
Ras
|
Cancer
|
|
ISIS-2503 is a 20-mer antisense oligonucleotide that inhibits Ha-Ras expression
|
-
- HY-153488A
-
|
|
Ras
|
Cancer
|
|
ISIS-2503 sodium is a 20-mer antisense oligonucleotide that inhibits Ha-Ras expression
|
-
- HY-W339838
-
|
14:0 Lyso PG
|
Liposome
|
Cancer
|
|
1-Myristoyl-2-hydroxy-sn-glycero-3-PG sodium (14:0 Lyso PG) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-141615
-
|
PDME; 16:0 Dimethyl PE
|
Liposome
|
Cancer
|
|
1,2-Dipalmitoyl-sn-glycero-3-phospho-N,N-dimethylethanolamine (PDME; 16:0 Dimethyl PE) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-W343736
-
|
1,3-DPPE; 1,3-Dipalmitoyl-sn-glycero-2-PE
|
Liposome
|
Cancer
|
|
1,3-Dipalmitoyl-glycero-2-phosphoethanolamine (1,3-DPPE; 1,3-Dipalmitoyl-sn-glycero-2-PE) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-P3392A
-
|
ION373 sodium
|
FAP
|
Neurological Disease
|
|
Zilganersen sodium is a glial fibrillary acidic protein (GFAP) inhibitor. Zilganersen sodium can be used in Alexander disease (AxD) research .
|
-
- HY-149906
-
|
GEM91
|
HIV
|
Infection
|
|
Trecovirsen (GEM91) is a 25-mer antisense phosphorothioate oligonucleotide targeted at the gag site of the HIV gene.
|
-
- HY-153324
-
|
|
Others
|
Others
|
|
PS220 (sodium) is an antisense RNA oligonucleotides. PS220 (sodium) can be used for research of treating muscular dystrophy .
|
-
- HY-153495
-
|
BP1001
|
Others
|
Cancer
|
|
Prexigebersen is an antisense oligonucleotide designed to inhibit protein synthesis of Grb2 (growth factor receptor bound protein 2).
|
-
- HY-153495A
-
|
BP1001 sodium
|
Others
|
Cancer
|
|
Prexigebersen sodium is an antisense oligonucleotide designed to inhibit protein synthesis of Grb2 (growth factor receptor bound protein 2).
|
-
- HY-143230
-
|
OGX-011
|
Apoptosis
|
Cancer
|
|
Custirsen is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.
|
-
- HY-145725
-
|
IONIS 598769 sodium
|
Others
|
Others
|
|
Baliforsen (sodium) is an antisense oligonucleotide (16 nucleotides) designed to target myotonic dystrophy protein kinase (DMPK) mRNA and research myotonic dystrophy.
|
-
- HY-145725A
-
|
IONIS 598769; BIIB 065; ISIS-DMPK-2.5Rx
|
Others
|
Others
|
|
Baliforsen is an antisense oligonucleotide (16 nucleotides) designed to target myotonic dystrophy protein kinase (DMPK) mRNA and research myotonic dystrophy.
|
-
- HY-143230A
-
|
OGX-011 sodium
|
Apoptosis
|
Cancer
|
|
Custirsen sodium is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.
|
-
- HY-145727
-
|
|
Others
|
Endocrinology
|
|
Volanesorsen is an antisense oligonucleotide thay targes Apolipoprotein C-III (APOC3)
mRNA. Volanesorsen is used for the study of familial chylomicronemia syndrome.
|
-
- HY-153479
-
-
- HY-153479A
-
-
- HY-149906A
-
|
FITC-GEM91 sodium
|
HIV
|
Infection
|
|
FITC-Trecovirsen (sodium) is a FITC labeled Trecovirsen. Trecovirsen is a 25-mer antisense phosphorothioate oligonucleotide targeted at the gag site of the HIV gene .
|
-
- HY-145722A
-
|
OGX-427
|
HSP
|
Cancer
|
|
Apatorsen is an antisense oligonucleotide designed to bind to Hsp27 mRNA, resulting in the inhibition of the production of Hsp27 protein.
|
-
- HY-145726
-
|
|
TNF Receptor
|
Inflammation/Immunology
|
|
ISIS 104838 is an antisense oligonucleotide agent that reduces the production of tumor necrosis factor (TNF-alpha), a substance that contributes to joint pain and swelling in rheumatoid arthritis.
|
-
- HY-145726A
-
|
|
TNF Receptor
|
Inflammation/Immunology
|
|
ISIS 104838 sodium is an antisense oligonucleotide agent that reduces the production of tumor necrosis factor (TNF-alpha), a substance that contributes to joint pain and swelling in rheumatoid arthritis.
|
-
- HY-145722
-
|
OGX-427 sodium
|
HSP
|
Cancer
|
|
Apatorsen (sodium) is an antisense oligonucleotide designed to bind to Hsp27 mRNA, resulting in the inhibition of the production of Hsp27 protein.
|
-
- HY-153497
-
|
IONIS ANGPT-L3Rx; ISIS 703802
|
Others
|
Metabolic Disease
|
|
Vupanorsen is an N-acetyl galactosamine-conjugated antisense oligonucleotide that inhibits Angiopoietin-like 3 (ANGPTL3) protein synthesis. Vupanorsen lowers triglycerides and atherogenic lipoproteins.
|
-
- HY-153497A
-
|
IONIS ANGPT-L3Rx sodium; ISIS 703802 sodium
|
Others
|
Metabolic Disease
|
|
Vupanorsen (sodium) is an N-acetyl galactosamine-conjugated antisense oligonucleotide that inhibits Angiopoietin-like 3 (ANGPTL3) protein synthesis. Vupanorsen (sodium) lowers triglycerides and atherogenic lipoproteins.
|
-
- HY-112754A
-
|
1,2-Dioleoyl-3-trimethylammonium-propane chloride
|
Liposome
|
Cancer
|
|
DOTAP chloride is a useful and effective cationic lipid for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) with out the use of helper lipid .
|
-
- HY-112980
-
|
|
DNA/RNA Synthesis
|
Inflammation/Immunology
|
|
Nusinersen is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
|
-
- HY-145728
-
|
ISIS-2302
|
Integrin
|
Inflammation/Immunology
|
|
Alicaforsen is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
|
-
- HY-139787
-
|
ISIS-721744 free acid; IONIS-PKK-LRX free acid
|
Others
|
Others
|
|
Donidalorsen is an antisense oligonucleotide designed to reduce the production of prekallikrein (PKK). PKK plays an important role in the activation of inflammatory mediators associated with acute attacks of Hereditary angioedema (HAE).
|
-
- HY-139787A
-
|
ISIS-721744; IONIS-PKK-LRX
|
Others
|
Others
|
|
Donidalorsen (sodium) is an antisense oligonucleotide designed to reduce the production of prekallikrein (PKK). PKK plays an important role in the activation of inflammatory mediators associated with acute attacks of Hereditary angioedema (HAE).
|
-
- HY-145728A
-
|
ISIS-2302 sodium
|
Integrin
|
Inflammation/Immunology
|
|
Alicaforsen sodium is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
|
-
- HY-112980A
-
|
|
DNA/RNA Synthesis
|
Inflammation/Immunology
|
|
Nusinersen sodium is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
|
-
- HY-145724
-
|
Kyndrisa; GSK2402968A; PRO051
|
Others
|
Others
|
|
Drisapersen, a antisense oligonucleotide, induces exon 51 skipping during dystrophin pre-mRNA splicing and allows synthesis of partially functional dystrophin in Duchenne muscular dystrophy (DMD) patients with amenable mutations.
|
-
- HY-153489A
-
|
ISIS-CRPRx sodium
|
Others
|
Cardiovascular Disease
|
|
ISIS 329993 sodium is an antisense oligonucleotide targeting to C-reactive protein (CRP). ISIS-CRPRx sodium has been tested in a rodent model of rheumatoid arthritis (RA) and was shown to improve the clinical signs of arthritis
|
-
- HY-132585A
-
|
Vesleteplirsen sodium
|
Others
|
Others
|
|
SRP-5051 sodium is a next-generation antisense oligonucleotide of peptide phosphorodiamidate morpholino oligomer (PPMO). SRP-5051 targeting exon 51 skipping in Duchenne muscular dystrophy (DMD) .
|
-
- HY-148410A
-
|
STK-001 sodium
|
Sodium Channel
|
Others
|
|
Zorevunersen sodium is an antisense oligonucleotide that is intended to increase the level of productive SCN1A mRNA and consequently increase the expression of the sodium channel Nav1.1 protein. Zorevunersen sodium is used for the study of Dravet syndrome.
|
-
- HY-153489
-
|
ISIS-CRPRx
|
Others
|
Cardiovascular Disease
|
|
ISIS 329993 (ISIS-CRPRx) is an antisense oligonucleotide targeting to C-reactive protein (CRP). ISIS-CRPRx has been tested in a rodent model of rheumatoid arthritis (RA) and was shown to improve the clinical signs of arthritis
|
-
- HY-132582A
-
|
|
Tau Protein
|
|
|
Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
|
-
- HY-108764
-
|
ISIS 301012
|
HCV
|
Metabolic Disease
|
|
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
|
-
- HY-148410
-
|
STK-001
|
Sodium Channel
|
Others
|
|
Zorevunersen (STK-001) is an antisense oligonucleotide that is intended to increase the level of productive SCN1A mRNA and consequently increase the expression of the sodium channel Nav1.1 protein. Zorevunersen is used for the study of Dravet syndrome.
|
-
- HY-153496
-
|
QR 110
|
Others
|
Others
|
|
Sepofarsen (QR-110) is an RNA antisense oligonucleotide targeting to the p.Cys998X mutation (also known as the c.2991+1655A>G mutation) in the CEP290 gene.
|
-
- HY-153496A
-
|
QR 110 sodium
|
Others
|
Others
|
|
Sepofarsen (QR-110) sodium is an RNA antisense oligonucleotide targeting to the p.Cys998X mutation (also known as the c.2991+1655A>G mutation) in the CEP290 gene.
|
-
- HY-153491
-
|
ISIS 678354; IONIS-APOCIII-LRx; AKCEA-APOCIII-LRx
|
Others
|
Cardiovascular Disease
|
|
Olezarsen is an N-acetyl-galactosamine-conjugated antisense oligonucleotide targeted to hepatic APOC3 mRNA to inhibit apolipoprotein C-III (apoC-III) production, in lowering triglyceride levels in patients at high risk for or with established cardiovascular disease.
|
-
- HY-153491A
-
|
ISIS 678354 sodium; IONIS-APOCIII-LRx sodium; AKCEA-APOCIII-LRx sodium
|
Others
|
Cardiovascular Disease
|
|
Olezarsen sodium is an N-acetyl-galactosamine-conjugated antisense oligonucleotide targeted to hepatic APOC3 mRNA to inhibit apolipoprotein C-III (apoC-III) production, in lowering triglyceride levels in patients at high risk for or with established cardiovascular disease.
|
-
- HY-148370A
-
|
RG6299 sodium
|
Complement System
|
Others
|
|
IONIS-FB-LRx sodium is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx sodium effectively reduces circulating levels of CFB, and can be used for geographic atrophy (GA) research .
|
-
- HY-145728B
-
|
(R/S)-ISIS-2302
|
Integrin
|
Inflammation/Immunology
|
|
(R/S)-Alicaforsen is the racemate of Alicaforsen composed of R and S configurations. Alicaforsen is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
|
-
- HY-148413
-
|
ISIS 3521 sodium
|
PKC
|
Cancer
|
|
Aprinocarsen (ISIS 3521) sodium, a specific antisense oligonucleotide inhibitor of protein kinase C-alpha (PKC-α). Aprinocarsen sodium is a 20-mer oligonucleotide, it regulates cell differentiation and proliferation. Aprinocarsen sodium inhibits the growth of human tumor cell lines in nude mice. Aprinocarsen sodium shows the value as a chemotherapeutic compound of human cancers .
|
-
- HY-145729
-
|
AZD9150
|
STAT
Apoptosis
|
Cancer
|
|
Danvatirsen is an antisense oligonucleotide targeting STAT3 with potential antitumor activity. Danvatirsen binds to STAT3 mRNA, thereby inhibiting translation of the transcript. Suppression of STAT3 expression induces tumor cell apoptosis and decreases tumor cell growth.
|
-
- HY-148505
-
|
|
Nucleoside Antimetabolite/Analog
|
Others
|
|
5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite is a potent nucleic acid analog. 5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite blongs to modified antisense oligonucleotide .
|
-
- HY-150237
-
|
|
Others
|
Others
|
|
FITC-labeled Drisapersen (sodium) is Drisapersen labeled with FITC. Drisapersen, a antisense oligonucleotide, induces exon 51 skipping during dystrophin pre-mRNA splicing and allows synthesis of partially functional dystrophin in Duchenne muscular dystrophy (DMD) patients with amenable mutations.
