1. Epigenetics
  2. MicroRNA
  3. hsa-miR-129-2-3p mimic

hsa-miR-129-2-3p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.

For research use only. We do not sell to patients.

RNA, (AAGCCCUUACCCCAAAAAGCAU), complex with RNA, (GCUUUUUGGGGUAAGGGCUUNN) (1:1)

hsa-miR-129-2-3p mimic Chemical Structure

Size Price Stock Quantity
5 nmol USD 120 Get quote 1-2 weeks 1-2 weeks 1-2 weeks
20 nmol USD 335 Get quote 1-2 weeks 1-2 weeks 1-2 weeks
Synthetic products have potential research and development risk.

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Customer Review

Based on 1 publication(s) in Google Scholar

Other Forms of hsa-miR-129-2-3p mimic:

Top Publications Citing Use of Products
  • Biological Activity

  • Purity & Documentation

  • Customer Review

Description

hsa-miR-129-2-3p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.

Molecular Weight

13981.45

miRBase Accession Number
Mature miRNA Sequence

AAGCCCUUACCCCAAAAAGCAU

Stem-loop ID

hsa-mir-129-2

Stem-loop Sequence

UGCCCUUCGCGAAUCUUUUUGCGGUCUGGGCUUGCUGUACAUAACUCAAUAGCCGGAAGCCCUUACCCCAAAAAGCAUUUGCGGAGGGCG

Species

Human, Mouse, Rat, Alligator mississippiensis, Bovine, Chicken, Dasypus novemcinctus, Eptesicus fuscus, Gadus morhua, Goat, Guinea pig, Horse, Ophiophagus hannah, Petromyzon marinus, Pig, Pongo pygmaeus, Pteropus alecto, Python bivittatus, Rabbit, Salmo salar, Taeniopygia guttata, Zebrafish

Unlabeled CAS

SMILES

[hsa-miR-129-2-3p mimic]

Shipping

Room temperature in continental US; may vary elsewhere.

Storage

Please store the product under the recommended conditions in the Certificate of Analysis.

Purity & Documentation
  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.

hsa-miR-129-2-3p mimic Related Classifications

  • Molarity Calculator

  • Dilution Calculator

The molarity calculator equation

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass   Concentration   Volume   Molecular Weight *
= × ×

The dilution calculator equation

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)
× = ×
C1   V1   C2   V2
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Your Recently Viewed Products:

Inquiry Online

Your information is safe with us. * Required Fields.

Product Name

 

Salutation

Applicant Name *

 

Email Address *

Phone Number *

 

Organization Name *

Department *

 

Requested quantity *

Country or Region *

     

Remarks

Bulk Inquiry

Inquiry Information

Product Name:
hsa-miR-129-2-3p mimic
Cat. No.:
HY-R00216
Quantity:
MCE Japan Authorized Agent: