1. Signaling Pathways
  2. Anti-infection
  3. HBV

HBV

Hepatitis B virus

HBV (Hepatitis B virus), abbreviated HBV, is a species of the genus Orthohepadnavirus, which is likewise a part of the Hepadnaviridae family of viruses. HBV causes the disease hepatitis B. The hepatitis B virus is classified as the type species of the Orthohepadnavirus, which contains three other species: the Ground squirrel hepatitis virus, Woodchuck hepatitis virus, and theWoolly monkey hepatitis B virus. The genus is classified as part of the Hepadnaviridae family. HBV is divided into four major serotypes (adr, adw, ayr, ayw) based on antigenic epitopes present on its envelope proteins, and into eight genotypes (A–H) according to overall nucleotide sequence variation of the genome. The genotypes have a distinct geographical distribution and are used in tracing the evolution and transmission of the virus. Differences between genotypes affect the disease severity, course and likelihood of complications, and response to treatment and possibly vaccination.

Cat. No. Product Name Effect Purity Chemical Structure
  • HY-N0058
    4,5-Dicaffeoylquinic acid
    Inhibitor 99.98%
    4,5-Dicaffeoylquinic acid (Isochlorogenic acid C) is an antioxidant, can be isolated from Gynura divaricata and Laggera alata. 4,5-Dicaffeoylquinic acid reduces islet cell apoptosis and improves pancreatic function in type 2 diabetic mice, and has obvious inhibitory activities against yeast α-glucosidase. 4,5-Dicaffeoylquinic acid inhibits prostate cancer cells through cell cycle arrest. 4,5-Dicaffeoylquinic acid also has anti-apoptotic, anti-injury and anti-hepatitis B virus effects.
    4,5-Dicaffeoylquinic acid
  • HY-P3465
    Bulevirtide
    Inhibitor 99.16%
    Bulevirtide (Myrcludex B) is a NTCP inhibitor, a linear lipopeptide of 47 amino acids. Bulevirtide inhibits HBV and HDV entry into liver cells, blocks HBV infection in hepatocytes, and participates in HBV transcriptional suppression. Bulevirtide can be used in HDV infection and compensated cirrhosis research.
    Bulevirtide
  • HY-N0054
    Osthole
    Inhibitor 99.95%
    Osthole (Osthol) is a natural antihistamine alternative. Osthole may be a potential inhibitor of histamine H1 receptor activity. Osthole also suppresses the secretion of HBV in cells.
    Osthole
  • HY-19314A
    Azvudine hydrochloride
    Inhibitor
    Azvudine (RO-0622) hydrochloride is a potent nucleoside reverse transcriptase inhibitor (NRTI), with antiviral activity on HIV, HBV and HCV. Azvudine hydrochloride exerts highly potent inhibition on HIV-1 (EC50s ranging from 0.03 to 6.92 nM) and HIV-2 (EC50s ranging from 0.018 to 0.025 nM). Azvudine hydrochloride inhibits NRTI-resistant viral strains. Azvudine (hydrochloride) is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. Strain-promoted alkyne-azide cycloaddition (SPAAC) can also occur with molecules containing DBCO or BCN groups.
    Azvudine hydrochloride
  • HY-13623
    Entecavir
    Inhibitor 98.88%
    Entecavir (SQ 34676; BMS 200475) is a potent and selective inhibitor of HBV, with an EC50 of 3.75 nM in HepG2 cell.
    Entecavir
  • HY-N0639
    Punicalin
    Inhibitor 99.89%
    Punicalin is a species that can be isolated from the leaves of Punica granatum. Punicalin is an active molecule against hepatitis b virus (HBV). Punicalin can induce pyroptosis. Punicalin is a Carbonic anhydrase inhibitor. Punicalin blocks the binding of S-glycoprotein and ACE2 receptors. Pnuicalin has anti-inflammatory, antioxidant and antiviral activity.
    Punicalin
  • HY-B1826
    Adefovir
    Inhibitor 99.74%
    Adefovir (GS-0393) is an adenosine monophosphate analog antiviral agent that after intracellular conversion to Adefovir diphosphate inhibits HBV DNA polymerase. Adefovir has an IC50 of 0.7 μM against HBV in the HepG2.2.15 cell line. Adefovir has good antiviral activity against several viruses, including HBV and herpesviruses.
    Adefovir
  • HY-N6939
    Pseudolaric Acid B
    Inhibitor 99.47%
    Pseudolaric Acid B is a diterpene isolated from the root of Pseudolarix kaempferi (pinaceae), has anti-cancer, antifungal, and antifertile activities, and shows immunosuppressive activity on T lymphocytes. Pseudolaric Acid B inhibits hepatitis B virus (HBV) secretion through apoptosis and cell cycle arrest. Pseudolaric Acid B induces autophagy.
    Pseudolaric Acid B
  • HY-13986
    Merimepodib
    Inhibitor 99.27%
    Merimepodib (VX-497) is a noncompetitive and oral inhibitor of inosine monophosphate dehydrogenase (IMPDH) with broad spectrum antiviral activities.
    Merimepodib
  • HY-108917
    Morphothiadin
    Inhibitor 99.84%
    Morphothiadin is a potent inhibitor on the replication of both wild-type and adefovir-resistant HBV with an IC50 of 12 nM.
    Morphothiadin
  • HY-B0255
    Adefovir dipivoxil
    Inhibitor 99.99%
    Adefovir dipivoxil, an adenosine analogue, is an oral proagent of the nucleoside reverse transcriptase inhibitor Adefovir. Adefovir dipivoxil inhibits both the wild type and HBV Lamivudine-resistant strains. Adefovir dipivoxil shows anti-orthopoxvirus activity.
    Adefovir dipivoxil
  • HY-B0766
    Bicyclol
    Inhibitor 99.84%
    Bicyclol(SY 801) is a anti-hepatitis drug.
    Bicyclol
  • HY-13782A
    Tenofovir Disoproxil
    Inhibitor 99.84%
    Tenofovir Disoproxil (Bis(POC)-PMPA) is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B.
    Tenofovir Disoproxil
  • HY-148560
    ccc_R08
    Inhibitor 98.87%
    ccc_R08 is a non-cytotoxic and orally active cccDNA inhibitor that reduces cccDNA levels in the liver of HBV-infected mice. ccc_R08 can be used in the study of HBV virus (hepatitis B virus) infection.
    ccc_R08
  • HY-138407
    Evixapodlin
    Inhibitor 98.14%
    Evixapodlin (GS-4224) is a human PD-1/PD-L1 protein/protein interaction inhibitor with an IC50 of 0.213 nM. Evixapodlin has anticancer and antiviral functions.
    Evixapodlin
  • HY-109168
    Bersacapavir
    Inhibitor 98.26%
    Bersacapavir is a novel Hepatitis B Virus capsid assembly modulator.
    Bersacapavir
  • HY-Y0073
    4-Hydroxyacetophenone
    Inhibitor 99.99%
    4-Hydroxyacetophenone (P-hydroxyacetophenone) is a key hepatoprotective and choleretic compound in Artemisia capillaris and A. morrisonensis, also has an anti-hepatitis B virus effect and anti-inflammatory effect.
    4-Hydroxyacetophenone
  • HY-109195
    Vebicorvir
    Inhibitor 99.73%
    Vebicorvir (ABI-H0731) is a first-generation hepatitis B virus (HBV) core protein inhibitor. Vebicorvir (ABI-H0731) suppresses covalently closed circular DNA (cccDNA) formation in two de novo infection models with EC50s from 1.84 μM to 7.3 μM.
    Vebicorvir
  • HY-B0955
    Oxethazaine
    Inhibitor 99.94%
    Oxethazaine (Oxetacaine), a precursor of phentermine acidic, is an acid-resistent and orally active analgesic agent. Oxethazaine (Oxetacaine) has the potential for the relief of pain associated with peptic ulcer disease or esophagitis.
    Oxethazaine
  • HY-147217
    Bepirovirsen
    Inhibitor 98.44%
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
    Bepirovirsen
Cat. No. Product Name / Synonyms Application Reactivity