|
-
- HY-145729A
-
|
AZD9150 sodium
|
Apoptosis
STAT
|
Cancer
|
|
Danvatirsen sodium is an antisense oligonucleotide targeting STAT3 with potential antitumor activity. Danvatirsen sodium binds to STAT3 mRNA, thereby inhibiting translation of the transcript. Suppression of STAT3 expression induces tumor cell apoptosis and decreases tumor cell growth.
|
-
- HY-147217
-
|
ISIS 505358
|
HBV
|
Infection
|
|
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
|
-
- HY-148370
-
|
RG6299
|
Complement System
|
Others
|
|
IONIS-FB-LRx is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx effectively reduces circulating levels of CFB. IONIS-FB-LRx can be used for geographic atrophy (GA) research .
|
-
- HY-147217A
-
|
ISIS 505358 sodium
|
HBV
|
Infection
|
|
Bepirovirsen sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
|
-
- HY-148687
-
|
|
Others
|
Cardiovascular Disease
|
|
SPC5001 is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
|
-
- HY-148827A
-
|
HYBO-165 sodium
|
PKA
|
Cancer
|
|
GEM231 sodium is an 18mer antisense oligonucleotide targeting the mRNA of the PKA-I (RIα regulatory subunit of cAMP dependent protein kinase type I ). GEM231 sodium induces cell growth arrest, apoptosis, and differentiation in a variety of cancer cell lines in vitro and in tumors in vivo.
|
-
- HY-148827
-
|
HYBO-165
|
PKA
|
Cancer
|
|
GEM231 is an 18mer antisense oligonucleotide targeting the mRNA of the PKA-I (RIα regulatory subunit of cAMP dependent protein kinase type I ). GEM231 induces cell growth arrest, apoptosis, and differentiation in a variety of cancer cell lines in vitro and in tumors in vivo.
|
-
- HY-148687A
-
|
|
Others
|
Cardiovascular Disease
|
|
SPC5001 sodium is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 sodium can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
|
-
- HY-132598
-
|
SPC-3649
|
MicroRNA
HCV
|
Infection
Inflammation/Immunology
|
|
Miravirsen (SPC-3649) is a potent miR-122 inhibitor and inhibits the biogenesis of miR-122. Miravirsen is a 15-nucleotide locked nucleic acid-modified phosphorothioate antisense oligonucleotide. Miravirsen inhibits HCV replication. Miravirsen can be used in research of HCV infection .
|
-
- HY-132584A
-
|
SRP-4045 sodium
|
Others
|
Others
|
|
Casimersen sodium is an antisense oligonucleotide of the phosphorodiamidate morpholino oligomer subclass. Casimersen sodium binds to exon 45 of dystrophin pre-mRNA, restores the open-reading frame (by skipping exon 45) resulting in the production of an internally truncated but functional dystrophin protein. Casimersen sodium can be used for the research of Duchenne muscular dystrophy (DMD) .
|
-
- HY-153485A
-
|
ISIS 766720 sodium; IONIS-GHR-LRx sodium
|
Small Interfering RNA (siRNA)
|
Others
|
|
Cimdelirsen is a novel, ligand-conjugated, hepatic-targeted investigative antisense oligonucleotide designed to reduce growth hormone receptor (GHr) synthesis, thereby inhibiting deleterious effects of growth hormone (GH) hypersecretion and reducing circulating insulin-like growth factor-1 (IGF-1) levels in acromegaly patients.
|
-
- HY-153485
-
|
ISIS 766720; IONIS-GHR-LRx
|
Small Interfering RNA (siRNA)
|
Others
|
|
Cimdelirsen is a novel, ligand-conjugated, hepatic-targeted investigative antisense oligonucleotide designed to reduce growth hormone receptor (GHr) synthesis, thereby inhibiting deleterious effects of growth hormone (GH) hypersecretion and reducing circulating insulin-like growth factor-1 (IGF-1) levels in acromegaly patients.
|
-
- HY-153734
-
|
|
Others
|
Others
|
|
Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications
|
-
- HY-132584
-
|
SRP-4045
|
Others
|
Others
|
|
Casimersen (SRP-4045) is an antisense oligonucleotide of the phosphorodiamidate morpholino oligomer subclass. Casimersen binds to exon 45 of dystrophin pre-mRNA, restores the open-reading frame (by skipping exon 45) resulting in the production of an internally truncated but functional dystrophin protein. Casimersen can be used for the research of Duchenne muscular dystrophy (DMD) .
|
-
- HY-148130
-
|
RG6091; RO7248824
|
E1/E2/E3 Enzyme
|
Others
|
|
Rugonersen (RG6091; RO7248824) is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
|
-
- HY-150236
-
|
|
Huntingtin
|
Neurological Disease
|
|
FITC-labeled Tominersen (sodium) is the Tominersen labeled with FITC. Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD).
|
-
- HY-138577
-
|
|
DNA/RNA Synthesis
Nucleoside Antimetabolite/Analog
|
Others
|
|
2'-F-Bz-dC Phosphoramidite can be used in the synthesis of oligoribonucleotide (such as DNA and RNA). 2'-F-Bz-dC Phosphoramidite also used for synthesis antiviral agent to inhibit the replication of virus. 2'-F-Bz-dC Phosphoramidite contains a phosphorothioate backbone, to synthesise antisense oligonucleotide analogs to induce apoptosis in cancer cells .
|
-
- HY-160912
-
|
|
ELOVL
|
Cancer
|
|
ELOVL6-IN-5 (compound B) is an inhibitor of the elongase enzyme of long-chain fatty acid family 6 (ELOVL6). ELOVL6 is a rate-limiting enzyme for the elongation of saturated and monounsaturated long-chain fatty acids and is an effective target for inhibiting diabetes. ELOVL6-IN-5 reduces hepatic fatty acid levels in a mouse model of diet-induced obesity (DIO). However, ELOVL6 inhibition by ELOVL6-IN-5 did not improve insulin resistance .
|
-
| Cat. No. |
Product Name |
Type |
-
- HY-150236
-
|
|
Dyes
|
|
FITC-labeled Tominersen (sodium) is the Tominersen labeled with FITC. Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD).
|
| Cat. No. |
Product Name |
Type |
-
- HY-21997
-
|
|
Gene Sequencing and Synthesis
|
|
Dmt-2'fluoro-da(bz) amidite, an uniformly modified 2'-deoxy-2'-fluoro phosphorothioate oligonucleotide, is a nuclease-resistant antisense compound with high affinity and specificity for RNA targets. Dmt-2'fluoro-da(bz) amidite is also an intermediate for 5’-DMT-3’-phosphoramidite synthesis .
|
-
- HY-112754A
-
|
1,2-Dioleoyl-3-trimethylammonium-propane chloride
|
Drug Delivery
|
|
DOTAP chloride is a useful and effective cationic lipid for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) with out the use of helper lipid .
|
| Cat. No. |
Product Name |
Target |
Research Area |
-
- HY-P2073
-
|
|
Liposome
|
Cancer
|
|
Cyclo(δ-Ala-L-Val) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-P10442
-
|
|
Liposome
|
Cancer
|
|
Cinnamosyn is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-137798
-
|
|
Liposome
|
Cancer
|
|
Chromozym PL is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-P10446
-
|
|
Liposome
|
Cancer
|
|
TAT-PiET-PROTAC is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-P10447
-
|
Fengycin IX; SNA-60-367-3
|
Liposome
|
Cancer
|
|
Plipastatin A1 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-P3100
-
|
|
Liposome
|
Cancer
|
|
Orfamide A is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-P3118
-
|
|
Liposome
|
Cancer
|
|
Bz-IEGR-pNA (acetate) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-P10443
-
|
|
Liposome
|
Cancer
|
|
ppTG20 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-P10445
-
|
|
Liposome
|
Cancer
|
|
TAT-PiET is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-138152
-
|
Benzyl-D-Arg-Gly-Arg-pNA dihydrochloride
|
Liposome
|
Cancer
|
|
Z-D-Arg-Gly-Arg-pNA (dihydrochloride) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-P10444
-
|
|
Liposome
|
Cancer
|
|
DOTA Conjugated JM#21 derivative 7 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-P10448
-
|
Boc-LGR-pNA acetate
|
Liposome
|
Cancer
|
|
Boc-Leu-Gly-Arg-pNA is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-P2435
-
|
|
Liposome
|
Cancer
|
|
Bz-Nle-Lys-Arg-Arg-AMC is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
| Cat. No. |
Product Name |
|
Classification |
-
- HY-W440694
-
|
|
|
Azide
|
|
Cholesterol-PEG-Azide (MW 2000) is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
Your information is safe with us. * Required Fields.
Inquiry Information
- Product Name:
- Cat. No.:
- Quantity:
- MCE Japan Authorized Agent:
![23:2 Diyne PE [DC(8,9)PE]](http://file.medchemexpress.com/product_pic/hy-w800784.gif)
