2. Search Result
Search Result
Results for "

ASO

" in MedChemExpress (MCE) Product Catalog:

17

Inhibitors & Agonists

1

Biochemical Assay Reagents

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-148688
    ASO 556089

    		Others Others
    ASO 556089 is a 16 nucleotide length gap protein (3-10-3) that targets MALAT1, a long non-coding human and mouse RNA. ASO 556089 is an antisense oligonucleotide (ASO) with the sequence 5 '-GmCATTmCTAATAGmCAGmC-3' .
    <em>ASO</em> 556089
  • HY-132582A
    Tau ASO-12 (murine) (sodium)

    		Tau Protein
    Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
    Tau <em>ASO</em>-12 (murine) (sodium)
  • HY-153734
    Inactive ASO (in vivo) sodium

    		Others Others
    Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications
    Inactive <em>ASO</em> (in vivo) sodium
  • HY-W570887
    LNA-A(Bz) amidite

    		DNA/RNA Synthesis Others
    LNA-A(Bz) amidite can be used for synthesis of ASOs (antisense oligonucleotides) .
    LNA-A(Bz) amidite
  • HY-P2742
    Ascorbate oxidase

    ASO

    		 Endogenous Metabolite Metabolic Disease
    Ascorbate oxidase, also known as vitamin C oxidase, is a REDOX enzyme involved in the regulation of extracellular matrix. Ascorbate oxidase catalyzes the reaction of ascorbic acid and oxygen to produce dehydroascorbic acid .
    Ascorbate oxidase
  • HY-137501
    306-O12B-3

    		Others Others
    306-O12B-3 is a lipidoid that can efficiently deliver ASO both in vitro and in vivo. 306-O12B-3 is used to transport small molecule drugs across the blood-brain barrier (BBB) .
    306-O12B-3
  • HY-148687
    SPC5001

    		Others Cardiovascular Disease
    SPC5001 is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
    SPC5001
  • HY-148687A
    SPC5001 sodium

    		Others Cardiovascular Disease
    SPC5001 sodium is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 sodium can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
    SPC5001 sodium
  • HY-157261
    UNC2383

    		Others Others
    UNC2383 is an oligonucleotide enhancing compound that can enhance effects of antisense oligonucleotides (ASOs), and splice switching oligonucleotides (SSOs) .
    UNC2383
  • HY-132581
    Tadnersen

    BIIB078; IONIS-C9Rx

    		 Others Neurological Disease
    Tadnersen (BIIB078), an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
    Tadnersen
  • HY-132582
    IONIS-MAPTRx

    BIIB080; ISIS 814907

    		 Tau Protein Neurological Disease
    IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease .
    IONIS-MAPTRx
  • HY-148370A
    IONIS-FB-LRx sodium

    RG6299 sodium

    		 Complement System Others
    IONIS-FB-LRx sodium is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx sodium effectively reduces circulating levels of CFB, and can be used for geographic atrophy (GA) research .
    IONIS-FB-LRx sodium
  • HY-148370
    IONIS-FB-LRx

    RG6299

    		 Complement System Others
    IONIS-FB-LRx is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx effectively reduces circulating levels of CFB. IONIS-FB-LRx can be used for geographic atrophy (GA) research .
    IONIS-FB-LRx
  • HY-148130
    Rugonersen

    RG6091; RO7248824

    		 E1/E2/E3 Enzyme Others
    Rugonersen (RG6091; RO7248824) is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
    Rugonersen
  • HY-W570885
    2'-O-MOE-rC

    		DNA/RNA Synthesis Others
    2'-O-MOE-rC is a 2'-O-MOE modified nucleoside. 2'-O-MOE-rC can be used for synthesis of DNA .
    2'-O-MOE-rC
  • HY-136151
    UNC10217938A
    1 Publications Verification

    		 Others Others
    UNC10217938A is a 3-deazapteridine analog with strong oligonucleotide enhancing effects. UNC10217938A enhances oligonucleotides effects by modulating their intracellular trafficking and release from endosomes. UNC10217938A also enhances the effects of antisense and siRNA oligonucleotides .
    UNC10217938A
  • HY-108764
    Mipomersen sodium

    ISIS 301012

    		 HCV Metabolic Disease
    Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
    Mipomersen sodium

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

  

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

  

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: