1. Search Result
Search Result
Results for "

All sglt2 Inhibitors

" in MedChemExpress (MCE) Product Catalog:

339

Inhibitors & Agonists

155

Screening Libraries

28

Fluorescent Dye

17

Biochemical Assay Reagents

27

Peptides

9

MCE Kits

10

Inhibitory Antibodies

41

Natural
Products

4

Recombinant Proteins

53

Isotope-Labeled Compounds

7

Click Chemistry

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-10450S

    BMS-512148-d5

    SGLT Metabolic Disease Cancer
    Dapagliflozin-d5 is a deuterium labeled Dapagliflozin. Dapagliflozin is a competitive SGLT2 inhibitor[1].
    Dapagliflozin-d5
  • HY-15409
    Empagliflozin
    Maximum Cited Publications
    49 Publications Verification

    BI 10773

    SGLT Metabolic Disease
    Empagliflozin (BI 107730 is a selective sodium glucose cotransporter-2 (SGLT-2) inhibitor with an IC50 of 3.1 nM for human SGLT-2 .
    Empagliflozin
  • HY-123011

    SHR3824

    SGLT Metabolic Disease
    Henagliflozin (SHR3824) is a potent selective sodium-glucose co-transporter 2 (SGLT2) inhibitor with the IC50 values of 2.38 and 4324 nM for human SGLT2 and SGLT1, respectively. Henagliflozin can be used in diabetes research .
    Henagliflozin
  • HY-10451S

    JNJ 28431754-d4

    SGLT Metabolic Disease Cancer
    Canagliflozin-d4 is a deuterium labeled Canagliflozin. Canagliflozin is a selective SGLT2 inhibitor[1].
    Canagliflozin-d4
  • HY-13414

    Remogliflozin A

    SGLT Metabolic Disease
    Remogliflozin is a potent and selective inhibitor of SGLT2 (sodium-glucose cotransporter 2) with Kis of 12.4 and 26 nM for human and rat SGLT2, respectively. Remogliflozin is the active form of Remogliflozin etabonate(HY-14945) .
    Remogliflozin
  • HY-14894
    Ipragliflozin
    5 Publications Verification

    ASP1941

    SGLT Metabolic Disease
    Ipragliflozin (ASP1941) is an orally active and selective SGLT2 inhibitor with IC50s of 7.38 and 1876 nM, 6.73 and 1166 nM, 5.64 and 1380 nM for human SGLT2 and SGLT1, rat SGLT2 and SGLT1, mouse SGLT2 and SGLT1, respectively. Antidiabetic agent .
    Ipragliflozin
  • HY-10449A

    TS 071 hydrate

    SGLT Metabolic Disease
    Luseogliflozin (TS 071) hydrate is a selective potent and orally active second-generation sodium-glucose co-transporter 2 (SGLT2) inhibitor with an IC50 of 2.26 nM. Luseogliflozin hydrate can be used for the research of type 2 diabetes mellitus (T2DM) [2].
    Luseogliflozin hydrate
  • HY-109018A
    Velagliflozin proline
    1 Publications Verification

    SGLT Metabolic Disease
    Velagliflozin proline is an oral sodium-glucose cotransporter 2 (SGLT2) inhibitor with antidiabetic activity. Velagliflozin proline reduces renal glucose reabsorption and stimulates glycosuria, which lowers blood sugar and insulin concentrations .
    Velagliflozin proline
  • HY-14902

    CSG452

    SGLT Metabolic Disease
    Tofogliflozin(CSG-452) is a potent and highly specific sodium/glucose cotransporter 2(SGLT2) inhibitor with Ki values of 2.9, 14.9, and 6.4 nM for human, rat, and mouse SGLT2.
    Tofogliflozin
  • HY-106158

    SGLT Metabolic Disease
    T-1095 is a selective and orally active Na +-glucose cotransporter (SGLT) inhibitor with IC50s of 22.8 µM and 2.3 µM for human SGLT1 and SGLT2, respectively. T-1095 can be used for diabetes research .
    T-1095
  • HY-109092

    LIK066

    SGLT Metabolic Disease Inflammation/Immunology
    Licogliflozin is a sodium glucose cotransporter (SGLT1 and SGLT2) inhibitor.
    Licogliflozin
  • HY-116223

    SGLT Metabolic Disease
    Tianagliflozin is a sodium/glucose cotransporter 2 (SGLT-2) inhibitor with potential for investigation in type 2 diabetes .
    Tianagliflozin
  • HY-15461
    Ertugliflozin
    1 Publications Verification

    PF-04971729

    SGLT Metabolic Disease
    Ertugliflozin (PF-04971729) is a potent, selective and orally active inhibitor of the sodium-dependent glucose cotransporter 2 (SGLT2), with an IC50 of 0.877 nM for h-SGLT2 . Has the potential for the treatment of type 2 diabetes mellitus [2].
    Ertugliflozin
  • HY-15461A
    Ertugliflozin L-pyroglutamic acid
    1 Publications Verification

    PF-04971729 L-pyroglutamic acid

    SGLT Metabolic Disease
    Ertugliflozin L-pyroglutamic acid (PF-04971729 L-pyroglutamic acid) is a potent, selective and orally active inhibitor of the sodium-dependent glucose cotransporter 2 (SGLT2), with an IC50 of 0.877 nM for h-SGLT2 . Has the potential for the treatment of type 2 diabetes mellitus [2].
    Ertugliflozin L-pyroglutamic acid
  • HY-15516
    Sotagliflozin
    5+ Cited Publications

    LX-4211; LP-802034

    SGLT Metabolic Disease
    Sotagliflozin (LX-4211) is a potent dual SGLT2/1 inhibitor. Antidiabetic agents.
    Sotagliflozin
  • HY-109018
    Velagliflozin
    1 Publications Verification

    SGLT Metabolic Disease
    Velagliflozin is an orally available sodium-glucose cotransporter 2 (SGLT2) inhibitor, with anti-diabetic activity.
    Velagliflozin
  • HY-15409S

    BI 10773-d4

    SGLT Metabolic Disease
    Empagliflozin-d4 is deuterium labeled Empagliflozin. Empagliflozin (BI 107730 is a selective sodium glucose cotransporter-2 (SGLT-2) inhibitor with an IC50 of 3.1 nM for human SGLT-2[1].
    Empagliflozin-d4
  • HY-15461S

    PF-04971729-d5

    SGLT Metabolic Disease
    Ertugliflozin-d5 is the deuterium labeled Ertugliflozin[1]. Ertugliflozin (PF-04971729) is a potent, selective and orally active inhibitor of the sodium-dependent glucose cotransporter 2 (SGLT2), with an IC50 of 0.877 nM for h-SGLT2[2]. Has the potential for the treatment of type 2 diabetes mellitus[3].
    Ertugliflozin-d5
  • HY-138944

    SGLT Metabolic Disease
    SGLT1/2-IN-1 is a dual SGLT1/SGLT2 inhibitor extract from WO2015032272A1, compound 2 .
    <em>SGLT</em>1/<em>2</em>-IN-1
  • HY-109144

    DWP-16001

    SGLT Metabolic Disease
    Enavogliflozin (DWP-16001), an antidiabetic agent, is an orally active, best-in-class and selective sodium-glucose cotransporter-2 (SGLT-2) inhibitor [2] .
    Enavogliflozin
  • HY-13413
    Tofogliflozin (hydrate)
    3 Publications Verification

    CSG-452 hydrate

    SGLT Reactive Oxygen Species Metabolic Disease
    Tofogliflozin hydrate (CSG-452 hydrate) is a potent and highly specific sodium/glucose cotransporter 2 (SGLT2) inhibitor with an IC50 of 2.9 nM and Ki values of 2.9 nM, 14.9 nM, and 6.4 nM for human, rat, and mouse SGLT2 . Tofogliflozin partially inhibits high glucose-induced reactive oxyen species (ROS) generation in tubular cells [2].
    Tofogliflozin (hydrate)
  • HY-117010

    Cytochrome P450 HSV SGLT Infection Metabolic Disease
    Kushenol K, a flavonoid antioxidant isolated from the roots of Sophora flavescens. Kushenol K is a cytochrome P-450 3A4 (CYP3A4) inhibitor with a Ki value of 1.35 μM . Kushenol K shows weak antiviral activity against HSV-2 (EC50 of 147 μM) [2]. Kushenol K also inhibits the activity of SGLT1 and SGLT2 .
    Kushenol K
  • HY-101782

    SGLT Metabolic Disease
    HSK0935 is a potent, highly selective and orally available SGLT2 inhibitor with an IC50 of 1.3 nM. Antihyperglycemic activities .
    HSK0935
  • HY-153113

    DJT1116PG

    SGLT Endocrinology
    Rongliflozin (DJT1116PG) is a selective and orally active inhibitor of sodium-glucose co-transporter-2 (SGLT-2). Rongliflozin can be used for the research of type 2 diabetes mellitus (T2DM) .
    Rongliflozin
  • HY-145357

    SGLT Metabolic Disease
    SGLT1/2-IN-2 demonstrates potent dual inhibitory activities (IC50 = 96 nM for SGLT1 and IC50 = 1.3 nM for SGLT2).
    <em>SGLT</em>1/<em>2</em>-IN-<em>2</em>
  • HY-14894A
    Ipragliflozin (L-Proline)
    5 Publications Verification

    SGLT Metabolic Disease
    Ipragliflozin (L-Proline) is a highly potent and selective SGLT2 inhibitor with an IC50 of 2.8 nM; little and NO potency for SGLT1/3/4/5/6.
    Ipragliflozin (L-Proline)
  • HY-10451
    Canagliflozin
    25+ Cited Publications

    JNJ 28431754

    SGLT Metabolic Disease Cancer
    Canagliflozin (JNJ 28431754) is a selective SGLT2 inhibitor with IC50s of 2 nM, 3.7 nM, and 4.4 nM for mSGLT2, rSGLT2, and hSGLT2 in CHOK cells, respectively .
    Canagliflozin
  • HY-I0383
    Canagliflozin hemihydrate
    25+ Cited Publications

    JNJ 28431754 hemihydrate

    SGLT Metabolic Disease Cancer
    Canagliflozin hemihydrate (JNJ28431754 hemihydrate) is a selective SGLT2 inhibitor with IC50s of 2 nM, 3.7 nM, and 4.4 nM for mSGLT2, rSGLT2, and hSGLT2 in CHOK cells, respectively .
    Canagliflozin hemihydrate
  • HY-12608

    JNJ-39933673

    SGLT Metabolic Disease
    TA-1887 (JNJ-39933673) is a highly potent, selective and orally active SGLT2 inhibitor (IC50: 1.4 nM) with antihyperglycemic effects. TA-1887 can be used in the research of diabetes [2].
    TA-1887
  • HY-123797

    SGLT Metabolic Disease
    KGA-2727 is a first selective, high-affinity and orally active SGLT1 inhibitor with Kis of 97.4 nM and 43.5 nM for human and rat SGLT1, respectively. The selectivity ratios (Ki for SGLT2/Ki for SGLT1) of KGA-2727 are 140 (human) and 390 (rat). KGA-2727 has antidiabetic efficacy .
    KGA-2727
  • HY-109018B

    SGLT Metabolic Disease
    Velagliflozin proline hydrate is the clinical form of Velagliflozin (HY-109018). Velagliflozin is an oral sodium-glucose cotransporter 2 (SGLT2) inhibitor with antidiabetic activity. Velagliflozin reduces renal glucose reabsorption and stimulates glycosuria, which lowers blood sugar and insulin concentrations .
    Velagliflozin proline hydrate
  • HY-10451S2

    JNJ 28431754-d6

    SGLT
    Canagliflozin-d6 is the deuterium labeled Canagliflozin[1]. Canagliflozin (JNJ 28431754) is a selective SGLT2 inhibitor with IC50s of 2 nM, 3.7 nM, and 4.4 nM for mSGLT2, rSGLT2, and hSGLT2 in CHOK cells, respectively[2].
    Canagliflozin-d6
  • HY-10450
    Dapagliflozin
    30+ Cited Publications

    BMS-512148

    SGLT Metabolic Disease Cancer
    Dapagliflozin (BMS-512148), a new type of agent used to treat diabetes mellitus (DM), is a competitive sodium/glucose cotransporter 2 (SGLT2) inhibitor, which results in excretion of glucose into the urine . Dapagliflozin induces HIF1 expression and attenuates renal IR injury [2].
    Dapagliflozin
  • HY-101122

    SGLT Metabolic Disease
    LX2761 is chemically stable and potent inhibitor against sodium-dependent glucose cotransporter 1 (SGLT1) and SGLT2 in vitro with IC50s of 2.2 nM and 2.7nM for hSGLT1 and hSGLT2, but displays specific SGLT1 inhibition in the gastrointestinal (GI) tract .
    LX2761
  • HY-12611

    GW-869682X

    SGLT Metabolic Disease
    Sergliflozin etabonate (GW-869682X) is a potent and orally active sodium glucose cotransporter (SGLT2) inhibitor. Sergliflozin etabonate shows antidiabetic and antihyperglycemic effects. Sergliflozin etabonate significantly reduces non-fasting blood glucose levels in diabetic mice. Sergliflozin etabonate has the potential for the research of diabetes .
    Sergliflozin etabonate
  • HY-17638
    Mizagliflozin
    2 Publications Verification

    DSP-3235 free base; KGA-3235 free base; GSK-1614235 free base

    SGLT Metabolic Disease
    Mizagliflozin (DSP-3235 free base) is a potent, orally active and selective SGLT1 inhibitor, with a Ki of 27 nM for human SGLT1. Mizagliflozin displays 303-fold selectivity over SGLT2. Mizagliflozin is used as an antidiabetic agent that can modify postprandial blood glucose excursion. Mizagliflozin also exhibits potential in the amelioration of chronic constipation .
    Mizagliflozin
  • HY-14945

    GSK189075

    SGLT Metabolic Disease
    Remogliflozin etabonate (GSK189075) is an orally active, selective and low-affinity sodium glucose cotransporter (SGLT2) inhibitor with Ki values of 1.95 μM, 2.14 μM, 43.1 μM, 8.57 μM for hSGLT2, rSGLT2, hSGLT1, rSGLT1, respectively. Remogliflozin etabonate is a proagent based on benzylpyrazole glucoside and is metabolized to its active form, Remogliflozin, in the body. Remogliflozin etabonate exhibits antidiabetic efficacy in rodent models .
    Remogliflozin etabonate
  • HY-N0142
    Phloretin
    10+ Cited Publications

    NSC 407292; RJC 02792

    SGLT Endogenous Metabolite GLUT Metabolic Disease Cancer
    Phloretin (NSC 407292; RJC 02792) is a flavonoid extracted from Malus pumila Mill., has anti-inflammatory activities. Phloridzin is a specific, competitive and orally active inhibitor of sodium/glucose cotransporters in the intestine (SGLT1) and kidney (SGLT2). Phloretin inhibits Yeast-made GLUT1 as well as Human erythrocyte GLUT1 with IC50values of 49 μM and 61 μM, respectively .Phloretin has the potential for the treatment of rheumatoid arthritis (RA) and allergic airway inflammation .
    Phloretin
  • HY-10450A

    BMS-512148 (2S)-1,2-propanediol, hydrate

    SGLT Metabolic Disease Cancer
    Dapagliflozin ((2S)-1,2-propanediol, hydrate) is the S-enantiomer of Dapagliflozin 1,2-propanediol, hydrate. Dapagliflozin ((2S)-1,2-propanediol, hydrate), a new type of agent used to treat diabetes mellitus (DM), is a competitive sodium/glucose cotransporter 2 (SGLT2) inhibitor, which results in excretion of glucose into the urine . Dapagliflozin ((2S)-1,2-propanediol, hydrate) induces HIF1 expression and attenuates renal IR injury [2].
    Dapagliflozin ((<em>2</em>S)-1,<em>2</em>-propanediol, hydrate)
  • HY-N0142R

    NSC 407292 (Standard); RJC 02792 (Standard)

    SGLT Endogenous Metabolite GLUT Metabolic Disease Cancer
    Phloretin (Standard) is the analytical standard of Phloretin. This product is intended for research and analytical applications. Phloretin (NSC 407292; RJC 02792) is a flavonoid extracted from Malus pumila Mill., has anti-inflammatory activities. Phloridzin is a specific, competitive and orally active inhibitor of sodium/glucose cotransporters in the intestine (SGLT1) and kidney (SGLT2). Phloretin inhibits Yeast-made GLUT1 as well as Human erythrocyte GLUT1 with IC50values of 49 μM and 61 μM, respectively .Phloretin has the potential for the treatment of rheumatoid arthritis (RA)?and allergic airway inflammation .
    Phloretin (Standard)
  • HY-W004500

    Endogenous Metabolite Apoptosis Metabolic Disease
    All-trans-retinal is an vitamin A metabolite in the retina, and is produced following photo-isomerization of the visual chromophore 11-cis-Retinal. All-trans-retinal is cleared from photoreceptors by ATP-binding cassette transporter (ABCA4) and all-trans-retinol dehydrogenase (RDH). All-trans-retinal induces Bax activation via DNA damage to mediate retinal cell apoptosis .
    <em>All</em>-trans-retinal
  • HY-N7495

    Anhydrovitamin A

    Endogenous Metabolite Metabolic Disease
    all-trans-Anhydro Retinol (Anhydrovitamin A) is a metabolite of Vitamin A. all-trans-Anhydro Retinol is used in synthetic multivitamin preparations .
    <em>all</em>-trans-Anhydro Retinol
  • HY-107494A

    All-trans 4-Keto Retinoic Acid

    Endogenous Metabolite Metabolic Disease
    all-trans-4-Oxoretinoic acid, an active metabolite of vitamin A, induces gene transcription via binding to nuclear retinoic acid receptors (RARs).
    <em>all</em>-trans-4-Oxoretinoic acid
  • HY-D0987

    Calmodulin Others
    Stains-All, a cationic carbocyanine dye, is a convenient probe to study the structural features of the individual calcium-binding sites of calmodulin (CaM) and related calcium-binding proteins (CaBP) [2].
    Stains-<em>All</em>
  • HY-115437

    Biochemical Assay Reagents Others
    Methyl all-cis-7,10,13,16,19-docosapentaenoate is a long-chain polyunsaturated omega-3 fatty acid esters.
    Methyl <em>all</em>-cis-7,10,13,16,19-docosapentaenoate
  • HY-N7864

    All-cis-4,7,10,13,16-Docosapentaenoic acid; Osbond acid

    Biochemical Assay Reagents Others
    Docosapentaenoic acid (DPA) is a 22-carbon fatty acid found in fish oil. It is a minor component of total serum unsaturated fatty acids in humans, ranging from 0.1% to 1%, and increasing with dietary supplementation. all-cis-4,7,10,13,16-DPA, also known as Austrian acid, is an isomer of DPA. It is an omega-6 fatty acid formed by the extension and desaturation of arachidonic acid. During fatty acid desaturase syndrome, levels of this fatty acid may be reduced, which may affect development. Upregulated hepatic elongate expression of very long fatty acid protein 6 and elevated levels of very long chain fatty acids, including all-cis 4,7,10,13,16-DPA, are characteristic of nonalcoholic steatohepatitis, a precancerous disease of hepatocellular carcinoma.
    <em>all</em>-cis-4,7,10,13,16-Docosapentaenoic acid
  • HY-124573

    TH-3424

    DNA Alkylator/Crosslinker Cancer
    OBI-3424 (TH-3424) is a proagent that is selectively converted by AKR1C3 (aldo-keto reductase 1C3) to a potent DNA-alkylating agent. OBI-3424 can be used for hepatocellular carcinoma, castrate-resistant prostate cancer, and acute lymphoblastic leukemia (ALL) research .
    OBI-3424
  • HY-B1342S2

    Vitamin A1-d4; All-trans-Retinol-d4

    Endogenous Metabolite Metabolic Disease
    Retinol-d4 (Vitamin A1-d4; all-trans-Retinol-d4) is the deuterium labeled Vitamin A. Retinol is an endogenous metabolite.
    Retinol-d4
  • HY-A0143A

    DGLA sodium; All-cis-8,11,14-Eicosatrienoic acid sodium

    Endogenous Metabolite Cardiovascular Disease Inflammation/Immunology Cancer
    Dihomo-γ-linolenic acid (DGLA; all-cis-8,11,14-Eicosatrienoic acid) sodium is a 20-carbon ω-6 fatty acid, with anti-inflammatory and anti-proliferative activities. Dihomo-γ-linolenic acid (sodium) attenuates atherosclerosis in the apolipoprotein E deficient mouse model system [2] .
    Dihomo-γ-linolenic acid sodium
  • HY-148530

    PROTACs CDK Cancer
    YX-2-107 is a PROTAC (IC50= 4.4 nM) that selectively degrades CDK6. YX-2-107 effectively inhibits RB phosphorylation and FOXM1 expression in vitro and inhibits the development of Ph + ALL in rats. YX-2-107 can be used in the study of Ph chromosome-positive (Ph +) acute lymphoblastic leukemia (ALL) .
    YX-<em>2</em>-107
  • HY-136175
    Revumenib
    4 Publications Verification

    SNDX-5613

    Epigenetic Reader Domain Cancer
    Revumenib (SNDX-5613) is a potent and specific Menin-MLL inhibitor with a binding Ki of 0.149 nM and a cell based IC50 of 10-20 nM. Revumenib can be used for the research of MLL-rearranged (MLL-r) acute leukemias, including acute lymphoblastic leukemia (ALL) and acute myeloid leukemia (AML) .
    Revumenib
  • HY-145696

    PROTACs JAK Inflammation/Immunology Cancer
    SJ10542 is a potent and selective JAK2/3 directing phenyl glutarimide (PG)-PROTAC with DC50s of 14, 11, and 24 nM for JAK2, JAK3, and JAK2-fusion ALL, respectively. SJ10542 utilizes a PG ligand as the cereblon (CRBN) recruiter .
    SJ10542
  • HY-W145524

    Phenyl 3-O-Allyl-2,4,6-tri-O-benzyl-1-thio-β-D-galactopyranoside

    Biochemical Assay Reagents Others
    Gal[246Bn,3All]-β-SPh is a biochemical reagent that can be used as a biological material or organic compound for life science related research.
    Gal[246Bn,3<em>All</em>]-β-SPh
  • HY-151902

    PROTACs JAK Cancer
    SJ988497 is a PROTAC JAK2 degrader. SJ988497 potently inhibits CRLF2-rearranged (CRLF2r) cell proliferation and degrades the CRBN neosubstrate GSPT1. SJ988497 consists of a Ruxolitinib (HY-50856) derivative, linker, and CRBN ligand Pomalidomide. SJ988497 can be used in the research of acute lymphoblastic leukemia (ALL) .
    SJ988497
  • HY-117596
    UNC569
    1 Publications Verification

    TAM Receptor Cancer
    UNC569 is a potent, reversible, ATP-competitive and orally active Mer kinase inhibitor with an IC50 of 2.9 nM and a Ki of 4.3 nM. UNC569 also inhibits Axl and Tyro3 with IC50s of 37 nM and 48 nM, respectively. UNC569 can be used for acute lymphoblastic leukemia (ALL) and atypical teratoid/rhabdoid tumors research [2]
    UNC569
  • HY-B1342S3

    Vitamin A1-13C3; All-trans-Retinol-13C3

    Isotope-Labeled Compounds Others
    Retinol- 13C3 (Vitamin A1- 13C3; all-trans-Retinol- 13C3) is a 13C-labeled Vitamin A/Retinol (HY-B1342). Retinol is an endogenous metabolite.
    Retinol-13C3
  • HY-N2302
    Fucoxanthin
    5+ Cited Publications

    All-trans-Fucoxanthin

    Others Metabolic Disease Inflammation/Immunology Cancer
    Fucoxanthin is a marine carotenoid and shows anti-obesity, anti-diabetic, anti-oxidant, anti-inflammatory and anticancer activities.
    Fucoxanthin
  • HY-A0143S

    DGLA-d6; All-cis-8,11,14-Eicosatrienoic acid-d6

    Endogenous Metabolite Cardiovascular Disease Inflammation/Immunology Cancer
    Dihomo-γ-linolenic acid-d6 (DGLA-d6) is the deuterium labeled Dihomo-γ-linolenic acid. Dihomo-γ-linolenic acid (all-cis-8,11,14-Eicosatrienoic acid) is a 20-carbon ω-6 fatty acid, with anti-inflammatory and anti-proliferative activities. Dihomo-γ-linolenic acid attenuates atherosclerosis in the apolipoprotein E deficient mouse model system[1][2][3].
    Dihomo-γ-linolenic acid-d6
  • HY-130640

    E3 Ligase Ligand-Linker Conjugates Cancer
    (S,R,S)-AHPC-Me-C7 ester is a E3 ligase ligand-linker conjugate used to synthesise BCL-XL PROTAC degraders .
    (S,R,S)-AHPC-Me-C7 ester
  • HY-14649
    Retinoic acid
    45+ Cited Publications

    Vitamin A acid; All-trans-Retinoic acid; ATRA

    Organoid RAR/RXR PPAR Endogenous Metabolite Autophagy Cancer
    Retinoic acid is a metabolite of vitamin A that plays important roles in cell growth, differentiation, and organogenesis. Retinoic acid is a natural agonist of RAR nuclear receptors, with IC50s of 14 nM for RARα/β/γ. Retinoic acid bind to PPARβ/δ with Kd of 17 nM. Retinoic acid acts as an inhibitor of transcription factor Nrf2 through activation of retinoic acid receptor alpha.
    Retinoic acid
  • HY-B1960
    Canthaxanthin
    2 Publications Verification

    E 161g; All-trans-Canthaxanthin

    Reactive Oxygen Species Endogenous Metabolite Inflammation/Immunology Cancer
    Canthaxanthin is a red-orange carotenoid with various biological activities, such as antioxidant, antitumor properties.
    Canthaxanthin
  • HY-122613

    SGLT Metabolic Disease
    YM543 free base is a potent and orally active sodium-glucose cotransporter (SGLT) 2 inhibitor. YM543 free base reduces blood glucose levels. YM543 free base can be used in research of diabetes [2].
    YM543 free base
  • HY-101541

    Methyl docosahexaenoate; All cis-DHA methyl ester

    Others Neurological Disease
    Docosahexaenoic Acid methyl ester is a methylated docosahexaenoic acid analog which can be intercalated into membrane phospholipids without being oxidized or hydrolyzed.
    Docosahexaenoic acid methyl ester
  • HY-10449

    TS 071

    SGLT Metabolic Disease
    Luseogliflozin (TS 071) is a potent, selective, orally active sodium-dependent glucose cotransporter (SGLT) 2 inhibitor, with an IC50 of 2.26 nM, about 1765-fold selectivity over SGLT1 (IC50, 3990 nM). Luseogliflozin has the protential for researching type 2 diabetes.
    Luseogliflozin
  • HY-N7833

    Heneicosapentaenoic acid

    Biochemical Assay Reagents Others
    Heneicosapentaenoic Acid (HPA) is a 21:5 omega-3 fatty acid found in trace amounts in the green alga B. pennata and in fish oils. Its chemical composition is similar to eicosapentaenoic acid (EPA), except that a carbon is extended at the carboxy terminus, placing the first double bond at the δ6 position. HPA can be used to study the importance of double bond position in omega-3 fatty acids. It incorporates phospholipids and triacylglycerols in vivo with the same efficiency as EPA and docosahexaenoic acid, and exhibits a strong inhibitory effect on the synthesis of arachidonic acid from linoleic acid. HPA is a poor substrate for prostaglandin H synthase (PGHS) (cyclooxygenase) and 5-lipoxygenase, but retains the ability to rapidly inactivate PGHS.
    (<em>all</em>-Z)-6,9,12,15,18-Heneicosapentaenoic Acid
  • HY-A0143
    Dihomo-γ-linolenic acid
    2 Publications Verification

    DGLA; All-cis-8,11,14-Eicosatrienoic acid

    Endogenous Metabolite Cardiovascular Disease Inflammation/Immunology Cancer
    Dihomo-γ-linolenic acid (DGLA) is a 20-carbon ω-6 fatty acid, with anti-inflammatory and anti-proliferative activities. Dihomo-γ-linolenic acid attenuates atherosclerosis in the apolipoprotein E deficient mouse model system [2] .
    Dihomo-γ-linolenic acid
  • HY-108604

    Bis II

    PKC Metabolic Disease Cancer
    Bisindolylmaleimide II is a general inhibitor of all PKC subtypes .
    Bisindolylmaleimide II
  • HY-114227

    DNA Stain Inflammation/Immunology
    Hexidium iodide, a fluorescent nucleic binding acid stain (excitation/emission ~ 518/600 nm), permeants to mammalian cells and selectively stains almost all gram-positive bacteria. Hexidium iodide can bind to the DNA of all bacteria after permeabilization by EDTA [2].
    Hexidium iodide
  • HY-14649G

    Vitamin A acid; All-trans-Retinoic acid; ATRA

    RAR/RXR Cancer
    Retinoic acid (Vitamin A acid) (GMP) is Retinoic acid (HY-14649) produced by using GMP guidelines. GMP small molecules works appropriately as an auxiliary reagent for cell therapy manufacture. Retinoic acid is an agonist of RAR nuclear receptors [2] .
    Retinoic acid
  • HY-14649R
    Retinoic acid (Standard)
    45+ Cited Publications

    Vitamin A acid (Standard); All-trans-Retinoic acid (Standard); ATRA (Standard)

    RAR/RXR PPAR Endogenous Metabolite Autophagy Cancer
    Retinoic acid (Standard) is the analytical standard of Retinoic acid. This product is intended for research and analytical applications. Retinoic acid is a metabolite of vitamin A that plays important roles in cell growth, differentiation, and organogenesis. Retinoic acid is a natural agonist of RAR nuclear receptors, with IC50s of 14 nM for RARα/β/γ. Retinoic acid bind to PPARβ/δ with Kd of 17 nM. Retinoic acid acts as an inhibitor of transcription factor Nrf2 through activation of retinoic acid receptor alpha.
    Retinoic acid (Standard)
  • HY-D0889
    Glycylglycine
    1 Publications Verification

    Endogenous Metabolite Metabolic Disease
    Glycylglycine is the simplest of all peptides and could function as a gamma-glutamyl acceptor.
    Glycylglycine
  • HY-D1341

    Fluorescent Dye Cancer
    Coumberone is a metabolic fluorogenic probe, and isoform-selective substrate for all AKR1C isoforms. Coumberone can be reduced by all four members of the AKR1C family to its fluorescent alcohol coumberol. Coumberone can be used for the research of AKR1C [2].
    Coumberone
  • HY-13022
    CC-401 hydrochloride
    5 Publications Verification

    CC401 HCl

    JNK Cancer
    CC-401 hydrochloride is a potent inhibitor of all three forms of JNK with Ki of 25 to 50 nM.
    CC-401 hydrochloride
  • HY-13022A

    JNK Cancer
    CC-401 is a potent inhibitor of all three forms of JNK with Ki of 25 to 50 nM.
    CC-401
  • HY-14531
    Talarozole
    15+ Cited Publications

    R115866

    RAR/RXR Cytochrome P450 Autophagy Inflammation/Immunology
    Talarozole (R115866) is an oral systemic all-trans retinoic acid metabolism blocking agent (RAMBA) which increases intracellular levels of endogenous all-trans retinoic acid (RA). Talarozole inhibits both CYP26A1 and CYP26B1 with IC50s of 5.4 and 0.46 nM, respectively.
    Talarozole
  • HY-P9906
    Bevacizumab
    20+ Cited Publications

    Anti-Human VEGF, Humanized Antibody

    VEGFR Cancer
    Bevacizumab, a humanized IgG1 monoclonal antibody, specifically binds to all VEGF-A isoforms with high affinity.
    Bevacizumab
  • HY-113159

    Endogenous Metabolite Metabolic Disease
    Docosapentaenoic acid (22n-3) is a component of phospholipids found in all animal cell membranes.
    Docosapentaenoic acid 22n-3
  • HY-121324

    Others Others
    Prometryn could improves the control of all weed species and increased lint yield compared with the systems .
    Prometryn
  • HY-N2318

    TRP Channel Neurological Disease
    Podocarpic acid is a natural product, which has the best all-round positive effect and acts as a novel TRPA1 activator.
    Podocarpic acid
  • HY-P9906A
    Bevacizumab (PBS)
    20+ Cited Publications

    Anti-Human VEGF, Humanized Antibody (PBS)

    VEGFR Cancer
    Bevacizumab, a humanized IgG1 monoclonal antibody, specifically binds to all VEGF-A isoforms with high affinity [2].
    Bevacizumab (PBS)
  • HY-P5461

    Bacterial Others
    CHRG01 is a biological active peptide. (CHRG01 is derived from human b-defensin 3 (hBD3) C-terminal amino acids 54 to 67, with all Cys residues substituted with Ser. This substitution removes all disulfide bond linkages within the sequence. CHRG01, like hBD3, displays electrostatic-dependent antimicrobial properties.)
    CHRG01
  • HY-12808
    STF-118804
    1 Publications Verification

    NAMPT Apoptosis Cancer
    STF-118804 is a highly specific NAMPT inhibitor; reduces the viability of most B-ALL cell lines with IC50 <10 nM.
    STF-118804
  • HY-130573

    DimethylAllyl diphosphate

    Others Metabolic Disease
    DMAPP (Dimethylallyl pyrophosphate) is an isoprenoid precursor. DMAPP, as an isomer of isopentenyl pyrophosphate (IPP), exists in virtually all life forms .
    DMAPP
  • HY-P99261

    OMP 21M18; Human Anti-TNFRSF10B Recombinant Antibody

    Notch Cancer
    Demcizumab (OMP 21M18) is an anti-DLL4 monoclonal antibody. Demcizumab is a potent inhibitor of the Notch pathway. Demcizumab alone or in combination with chemotherapy is effective in various cancer models [2] .
    Demcizumab
  • HY-14817

    PPM 204

    PPAR Metabolic Disease
    Indeglitazar (PPM 204) is an orally available PPAR pan-agonist for all three PPARα, PPARδ and PPARγ .
    Indeglitazar
  • HY-13701
    Nelarabine
    1 Publications Verification

    506U78; GW 506U78; Nelzarabine

    Nucleoside Antimetabolite/Analog Apoptosis Cancer
    Nelarabine (506U78) is a nucleoside analogue and can be used for the research of T cell acute lymphoblastic leukemia (T-ALL) .
    Nelarabine
  • HY-Y0258
    Benzocaine
    1 Publications Verification

    Sodium Channel Bacterial Neurological Disease
    Benzocaine shares a common receptor with all othe rLAs in the voltage-gated Na + channel, with an IC50 of 0.8 mM tested with a potential of +30 mV.
    Benzocaine
  • HY-107383

    (Rac)-Sapropterin

    NO Synthase Endogenous Metabolite Inflammation/Immunology
    Tetrahydrobiopterin ((Rac)-Sapropterin) is a cofactor of the aromatic amino acid hydroxylases enzymes and also acts as an essential cofactor for all nitric oxide synthase (NOS) isoforms.
    Tetrahydrobiopterin
  • HY-130573A

    DimethylAllyl diphosphate triammonium

    Others Metabolic Disease
    DMAPP (Dimethylallyl diphosphate) triammonium is an isoprenoid precursor. DMAPP triammonium, as an isomer of isopentenyl pyrophosphate (IPP), exists in virtually all life forms .
    DMAPP triammonium
  • HY-E70194

    V8 protease; Glu-C

    Ser/Thr Protease Others
    Endoproteinase GluC (V8 protease) is a serine proteinase. Endoproteinase GluC is able to hydrolyze some serpins and all classes of mammalian immunoglobulins .
    Endoproteinase Glu-C
  • HY-N0913

    Endogenous Metabolite Others
    Manninotriose is a novel and important player in the RFO(Raffinose family oligosaccharides) metabolism of red dead deadnettle; potential to improve the side effects of MTX for ALL treatment.
    Manninotriose
  • HY-P1486

    Endogenous Metabolite Cardiovascular Disease
    Angiotensinogen (1-14), human is a fragment of the renin substrate angiotensinogen. Angiotensinogen is naturally occurring substrate for renin and a precursor for all angiotensin peptides [2].
    Angiotensinogen (1-14), human
  • HY-14802

    (R)-Talarozole

    Cytochrome P450 Cancer
    Talarozole R enantiomer is a potent and selective inhibitor of cytochrome P450 26-mediated breakdown of endogenous all-trans retinoic acid for the treatment of psoriasis and acne.
    Talarozole (R enantiomer)
  • HY-14614D

    S-Adenosyl methionine iodide; Ademetionine iodide; AdoMet iodide

    Endogenous Metabolite Metabolic Disease Cancer
    S-(5'-Adenosyl)-L-methionine iodide (S-Adenosyl-L-methionine iodide) is an important methyl donor that is found in all living organisms .
    S-Adenosyl-L-methionine iodide
  • HY-P5746

    ADC Cytotoxin Others
    Suicin 65 is a class I type B lantibiotic produced by Streptococcus suis. Suicin 65 is active against all S. suis isolates .
    Suicin 65
  • HY-P5939

    Angiotensin Receptor Cardiovascular Disease
    Angiotensinogen (1-13) (human) is a fragment of the renin substrate angiotensinogen. Angiotensinogen is naturally occurring substrate for renin and a precursor for all angiotensin peptides [2].
    Angiotensinogen (1-13) (human)
  • HY-P1486A

    Endogenous Metabolite Cardiovascular Disease
    Angiotensinogen (1-14), human TFA is a fragment of the renin substrate angiotensinogen. Angiotensinogen is naturally occurring substrate for renin and a precursor for all angiotensin peptides [2].
    Angiotensinogen (1-14), human TFA
  • HY-123786

    Others Cancer
    NSC745887 (compound 25) is an anti-cancer agent. NSC745887 exhibits dose-dependent inhibition of proliferation in all 60 cancer cell lines .
    NSC745887
  • HY-114414
    HDACs/mTOR Inhibitor 1
    1 Publications Verification

    HDAC mTOR Apoptosis Cancer
    HDACs/mTOR Inhibitor 1 is a dual HDACs and mTOR inhibitor, with IC50s of 0.19 nM, 1.8 nM, 1.2 nM for HDAC1, HDAC6, mTOR, respectively. HDACs/mTOR Inhibitor 1 stimulates cell cycle arrest in G0/G1 phase and induces tumor cell apoptosis with low toxicity in vivo. HDACs/mTOR Inhibitor 1 can be used in the research of hematologic malignancies [2].
    HDACs/mTOR Inhibitor 1
  • HY-147330

    PROTACs JAK Cancer
    SJ1008030 (compound 8) is a JAK2 PROTAC which selectively degrades JAK2. SJ1008030 inhibits MHH–CALL-4 cell growth with an IC50 of 5.4 nM. SJ1008030 can be used for the research of leukemia .
    SJ1008030
  • HY-147330A

    PROTACs JAK Cancer
    SJ1008030 (compound 8) TFA is a JAK2 PROTAC which selectively degrades JAK2. SJ1008030 TFA inhibits MHH–CALL-4 cell growth with an IC50 of 5.4 nM. SJ1008030 TFA can be used for the research of leukemia .
    SJ1008030 TFA
  • HY-147330B

    PROTACs JAK Cancer
    SJ1008030 (compound 8) formic is a JAK2 PROTAC which selectively degrades JAK2. SJ1008030 formic inhibits MHH–CALL-4 cell growth with an IC50 of 5.4 nM. SJ1008030 formic can be used for the research of leukemia .
    SJ1008030 formic
  • HY-112542

    CL-287088; LL-F28249 α

    Parasite Antibiotic Infection
    Nemadectin (CL-287088), an orally active broad-spectrum endectocide, is highly efficacious against natural infections of all the major canine gastrointestinal helminthes. Anthelmintic activity .
    Nemadectin
  • HY-N11096

    Flavivirus Dengue virus Infection Cancer
    Sinococuline is a potent anti-dengue agent that is effective against all four serotypes of dengue virus (DENV). Sinococuline is also an effective tumor cell growth inhibitor [2].
    Sinococuline
  • HY-W541025

    Biochemical Assay Reagents Others
    Deoxyribonucleic acid is a polymer made of two polynucleotide chains wrapped around each other to form a double helix. Deoxyribonucleic acid is found in all dividing cells and is an essential constituent of the chromosomes .
    Deoxyribonucleic acid
  • HY-147092

    Microtubule/Tubulin Others
    Oryzalin is a dinitroaniline herbicide, binding to plant tubulin and inhibits microtubule (MT) polymerization in vitro. Oryzalin depolymerizes MTs and prevented the polymerization of new MTs at all stages of the mitotic cycle .
    Oryzalin
  • HY-121324S

    Isotope-Labeled Compounds Others
    Prometryn-d14 is the deuterium labeled Prometryn[1]. Prometryn could improves the control of all weed species and increased lint yield compared with the systems[2].
    Prometryn-d14
  • HY-U00189

    Adenosine Receptor Neurological Disease
    Sch412348 is a potent competitive antagonist of the human adenosine A2A receptor (Ki=0.6 nM) and has >1000-fold selectivity over all other adenosine receptors.
    Sch412348
  • HY-137103

    Fluorescent Dye Others
    BTC-AM is a low affinity calcium indicator. BTC-AM has substantial calcium-independent fluorescence at all excitation wavelengths. BTC-AM is readily loaded into neurons and is rapidly hydrolysed .
    BTC-AM
  • HY-P4318

    HSV Infection
    HHV-2 Envelope Glycoprotein G (552-574) is an immunodominant region of glycoprotein G (gG-2) reactive with all herpes simplex (HSV-2) sera .
    HHV-<em>2</em> Envelope Glycoprotein G (552-574)
  • HY-N9585

    Others Cancer
    Lutonarin is a antioxidant agent that can be isolated from green barley leaves. Lutonarin inhibits malonaldehyde formation from all lipids when in combination with Saponarin (HY-N5083) .
    Lutonarin
  • HY-B1342S4

    Vitamin A1-d5; All-trans-Retinol-d5

    Isotope-Labeled Compounds Others
    Retinol-d5 is the deuterium labeled Retinol[1].
    Retinol-d5
  • HY-B1342S1

    Vitamin A1-d6; All-trans-Retinol-d6

    Endogenous Metabolite Metabolic Disease
    Retinol-d6 is the deuterium labeled Vitamin A. Retinol is an endogenous metabolite.
    Retinol-d6
  • HY-B1342S

    Vitamin A1-d8; All-trans-Retinol-d8

    Endogenous Metabolite Metabolic Disease
    Retinol-d8 is the deuterium labeled Retinol. Retinol is an endogenous metabolite.
    Retinol-d8
  • HY-D0842
    Bovine Serum Albumin
    15+ Cited Publications

    Albumin bovine serum; BSA

    Biochemical Assay Reagents Others
    Bovine Serum Albumin (BSA) is a 583-residue protein consisting of three homologous all-α domains, organized in a heart-shaped structure. BSA is a globular protein that is used in numerous biochemical applications.
    Bovine Serum Albumin
  • HY-Y0258S

    Isotope-Labeled Compounds Sodium Channel Neurological Disease
    Benzocaine-d4 is the deuterium labeled Benzocaine. Benzocaine shares a common receptor with all othe rLAs in the voltage-gated Na+ channel, with an IC50 of 0.8 mM tested with a potential of +30 mV.
    Benzocaine-d4
  • HY-125652

    Antibiotic Infection
    Macrosphelide A is a macrolide antibiotic. Macrosphelide A inhibits growth of some ascomycetes, basidiomycetes, oomycetes and all four Gram-positive bacteria tested, including the medically important Staphylococcus aureus with a MIC of ≤500 μg/mL .
    Macrosphelide A
  • HY-N7139

    Benzylpenicillin

    Antibiotic Bacterial Infection
    Penicillin G is a potent penicillinantibiotic. Penicillin G can be used for bacterial infection. Penicillin G has potent activity against all Gram-positive bacteria and Gram-negative cocci [2].
    Penicillin G
  • HY-136522

    Histone Demethylase Apoptosis Cancer
    S2116, a N-alkylated tranylcypromine (TCP) derivative, is a potent lysine-specific demethylase 1 (LSD1) inhibitor. S2116 increases H3K9 methylation and reciprocal H3K27 deacetylation at super-enhancer regions. S2116 induces apoptosis in TCP-resistant T-cell acute lymphoblastic leukemia (T-ALL) cells by repressing transcription of the NOTCH3 and TAL1 genes. S2116 significantly retardes the growth of T-ALL cells in xenotransplanted mice .
    S2116
  • HY-Y0258S1

    Sodium Channel Neurological Disease
    Benzocaine-(ethyl-d5) is the deuterium labeled Benzocaine. Benzocaine shares a common receptor with all othe rLAs in the voltage-gated Na+ channel, with an IC50 of 0.8 mM tested with a potential of +30 mV.
    Benzocaine-(ethyl-d5)
  • HY-128607

    Bcl-2 Family Cancer
    Mcl1-IN-9 is a potent myeloid cell leukemia-1 (Mcl-1) Inhibitor with an IC50 of 446 nM in reengineered BCR-ABL+ B-ALL cells and a Ki of 0.03 nM .
    Mcl1-IN-9
  • HY-146809

    Galectin Cancer
    Galectin-3 is a β Galactoside specific carbohydrate recognition protein (lectin) has the ability to promote the migration of B cell precursor acute lymphoblastic leukemia (BCP-ALL) cells and withstand drug research.
    Galectin-3 antagonist <em>2</em>
  • HY-P99255

    CAT 8015; HA 22; Anti-Human CD22 Recombinant Antibody

    Antibody-Drug Conjugates (ADCs) CD22 Cancer
    Moxetumomab pasudotox (CAT 8015) is anti-CD22 immunotoxin containing an anti-CD22 Fv and Pseudomonas exotoxin. CD22 is a cell surface receptor expressed on a variety of malignant B-cells. Moxetumomab pasudotox can be used in the research of hairy cell leukemia (HCL) [2] .
    Moxetumomab pasudotox
  • HY-120978

    ω-3 Arachidonic acid methyl ester; (All-Z)-8,11,14,17-Eicosatetraenoic acid methyl ester

    Biochemical Assay Reagents Others
    omega-3 Arachidonic Acid methyl ester, mainly docosahexaenoic acid, eicosapentaenoic acid and α-Linoleic acid, represented by linoleic acid, is an essential dietary nutrient required for normal growth and development.Omega-3Methyl arachidonic acid is a rare fatty acid Omega-3Neutral fat-soluble form of arachidonic acid. Omega-3Fatty acids, as a group, were associated with reduced inflammation and autoimmune activity, as well as reduced thrombosis and platelet activation.
    Omega-3 arachidonic acid methyl ester
  • HY-125139

    ω-3 Arachidonic acid ethyl ester; (All-Z)-8,11,14,17-Eicosatetraenoic acid ethyl ester

    Biochemical Assay Reagents Others
    omega-3 Arachidonic Acid ethyl ester is a rare polyunsaturated fatty acid found in very small amounts in dietary sources. Omega-3 fatty acids are known to be essential for the growth and development of infants, and they protect against heart disease, blood clots, high blood pressure, and inflammatory and autoimmune diseases. In human platelet membranes, omega-3 arachidonic acid inhibits arachidonyl-CoA synthetase with a Ki of 14 μM. It also inhibits arachidonoyl-CoA synthetase in calf brain extract with an IC50 of approximately 5 μM. Omega-3 ethyl arachidonate is the more lipophilic form of the free acid.
    omega-3 Arachidonic acid ethyl ester
  • HY-12866
    Larotrectinib
    5+ Cited Publications

    LOXO-101; ARRY-470

    Trk Receptor Apoptosis Cancer
    Larotrectinib (LOXO-101) is an ATP-competitive oral, selective inhibitor of the tropomyosin-related kinase (TRK) family receptors, with low nanomolar 50% inhibitory concentrations against all three isoforms (TRKA, B, and C).
    Larotrectinib
  • HY-P99152

    CD3 Inflammation/Immunology Cancer
    Muromonab is a monoclonal antibody targeting the CD3 receptor. Muromonab can block all cytotoxic T cell function. Muromonab also as an immunosuppressant agent given to reduce acute solid organ transplant rejection .
    Muromonab
  • HY-108860

    PEG-L-asparaginase; Pegasparaginase

    Others Cancer
    Oncaspar (PEG-L-asparaginase; Pegasparaginase), a pegylated form of native Escherichia coli-derived L-asparaginase, breaks down the amino acid asparagine that are circulating in the bloodstream. Oncaspar plays an important role in acute lymphoblastic leukemia (ALL) .
    Oncaspar
  • HY-111904

    Histone Methyltransferase Cancer
    EHMT2-IN-2 is a potent EHMT inhibitor, with IC50s of all <100 nM for EHMT1 peptide, EHMT2 peptide and cellular EHMT2. Used in the research of blood disease or cancer .
    EHMT<em>2</em>-IN-<em>2</em>
  • HY-111778

    Histone Methyltransferase Cancer
    EHMT2-IN-1 is a potent EHMT inhibitor, with IC50s of all <100 nM for EHMT1 peptide, EHMT2 peptide and cellular EHMT2. Used in the research of blood disorder or cancer .
    EHMT<em>2</em>-IN-1
  • HY-139748

    Antibiotic Bacterial Infection
    ETX0462 is a gram-negative chemotype antibiotic. ETX0462 has potent in vitro and in vivo activity against Pseudomonas aeruginosa plus all other Gram-negative ESKAPE pathogens, Stenotrophomonas maltophilia and biothreat pathogens .
    ETX0462
  • HY-P2981

    Carboxypeptidase Y; EC 3.4.16.1

    Carboxypeptidase Others
    Carboxypeptidase C is a carboxypeptidase, is often used in biochemical studies. Carboxypeptidase C removes COOH-terminal lysine, arginine, and proline, as well as all other neutral, aliphatic, aromatic, and the acidic protein amino acids of a peptide chain .
    Carboxypeptidase C
  • HY-Y0258R

    Sodium Channel Bacterial Neurological Disease
    Benzocaine (Standard) is the analytical standard of Benzocaine. This product is intended for research and analytical applications. Benzocaine shares a common receptor with all othe rLAs in the voltage-gated Na + channel, with an IC50 of 0.8 mM tested with a potential of +30 mV.
    Benzocaine (Standard)
  • HY-E70206

    CpG

    DNA Methyltransferase Biochemical Assay Reagents Others
    CpG Methyltransferase is a DNA methyltransferase. CpG Methyltransferase can methylate the C5 position on the base moiety of all cytosine nucleotides contained in unmethylated or hemimethylated double stranded DNA in a 5’-CpG-3’ context .
    CpG Methyltransferase
  • HY-136523

    Histone Demethylase Apoptosis Cancer
    S2157, a N-alkylated tranylcypromine (TCP) derivative, is a potent lysine-specific demethylase 1 (LSD1) inhibitor. S2157 increases H3K9 methylation and reciprocal H3K27 deacetylation at super-enhancer regions. S2157 induces apoptosis in TCP-resistant T-cell acute lymphoblastic leukemia (T-ALL) cells by repressing transcription of the NOTCH3 and TAL1 genes. S2157 efficiently pass through the blood-brain barrier and can almost completely eradicate CNS leukemia in mice transplanted with T-ALL cells .
    S2157
  • HY-N0086
    N6-Methyladenosine
    4 Publications Verification

    6-Methyladenosine; N-Methyladenosine

    Influenza Virus Endogenous Metabolite Infection
    N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
    N6-Methyladenosine
  • HY-21088

    Cyclo-ornithine

    Endogenous Metabolite Metabolic Disease
    3-aminopiperidine-2-one is a metabolite from all living organisms. 3-aminopiperidine-2-one is a delta-lactam that is 2-piperidone substituted at position 3 by an amino group.
    3-Amino-<em>2</em>-piperidinone
  • HY-E70024

    Sialyltransferase Others
    CMP-sialic acid synthetase (NmCSS) is an essential enzyme involved in the biosynthesis of carbohydrates and glycoconjugates containing sialic acids. CMP-sialic acid synthetase (NmCSS) activates free Sia, converting it to CMP-Sia, which is the only donor substrate for all sialyltransferases .
    CMP-sialic acid synthetase (NmCSS)
  • HY-18732A
    L-NMMA acetate
    5 Publications Verification

    Tilarginine acetate; Methylarginine acetate

    NO Synthase Endogenous Metabolite Cardiovascular Disease Cancer
    L-NMMA acetate is a nitric oxide synthase inhibitor of all NOS isoforms including NOS1, NOS2, and NOS3. The Ki values for nNOS (rat), eNOS (human), and iNOS (mouse) are approximately 0.18, 0.4, and 6 µM, respectively.
    L-NMMA acetate
  • HY-145568

    KVD-824

    Ser/Thr Protease Cardiovascular Disease Metabolic Disease
    Feniralstat (compound 30), a pyrazole derivative, is a potent kallikrein inhibitor with an IC50 of 6.7 nM for Human plasma kallikrein (pKal). Feniralstat has no inhibition on Human KLKl, Human FXIa, Human Factor Xlla (all IC50>40 μM).
    Feniralstat
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-P2929
    PNGase F
    1 Publications Verification

    Biochemical Assay Reagents Glucosidase Cancer
    PNGase F, a glycosidase, catalyzes the cleavage of an internal glycoside bond in an oligosaccharide. PNGase F removes nearly all N-linked oligosaccharides from glycoproteins. PNGase F can release N-glycans from glycoproteins in glycoanalytical workflows [2].
    PNGase F
  • HY-147217A

    ISIS 505358 sodium

    HBV Infection
    Bepirovirsen sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-101541S

    Methyl docosahexaenoate-d5; All cis-DHA methyl ester-d5

    Isotope-Labeled Compounds Neurological Disease
    Docosahexaenoic acid-d5 methyl ester is the deuterium labeled Docosahexaenoic Acid methyl ester. Docosahexaenoic Acid methyl ester is a methylated docosahexaenoic acid analog which can be intercalated into membrane phospholipids without being oxidized or hydrolyzed[1][2].
    Docosahexaenoic acid-d5 methyl ester
  • HY-W004260
    Arachidic acid
    1 Publications Verification

    Eicosanoic acid

    Endogenous Metabolite Others
    Arachidonic acid (Icosanoic acid), an orally active long-chain fatty acid, is present in all mammalian cells, typically esterified to membrane phospholipids, and is one of the most abundant polyunsaturated fatty acids present in human tissue. Moreover, Arachidonic acid is an important mediator of inflammation [2] .
    Arachidic acid
  • HY-115766

    nAChR Neurological Disease
    Anabaseine is a non-selective nicotinic agonist. Anabaseine stimulates all AChRs, preferentially stimulates skeletal muscle and brain α7 subtypes [2]. Anabaseine is also a weak partial agonist at α4β2 nAChRs .
    Anabaseine
  • HY-134438

    Endogenous Metabolite Metabolic Disease
    Hexanoyl coenzyme A trilithium is a hexanoyl-based medium-chain fatty acyl coenzyme A that is present in all organisms. Hexanoyl coenzyme A trilithium can be used as a precursor for cannabinoid biosynthesis and acts as a competitive inhibitor of medium-chain acyl coenzyme A dehydrogenase (MCAD) [2].
    Hexanoyl coenzyme A trilithium
  • HY-132177
    α-L-Fucosidase, Microorganism
    1 Publications Verification

    EC 3.2.1.51; FUC

    Others Cancer
    α-L-Fucosidase, Microorganism (EC 3.2.1.51) is an enzyme that catalyzes the chemical reaction. Serum activity of α-L-Fucosidase, Microorganism, a lysosomal enzyme present in all mammalian cells, has been proposed as a marker of hepatocellular carcinoma (HCC) .
    α-L-Fucosidase, Microorganism
  • HY-155338

    YAP Cancer
    SWTX-143 is a novel covalent YAP/TAZ-TEAD inhibitor that binds to the palmitoylation pocket of all four TEAD isoforms. SWTX-143 causes irreversible and specific inhibition of the transcriptional activity of YAP/TAZ-TEAD and shows antitumor activity .
    SWTX-143
  • HY-157479

    Bacterial Infection
    DPI-2016 is a antibacterial agent. DPI-2016 shows improved bactericidal activity (MIC, 0.25-8 μg/mL) against all bacterial strains compared to the aztreonam (HY-B0129) (MIC, 16->64 μg/mL) .
    DPI-2016
  • HY-160469

    Akt PROTACs Cancer
    INY-05-040 is a AKT degrader that can selectively and quickly degrade all three AKT isoforms. INY-05-040 can inhibit downstream signaling and cell proliferation in 288 cancer cell lines, with anti-cancer activity .
    INY-05-040
  • HY-12866A
    Larotrectinib sulfate
    5+ Cited Publications

    LOXO-101 sulfate; ARRY-470 sulfate

    Trk Receptor Apoptosis Cancer
    Larotrectinib sulfate (LOXO-101 sulfate; ARRY-470 sulfate) is an ATP-competitive oral, selective inhibitor of the tropomyosin-related kinase (TRK) family receptors, with low nanomolar 50% inhibitory concentrations against all three isoforms (TRKA, B, and C).
    Larotrectinib sulfate
  • HY-128602

    c-Kit Cancer
    c-Kit-IN-2 is a c-KIT inhibitor with an IC50 of 82 nM, shows superior antiproliferative activities against all the three GIST cell lines, GIST882, GIST430, and GIST48, with GI50s of 3, 1, and 2 nM, respectively .
    c-Kit-IN-<em>2</em>
  • HY-W004260S1

    Icosanoic acid-d39

    Isotope-Labeled Compounds Endogenous Metabolite Others
    Arachidic acid-d39 is the deuterium labeled Arachidic acid. Arachidonic acid (Icosanoic acid), a long-chain fatty acid, is present in all mammalian cells, typically esterified to membrane phospholipids, and is one of the most abundant polyunsaturated fatty acids present in human tissue[1][2].
    Arachidic acid-d39
  • HY-W004260S

    Icosanoic acid-d2

    Isotope-Labeled Compounds Endogenous Metabolite Others
    Arachidic acid-d2 is the deuterium labeled Arachidic acid. Arachidonic acid (Icosanoic acid), a long-chain fatty acid, is present in all mammalian cells, typically esterified to membrane phospholipids, and is one of the most abundant polyunsaturated fatty acids present in human tissue[1][2].
    Arachidic acid-d<em>2</em>
  • HY-N1372

    Thalrugosine; Thaligine

    Bacterial Antibiotic Infection Cardiovascular Disease Inflammation/Immunology Cancer
    (R)-Fangchinoline (Thalrugosine), a alkaloids from Stephania tetrandra,exhibits antimicrobial and hypotensive activity. The roots and stems of several plants from genus Stephania are all used as traditional Chinese medicine and have been used for treatment of fever, diarrhea, dyspepsia and urinary disease .
    (R)-Fangchinoline
  • HY-W004260S2

    Icosanoic acid-d3

    Isotope-Labeled Compounds Endogenous Metabolite Others
    Arachidic acid-d3) is the deuterium labeled Arachidic acid. Arachidonic acid (Icosanoic acid), a long-chain fatty acid, is present in all mammalian cells, typically esterified to membrane phospholipids, and is one of the most abundant polyunsaturated fatty acids present in human tissue[1][2].
    Arachidic acid-d3
  • HY-116055

    3-O-β-D-Galactopyranosyl-sn-glycerol

    Others Others
    (2R)-Glycerol-O-β-D-galactopyranoside (3-O-β-D-Galactopyranosyl-sn-glycerol) is a good substrate for all three components of the lac operon, i.e. β-galactosidase, the lactose transporter and thiogalactoside transacetylase .
    (<em>2</em>R)-Glycerol-O-β-D-galactopyranoside
  • HY-W004260S3

    Icosanoic acid-13C

    Isotope-Labeled Compounds Endogenous Metabolite Cancer
    Arachidic acid- 13C is the 13C labeled Arachidic acid. Arachidonic acid (Icosanoic acid), a long-chain fatty acid, is present in all mammalian cells, typically esterified to membrane phospholipids, and is one of the most abundant polyunsaturated fatty acids present in human tissue[1][2][3].
    Arachidic acid-13C
  • HY-W004260S4

    Icosanoic acid-d4

    Isotope-Labeled Compounds Endogenous Metabolite
    Arachidic acid-d4 is the deuterium labeled Arachidic acid. Arachidonic acid (Icosanoic acid), a long-chain fatty acid, is present in all mammalian cells, typically esterified to membrane phospholipids, and is one of the most abundant polyunsaturated fatty acids present in human tissue[1][2].
    Arachidic acid-d4
  • HY-136782

    Flavivirus Dengue virus Infection
    ST-148 maleate is a potent inhibitor of all four serotypes of DENV in vitro. ST-148 significantly reduced viremia and viral load in vital organs and tended to lower cytokine levels in the plasma in a nonlethal model of DENV infection in AG129 mice .
    ST-148 maleate
  • HY-109014

    CMX-157

    HIV HBV Nucleoside Antimetabolite/Analog Infection
    Tenofovir exalidex (CMX157) is a lipid conjugate of the acyclic nucleotide analog Tenofovir with activity against both wild-type and antiretroviral drug-resistant HIV strains, including multidrug nucleoside/nucleotide analog-resistant viruses. Tenofovir exalidex is active against all major subtypes of HIV-1 and HIV-2 in fresh human PBMCs and against all HIV-1 strains evaluated in monocyte-derived macrophages, with EC50s ranging between 0.2 and 7.2 nM. CMX157 is orally available and has no apparent toxicity. Tenofovir exalidex also shows antiviral activity against HBV [2] .
    Tenofovir exalidex
  • HY-111791
    ACY-1083
    1 Publications Verification

    HDAC Cancer
    ACY-1083 is a selective and brain-penetrating HDAC6 inhibitor with an IC50 of 3 nM and is 260-fold more selective for HDAC6 than all other classes of HDAC isoforms. ACY-1083 effectively reverses chemotherapy-induced peripheral neuropathy .
    ACY-1083
  • HY-P1783

    Influenza Virus Infection
    M2e, human, consisting of the 23 extracellular residues of M2 (the third integral membrane protein of influenza A), has been remarkably conserved in all human influenza A, which is a valid and versatile vaccine candidate to protect against any strain of human influenza A .
    M<em>2</em>e, human
  • HY-131940

    3-O-Methyl-GlcNAc

    Others Metabolic Disease
    3-O-Methyl-N-acetyl-D-glucosamine is a potent inhibitor of N-acetylglucosamine kinase. 3-O-Methyl-N-acetyl-D-glucosamine potently inhibits glucose phosphorylation by N-acetylglucosamine kinase whereas glucokinase is not at all affected by this hexosamine .
    3-O-Methyl-N-acetyl-D-glucosamine
  • HY-136688

    PROTACs Cancer
    MI-389 is a PROTAC translation termination factor GSPT1 degrader. MI-389 disrupts a target that is a shared dependency in different AML and ALL cell lines, and that MI-389 action is dependent on the CRL4 CRBN E3 ligase .
    MI-389
  • HY-18660

    PER977

    Others Cardiovascular Disease
    Ciraparantag is a thrombin and factor Xa inhibitor. Ciraparantag is a broad-spectrum reversal agent for anticoagulants, including low-molecular-weight heparin, unfractionated heparin, and certain direct oral anticoagulants. It is reported to antagonize the effects of all coagulants except VKAs and agratroban [2] .
    Ciraparantag
  • HY-W004260R
    Arachidic acid (Standard)
    1 Publications Verification

    Eicosanoic acid (Standard)

    Endogenous Metabolite Others
    Arachidic acid (Standard) is the analytical standard of Arachidic acid. This product is intended for research and analytical applications. Arachidonic acid (Icosanoic acid), a long-chain fatty acid, is present in all mammalian cells, typically esterified to membrane phospholipids, and is one of the most abundant polyunsaturated fatty acids present in human tissue [2].
    Arachidic acid (Standard)
  • HY-12949
    ML204
    4 Publications Verification

    TRP Channel Neurological Disease
    ML204 is a potent, selective TRPC4/TRPC5 channel inhibitor, with at least 19-fold selectivity against TRPC6 and no appreciable effect on all other TRP channels, nor on voltage-gated sodium, potassium, or Ca 2+ channels [2].
    ML204
  • HY-14608S

    Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid- 13C is the 13C-labeled L-Glutamic acid. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
    L-Glutamic acid-13C
  • HY-141716

    Histone Methyltransferase Cancer
    SW2_110A is a selective chromobox 8 chromodomain (CBX8 ChD) inhibitor with a Kd of 800 nM. SW2_110A shows minimal 5-fold selectivity for CBX8 ChD over all other CBX paralogs in vitro .
    SW<em>2</em>_110A
  • HY-14608S7

    Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid-d5 is the deuterium labeled L-Glutamic acid. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
    L-Glutamic acid-d5
  • HY-14608S8

    Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid-d3 is the deuterium labeled L-Glutamic acid. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
    L-Glutamic acid-d3
  • HY-155188

    Bcl-2 Family Neurological Disease
    NWP-0476 is BCL-2/BCL-xL inhibitor. NWP-0476 has a modified structure with fine-tuned BCL-xL activity. NWP-0476 can be used for relapsed T-acute lymphoblastic leukemia (T-ALL) research .
    NWP-0476
  • HY-160230

    Toll-like Receptor (TLR) Infection
    ssRNA41 sodium is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. It derives from ssRNA40 by replacement of all U nucleotides with adenosine. ssRNA41 sodium is unable to induce the production of type IFNs, and therefore can be used as a negative control for ssRNA40 .
    ssRNA41 sodium
  • HY-11012
    TDZD-8
    5+ Cited Publications

    GSK-3β Inhibitor I; NP 01139

    GSK-3 Cancer
    TDZD-8 is an inhibitor of GSK-3β, with an IC50 of 2 μM; TDZD-8 shows less potent activities against Cdk-1/cyclin B, CK-II, PKA, and PKC, with all IC50s of >100 μM.
    TDZD-8
  • HY-12949A
    ML204 hydrochloride
    4 Publications Verification

    TRP Channel Neurological Disease
    ML204 hydrochloride is a novel, potent, selective TRPC4/TRPC5 channel inhibitor, with at least 19-fold selectivity against TRPC6 and no appreciable effect on all other TRP channels, nor on voltage-gated sodium, potassium, or Ca 2+ channels [2].
    ML204 hydrochloride
  • HY-141438
    SIM1
    1 Publications Verification

    PROTACs Epigenetic Reader Domain Cancer
    SIM1 is a potent von Hippel-Lindau (VHL)-based trivalent PROTAC capable of degradation for all BET family members, with preference for BRD2 degradation (IC50=1.1 nM; Kd=186 nM). SIM1 shows sustained anti-cancer activity .
    SIM1
  • HY-14608S5

    Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid- 13C5 is the 13C-labeled L-Glutamic acid. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
    L-Glutamic acid-13C5
  • HY-147268

    RAF/KIN_2787

    Raf p38 MAPK Cancer
    Exarafenib (RAF/KIN_2787) is an orally-available, selective pan-RAF inhibitor. Exarafenib is effective in RAF-dependent cancers, including all classes of BRAF alterations. Exarafenib suppresses MAPK signaling in RAF-dependent melanoma cell lines. Exarafenib has anticancer activity [2].
    Exarafenib
  • HY-P10031

    GLP Receptor GCGR Metabolic Disease
    SAR441255 is a potent unimolecular peptide GLP-1/GIP/GCG receptor triagonist. SAR441255 displays high potency with balanced activation of all three target receptors.?SAR441255 shows positive acute glucoregulatory effectss in diabetic obese monkeys .
    SAR441255
  • HY-P1212

    CST-14, human, rat

    Somatostatin Receptor Neurological Disease
    Cortistatin 14, human, rat (CST-14, human, rat), a neuropeptide with neuronal depressant and sleep modulating properties, can bind to all five cloned somatostatin receptors (SSTRs) and ghrelin receptor to exert its biological activities and co-exists with GABA within the cortex and hippocampus [2].
    Cortistatin 14, human, rat
  • HY-P9951

    RG-6321

    VEGFR Cardiovascular Disease
    Ranibizumab (RG-6321) is a humanized anti-VEGF monoclonal antibody fragment and can recognize all VEGF-A isoforms (VEGF110, VEGF121, and VEGF165) . Ranibizumab slows vision loss in vivo and is used for wet age-related macular degeneration (AMD) research .
    Ranibizumab
  • HY-14608S2

    Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid- 15N is the 15N-labeled L-Glutamic acid. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals[1].
    L-Glutamic acid-15N
  • HY-147958

    Bacterial Infection
    Antibacterial agent 113 (compound 3) is a potent antibacterial agent. Antibacterial agent 113 shows antibacterial activity against P.aeruginosa, S.mutans, B.subtilis, E.coli, E.faecalis, S.typhimuriumand, and S.aureus microorganisms, with MIC values all of 156.25 μM .
    Antibacterial agent 113
  • HY-B0228S5

    Adenine riboside-13C; D-Adenosine-13C

    Apoptosis Autophagy Endogenous Metabolite Nucleoside Antimetabolite/Analog Metabolic Disease Cancer
    Adenosine- 13C is the 13C labeled Adenosine. Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular physiology,
    Adenosine-13C
  • HY-B0228S6

    Adenine riboside-d2; D-Adenosine-d2

    Apoptosis Autophagy Endogenous Metabolite Nucleoside Antimetabolite/Analog Metabolic Disease Cancer
    Adenosine-d2 is the deuterium labeled Adenosine. Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular physio
    Adenosine-d<em>2</em>
  • HY-B0228S7

    Adenine riboside-d1-1; D-Adenosine-d-1

    Apoptosis Autophagy Endogenous Metabolite Nucleoside Antimetabolite/Analog Metabolic Disease Cancer
    Adenosine-d-1 is the deuterium labeled Adenosine. Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular phys
    Adenosine-d1-1
  • HY-B0228S8

    Adenine riboside-d1-2; D-Adenosine-d-2

    Apoptosis Autophagy Endogenous Metabolite Nucleoside Antimetabolite/Analog Metabolic Disease Cancer
    Adenosine-d-2 is the deuterium labeled Adenosine. Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular phys
    Adenosine-d1-<em>2</em>
  • HY-W004260S5

    Endogenous Metabolite Others
    Arachidic acid-d4-1 is the deuterium labeled Arachidic acid[1]. Arachidonic acid (Icosanoic acid), a long-chain fatty acid, is present in all mammalian cells, typically esterified to membrane phospholipids, and is one of the most abundant polyunsaturated fatty acids present in human tissue[2][3].
    Arachidic acid-d4-1
  • HY-155100

    STING Inflammation/Immunology Cancer
    BI 7446 is a cyclic dinucleotide (CDN)-based potent and selective stimulator of interferon genes (STING) agonist. BI 7446 can activate all five STING variants in cells and induce tumor-specific immune-mediated tumor rejection. BI 7446 can be used for immuno-oncology research .
    BI 7446
  • HY-157269

    Others Inflammation/Immunology
    J10-1 is a hapten. J10-1 promotes peptide exchange of all DR alleles (DR1, DR2, DR4 (DRB1*0401)) and promotes peptide binding to MHC II, which can be used in the study of immune regulation .
    J10-1
  • HY-14608
    L-Glutamic acid
    2 Publications Verification

    Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid is an excitatory amino acid neurotransmitter that acts as an agonist for all subtypes of glutamate receptors (metabolic rhodophylline, NMDA, and AMPA). L-Glutamic acid has an agonist effect on the release of DA from dopaminergic nerve endings. L-Glutamic acid can be used in the study of neurological diseases [2] .
    L-Glutamic acid
  • HY-120548

    HSP Cancer
    KBU2046 is an oral, highly selective inhibitor of cell motility and cell invasion in vitro. KBU2046 binds chaperone heterocomplexes, selectively alters binding of client proteins that regulate motility, and lacks all of the hallmarks of classical HSP90 inhibitors. KBU2046 inhibits cancer metastasis and prolongs life .
    KBU2046
  • HY-14608S1

    Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid-1- 13C is the 13C-labeled L-Glutamic acid. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
    L-Glutamic acid-1-13C
  • HY-115475
    SW-100
    3 Publications Verification

    HDAC Neurological Disease
    SW-100, a selective histone deacetylase 6 (HDAC6) inhibitor with an IC50 of 2.3 nM, shows at least 1000-fold selectivity for HDAC6 relative to all other HDAC isozymes. SW-100 displays a significantly improved ability to cross the blood-brain-barrier .
    SW-100
  • HY-12824

    Antibiotic Bacterial Infection
    RNPA1000, an antibiotic, is a potent RnpA inhibitor and inhibits RnpA-mediated cellular RNA degradation. RNPA1000 inhibits tRNA maturation with an IC50 of 175 μM. RNPA1000 displays broad-spectrum antimicrobial activities and inhibits staphylococcal and all Gram-positive bacterial pathogens activity [2] .
    RNPA1000
  • HY-14608S6

    Isotope-Labeled Compounds Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid-5- 13C is the 13C-labeled L-Glutamic acid. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
    L-Glutamic acid-5-13C
  • HY-P1783A

    Influenza Virus Infection
    M2e, human TFA, consisting of the 23 extracellular residues of M2 (the third integral membrane protein of influenza A), has been remarkably conserved in all human influenza A. M2e, human TFA is a valid and versatile vaccine candidate to protect against any strain of human influenza A .
    M<em>2</em>e, human TFA
  • HY-N8356

    13-cis-Retinyl palmitate

    Endogenous Metabolite Others
    13-cis-Vitamin A palmitate (13-cis-Retinyl palmitate) is a 13-cis isomer formed by vitamin A palmitate in corn flakes. 13-cis-Vitamin A palmitate has a biological activity of 75% of all-trans-vitamin A palmitate, the most biologically ac-tive form of vitamin A .
    13-cis-Vitamin A palmitate
  • HY-N8356A

    9-cis-Retinyl palmitate

    Endogenous Metabolite Others
    9-cis-Vitamin A palmitate (9-cis-Retinyl palmitate) is a 9-cis isomer formed by vitamin A palmitate in corn flakes. 9-cis-Vitamin A palmitate has a biological activity of 26% of all-trans-vitamin A palmitate, the most biologically ac-tive form of vitamin A .
    9-cis-Vitamin A palmitate
  • HY-112547

    CRT0066051

    PKD Others
    CRT5, a pyrazine benzamide, is a potent and selective inhibitor for all three isoforms of PKD in endothelial cells treated with VEGF (IC50s = 1, 2, and 1.5 nM for PKD1, PKD2, and PKD3, respectively). CRT5 decreases VEGF-induced endothelial migration, proliferation and tubulogenesis .
    CRT5
  • HY-B0228S4

    Adenine riboside-1′-13C; D-Adenosine-1′-13C

    Apoptosis Autophagy Endogenous Metabolite Nucleoside Antimetabolite/Analog Metabolic Disease Cancer
    Adenosine-1′- 13C is the 13C labeled Adenosine. Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular physiolo
    Adenosine-1′-13C
  • HY-B0228S2

    Adenine riboside-2′-13C; D-Adenosine-2′-13C

    Apoptosis Autophagy Endogenous Metabolite Nucleoside Antimetabolite/Analog Metabolic Disease Cancer
    Adenosine-2′- 13C is the 13C labeled Adenosine. Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular physiolo
    Adenosine-<em>2</em>′-13C
  • HY-B0228S3

    Adenine riboside-3′-13C; D-Adenosine-3′-13C

    Apoptosis Autophagy Endogenous Metabolite Nucleoside Antimetabolite/Analog Metabolic Disease Cancer
    Adenosine-3′- 13C is the 13C labeled Adenosine. Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular physiolo
    Adenosine-3′-13C
  • HY-P99412

    OSE-127

    Interleukin Related Cancer
    Lusvertikimab (OSE-127) is a humanized IL7R monoclonal antibody. Lusvertikimab is not internalized by target cells and prevents IL7R heterodimerization and subsequent downstream signaling. Lusvertikimab has anti-leukemic efficacy and has the potential for B cell precursor acute lymphoblastic leukemia (BCP-ALL) research .
    Lusvertikimab
  • HY-W015273

    Reactive Oxygen Species Others
    3-Indoleacrylic acid is a high-efficient antialgal agent. 3-Indoleacrylic acid increases reactive oxygen species (ROS) production, and inhibits the functions of all the nutrient assimilating genes, down-regulated ribulose-1,5-bisphosphate carboxylase/oxygenase II, and cytochrome f genes in P. donghaiense .
    3-Indoleacrylic acid
  • HY-P10031A

    GLP Receptor Metabolic Disease
    SAR441255 TFA is a potent unimolecular peptide GLP-1/GIP/GCG receptor triagonist. SAR441255 TFA displays high potency with balanced activation of all three target receptors.?SAR441255 TFA shows positive acute glucoregulatory effectss in diabetic obese monkeys .
    SAR441255 TFA
  • HY-15985
    CTX-0294885
    2 Publications Verification

    Akt Metabolic Disease Inflammation/Immunology Cancer
    CTX-0294885 is a broad spectrum kinase inhibitor that can capture 235 kinases from MDA-MB-231 cells, and can capture all members of the AKT family. CTX-0294885 is a powerful reagent for analysis of kinome signaling networks that can be used for the research of diseases like inflammation, diabetes, and cancer .
    CTX-0294885
  • HY-15985A
    CTX-0294885 hydrochloride
    2 Publications Verification

    Akt Metabolic Disease Inflammation/Immunology Cancer
    CTX-0294885 hydrochloride is a broad spectrum kinase inhibitor that can capture 235 kinases from MDA-MB-231 cells, and can capture all members of the AKT family. CTX-0294885 hydrochloride is a powerful reagent for analysis of kinome signaling networks that can be used for the research of diseases like inflammation, diabetes, and cancer .
    CTX-0294885 hydrochloride
  • HY-14608A
    L-Glutamic acid monosodium salt
    2 Publications Verification

    iGluR Apoptosis Ferroptosis Endogenous Metabolite Neurological Disease
    L-Glutamic acid monosodium salt is an excitatory amino acid neurotransmitter that acts as an agonist for all subtypes of glutamate receptors (metabolic rhodophylline, NMDA, and AMPA). L-Glutamic acid monosodium salt has an agonist effect on the release of DA from dopaminergic nerve endings. L-Glutamic acid monosodium salt can be used in the study of neurological diseases [2] .
    L-Glutamic acid monosodium salt
  • HY-N3841
    ε-​Viniferin
    1 Publications Verification

    epsilon-Viniferin

    Cytochrome P450 Neurological Disease Metabolic Disease Inflammation/Immunology
    ε-Viniferin (epsilon-Viniferin), the dimer of Resveratrol and can be isolated from Vitis vinifera, displays a potent inhibitory for all the CYP activities, with Ki values from 0.5-20 μM. ε-Viniferin possesses potent antioxidant, anti-inflammatory, anti-diabetic, and anti-neurodegenerative capacity [2] .
    ε-​Viniferin
  • HY-P2315

    HβD-1

    Antibiotic Bacterial Infection
    Human β-defensin-1 (HβD-1) is a cysteine-rich cationic skin-antimicrobial peptide (SAP) produced by all epithelial surfaces, but also by circulatory cells and cells of the reproductive tract. Human β-defensin-1 has antimicrobial activities against a broad-sperm bacteria .
    Human β-defensin-1
  • HY-P1852

    Adenylate Cyclase Neurological Disease
    TIP 39, Tuberoinfundibular Neuropeptide is a neuropeptide and parathyroid hormone 2 receptor (PTH2R) agonist. TIP 39 is highly conserved among species. TIP39 from all species activates adenylyl cyclase and elevates intracellular calcium levels through parathyroid hormone 2 receptor (PTH2R) .
    TIP 39, Tuberoinfundibular Neuropeptide
  • HY-14608S3

    Isotope-Labeled Compounds Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid- 13C5, 15N is the 13C- and 15N-labeled L-Glutamic acid. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
    L-Glutamic acid-13C5,15N
  • HY-14608S9

    Isotope-Labeled Compounds Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid- 15N,d5 is the deuterium and 15N-labeled L-Glutamic acid. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
    L-Glutamic acid-15N,d5
  • HY-144297

    HDAC Parasite Infection
    HDAC1-IN-3 is a potent Pf HDAC1 inhibitor. HDAC1-IN-3 shows antimalarial activity in wild-type and multidrug-resistant parasite strains. HDAC1-IN-3 shows a significant in vivo killing effect against all life cycles of parasites .
    HDAC1-IN-3
  • HY-P9951A

    RG-6321 (anti-VEGF)

    VEGFR Cardiovascular Disease
    Ranibizumab (RG-6321) (anti-VEGF) is a humanized anti-VEGF monoclonal antibody fragment and can recognize all VEGF-A isoforms (VEGF110, VEGF121, and VEGF165) . Ranibizumab (anti-VEGF) slows vision loss in vivo and is used for wet age-related macular degeneration (AMD) research .
    Ranibizumab (anti-VEGF)
  • HY-14608S10

    Apoptosis iGluR Ferroptosis Endogenous Metabolite Neurological Disease
    L-Glutamic acid- 13C2 is the 13C labeled L-Glutamic acid[1]. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals[2].
    L-Glutamic acid-13C<em>2</em>
  • HY-N3142

    Bacterial Infection
    Oleuropeic acid 8-O-glucoside is a terpenic compound, that can be isolated from twigs with leaves of Juniperus communis var. depressa. Oleuropeic acid 8-O-glucoside shows antibacterial activity against three strains of Helicobacter pylori (NCTC11637, NCTC11916, and OCO1), with MIC of 100 μg/mL all .
    Oleuropeic acid 8-O-glucoside
  • HY-120234

    Z-Leu-Leu-Nle-CHO; GSII

    γ-secretase Proteasome Apoptosis Cancer
    Z-LLNle-CHO (Z-Leu-Leu-Nle-CHO) is a γ-secretase inhibitor I. Z-LLNle-CHO induces caspase and ROS-dependent apoptosis by blocking the Akt-mediated pro-survival pathway. Z-LLNle-CHO can be used in cancer research, such as breast cancer and leukaemia [2].
    Z-LLNle-CHO
  • HY-14649S3

    Vitamin A acid-d6; All-trans-Retinoic acid-d6; ATRA-d6

    RAR/RXR PPAR Autophagy Endogenous Metabolite Cancer
    Retinoic acid-d6 is the deuterium labeled Retinoic acid[1]. Retinoic acid is a metabolite of vitamin A that plays important roles in cell growth, differentiation, and organogenesis. Retinoic acid is a natural agonist of RAR nuclear receptors, with IC50s of 14 nM for RARα/β/γ. Retinoic acid bind to PPARβ/δ with Kd of 17 nM. Retinoic acid acts as an inhibitor of transcription factor Nrf2 through activation of retinoic acid receptor alpha[2][3][4][5][6][7].
    Retinoic acid-d6
  • HY-14649S4

    Vitamin A acid-d5; All-trans-Retinoic acid-d5; ATRA-d5

    Isotope-Labeled Compounds RAR/RXR PPAR Cancer
    Retinoic acid-d5 is the the deuterium labeled Retinoic acid (HY-14649). Retinoic acid is a metabolite of vitamin A that plays important roles in cell growth, differentiation, and organogenesis. Retinoic acid is a natural agonist of RAR nuclear receptors, with IC50s of 14 nM for RARα/β/γ. Retinoic acid bind to PPARβ/δ with Kd of 17 nM. Retinoic acid acts as an inhibitor of transcription factor Nrf2 through activation of retinoic acid receptor alpha [2] .
    Retinoic acid-d5
  • HY-B0228
    Adenosine
    5+ Cited Publications

    Adenine riboside; D-Adenosine

    Nucleoside Antimetabolite/Analog Autophagy Apoptosis Endogenous Metabolite Metabolic Disease Cancer
    Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular physiology, including neuronal activity, vascular function, platelet aggregation, and blood cell regulation [2].
    Adenosine
  • HY-100765

    MDM-2/p53 E1/E2/E3 Enzyme Cancer
    BI-0252 is an orally active, selective MDM2-p53 inhibitor with an IC50 of 4 nM. BI-0252 can induce tumor regressions in all animals of a mouse SJSA-1 xenograft, with concomitant induction of the tumor protein p53 (TP53) target genes and markers of apoptosis .
    BI-0252
  • HY-N7539

    Others Metabolic Disease
    Cognac oil, mainly found in wine lees, has unique fatty acid profiles, including Palmitic acid (59.26%), Linoleic acid (11.92%), Myristic acid (8.97%), Oleic acid (8.3%) and other fatty acids. Cognac oil leads to a general increase in the permeation of R6G (Rhodamine 6G) across all the membranes .
    Cognac oil
  • HY-114672

    Phosphodiesterase (PDE) Cardiovascular Disease
    MBCQ is a potent and selective cGMP-specific phosphodiesterase (PDE V; PDE5) inhibitor with an IC50 of 19 nM. MBCQ lacks inhibitory activity toward other PDE isozymes (all IC50s>100 μM). MBCQ dilates coronary arteries via specific inhibition of cGMP-PDE [2] .
    MBCQ
  • HY-D0819A
    CY5-SE triethylamine salt
    5+ Cited Publications

    Cy5 NHS Ester triethylamine salt; Sulfo-Cyanine5 Succinimidyl Ester triethylamine salt

    Fluorescent Dye Others
    Cy5-SE (Cy5 NHS Ester) triethylamine salt is a reactive dye for the labeling of amino-groups in peptides, proteins, and oligonucleotides. Cy5-SE triethylamine salt is ideal for very cost-efficient labeling of soluble proteins, as well as all kinds of peptides and oligonucleotides Ex=649 nm; Em=670 nm) .
    CY5-SE triethylamine salt
  • HY-126195

    ML-090

    NADPH Oxidase Cardiovascular Disease
    Fluoflavine (ML-090) is a selective NOX1 inhibitor with an IC50 of 90 nM. Fluoflavine has >100 selectivity for NOX1 over NOX2, NOX3, NOX4 (all IC50>10 μM). ML-090 has an IC50 of 360 nM in HEK293 cells .
    Fluoflavine
  • HY-15901A

    Pim mTOR Cancer
    LGB321 monohydrochloride is a potent, selective, orally active and ATP competitive inhibitor of all three PIM kinases. LGB321 monohydrochloride inhibits proliferation, mTOR-C1 signaling and phosphorylation of BAD in a number of cell lines derived from diverse hematologic malignancies. LGB321 monohydrochloride can be used for the research of hematologic malignancies .
    LGB321 monohydrochloride
  • HY-100408

    Porcupine Cardiovascular Disease Cancer
    GNF-6231 is a porcupine (IC50= 0.8 nM), Pron, and endoplasmic reticulum protein inhibitor with oral activity. GNF-6231 has anticancer activity. GNF-6231 can prevent the activation of the Wnt pathway by blocking the secretion of all Wnt ligands. GNF-6231 can be used in the study of myocardial infarction [2] .
    GNF-6231
  • HY-137892

    Epigenetic Reader Domain Inflammation/Immunology
    GSK620 is a potent and orally active pan-BD2 inhibitor with excellent broad selectivity, developability and in vivo oral pharmacokinetics. GSK620 is highly selective for the BET-BD2 family of proteins, with >200-fold selectivity over all other bromodomains. GSK620 shows an anti-inflammatory phenotype in human whole blood .
    GSK620
  • HY-138061

    Flavivirus Dengue virus DNA/RNA Synthesis Infection
    DENV-IN-2 is a potent dengue viral replication inhibitor extracted from patent WO2018215315A1, compound 6AB, has an EC50 of 0.016 nM. DENV-IN-2 shows high potent activity against all four serotypes of the Dengue virus with EC50s ranging from 0.013 to 0.029 nM .
    DENV-IN-<em>2</em>
  • HY-14608S4

    Isotope-Labeled Compounds Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid- 13C5, 15N,d5 is the deuterium, 13C-, and 15-labeled L-Glutamic acid. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
    L-Glutamic acid-13C5,15N,d5
  • HY-111013

    Others Cardiovascular Disease
    VK-II-86 is a Carvedilol (HY-B0006) analogue lacking antagonist activity at β-adrenoceptors, in hypokalaemia. VK-II-86 prevents hypokalaemia-induced ventricular arrhythmia through multi-channel effects. VK-II-86 prevents all hypokalaemia-induced changes in ion channel activity and oxidative stress .
    VK-II-86
  • HY-E70080

    Biochemical Assay Reagents Others
    Vaccinia virus capping enzyme is a transcription initiation factor. Vaccinia virus capping enzyme is a heterodimer of D1 (844 aa) and D12 (287 aa) polypeptides that executes all three steps in m7GpppRNA synthesis. Vaccinia virus capping enzyme has been used widely as a reagent for capping and cap-labeling RNAs in vitro [2].
    Vaccinia virus capping enzyme
  • HY-P4743

    HSV Infection
    FITC-εAhx-HHV-2 Envelope Glycoprotein G (561-578) is a FITC labeled HHV-2 Envelope Glycoprotein G (561-578). HHV-2 Envelope Glycoprotein G (561-578) is an immunodominant region of glycoprotein G (gG-2) reactive with all herpes simplex (HSV-2) sera .
    FITC-εAhx-HHV-<em>2</em> Envelope Glycoprotein G (561-578)
  • HY-160018

    Epigenetic Reader Domain Cancer
    BAY-155 is a potent and selective menin-MLL tool inhibitor, with an IC50 of 8 nM. BAY-155 leads to a strong expression down-regulation of the MEIS1 gene and up-regulation of CD11b and MNDA genes. BAY-155 shows anti-proliferative effects in AML/ALL (acute myeloid/lymphoblastic leukemia) models .
    BAY-155
  • HY-160231

    Toll-like Receptor (TLR) Inflammation/Immunology
    ssRNA42 (sodium) is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. ssRNA42 (sodium) derives from ssRNA40 by replacement of all G nucleotides with adenosine. ssRNA42 activated human PBMCs to secrete IFN-α, TNF-a, IL- 12p40, and IL-6, but ssRNA42 failed to stimulated murine pDCs and PBMCs.
    ssRNA42 sodium
  • HY-13271
    Tubastatin A Hydrochloride
    20+ Cited Publications

    Tubastatin A HCl; TSA HCl

    Beta-lactamase HDAC Autophagy Apoptosis Cancer
    Tubastatin A Hydrochloride (Tubastatin A HCl) is a potent and selective HDAC6 inhibitor with IC50 of 15 nM in a cell-free assay, and is selective (1000-fold more) against all other isozymes except HDAC8 (57-fold more). Tubastatin A Hydrochloride also inhibits HDAC10 and metallo-β-lactamase domain-containing protein 2 (MBLAC2).
    Tubastatin A Hydrochloride
  • HY-B1030
    Lanatoside C
    3 Publications Verification

    Flavivirus Dengue virus Autophagy Enterovirus Cardiovascular Disease Cancer
    Lanatoside C is a cardiac glycoside, can be used in the treatment of congestive heart failure and cardiac arrhythmia.Lanatoside C has an IC50 of 0.19 μM for dengue virus infection in HuH-7 cells. Lanatoside C can effectively inhibit all four serotypes of dengue virus, flavivirus Kunjin, alphavirus Chikungunya, Sindbis virus and the human enterovirus 71 [2].
    Lanatoside C
  • HY-13271A
    Tubastatin A
    20+ Cited Publications

    Beta-lactamase HDAC Autophagy Apoptosis Cancer
    Tubastatin A is a potent and selective HDAC6 inhibitor with an IC50 of 15 nM in a cell-free assay, and is selective (1000-fold more) against all other isozymes except HDAC8 (57-fold more). Tubastatin A also inhibits HDAC10 and metallo-β-lactamase domain-containing protein 2 (MBLAC2).
    Tubastatin A
  • HY-114286

    Monoamine Oxidase Inflammation/Immunology
    PXS-5153A is a potent, selective, orally active and fast-acting lysyl oxidase like 2/3 enzymatic (LOXL2/LOXL3) inhibitor, with an IC50 of <40 nM for LOXL2 across all mammalian species and an IC50 of 63 nM for human LOXL3. PXS-5153A could reduce crosslinks and ameliorates fibrosis.
    PXS-5153A
  • HY-111056

    Ser/Thr Protease Cancer
    UK122 is a potent and selective urokinase-type plasminogen activator (uPA) inhibitor with an IC50 of 0.2 μM. UK122 shows no or little inhibition of tissue-type PA (tPA), plasmin, thrombin, and trypsin (all IC50>100 μM). UK122, 4-oxazolidinone analogue, is an anticancer agent and inhibits cancer cell migration and invasion .
    UK122
  • HY-147149

    Others Neurological Disease
    BPN-15477 is a potent SMC (splicing modulator compound) that restores correct splicing of ELP1 (Elongator complex protein 1) exon 20. BPN-15477 corrects splicing of the ELP1 transcript, significantly increases the level of functional protein in vivo in all tissues, including brain. BPN-15477 can be used for frontotemporal dementia research .
    BPN-15477
  • HY-N3841A

    Cytochrome P450 Metabolic Disease
    δ-Viniferin is a resveratrol dehydrodimer, an isomer of ε-Viniferin (HY-N3841) . ε-Viniferin (epsilon-Viniferin), the dimer of Resveratrol, displays a potent inhibitory for all the CYP activities, with Ki values from 0.5-20 μM. ε-Viniferin possesses potent antioxidant, anti-inflammatory, anti-diabetic, and anti-neurodegenerative capacity.
    δ-Viniferin
  • HY-100233
    IQ-1S free acid
    1 Publications Verification

    JNK Inflammation/Immunology Cancer
    IQ-1S free acid is a prospective inhibitor of NF-κB/activating protein 1 (AP-1) activity with an IC50 of 2.3±0.41 μM. IQ-1S free acid has binding affinity (Kd values) in the nanomolar range for all three JNKs with Kds of 100 nM, 240 nM, and 360 nM for JNK3, JNK1, and JNK2, respectively.
    IQ-1S free acid
  • HY-B0228S

    Adenine riboside-d1; D-Adenosine-d

    Nucleoside Antimetabolite/Analog Autophagy Apoptosis Endogenous Metabolite Metabolic Disease Cancer
    Adenosine-d is the deuterium labeled Adenosine. Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular physiology, including neuronal activity, vascular function, platelet aggregation, and blood cell regulation[1][2].
    Adenosine-d1
  • HY-114286A

    Monoamine Oxidase Inflammation/Immunology
    PXS-5153A monohydrochloride is a potent, selective, orally active and fast-acting lysyl oxidase like 2/3 enzymatic (LOXL2/LOXL3) inhibitor, with an IC50 of <40 nM for LOXL2 across all mammalian species and an IC50 of 63 nM for human LOXL3. PXS-5153A monohydrochloride could reduce crosslinks and ameliorates fibrosis.
    PXS-5153A monohydrochloride
  • HY-N7434
    N-Nitrosodiethylamine
    2 Publications Verification

    Diethylnitrosamine; DEN

    DNA/RNA Synthesis Cancer
    N-Nitrosodiethylamine (Diethylnitrosamine) is a potent hepatocarcinogenic dialkylnitrosoamine. N-Nitrosodiethylamine is mainly present in tobacco smoke, water, cheddar cheese, cured, fried meals and many alcoholic beverages. N-Nitrosodiethylamine is responsible for the changes in the nuclear enzymes associated with DNA repair/replication. N-Nitrosodiethylamine results in various tumors in all animal species. The main target organs are the nasal cavity, trachea, lung, esophagus and liver.
    N-Nitrosodiethylamine
  • HY-110135A

    IGF-1R Neurological Disease
    NBI-31772 hydrate is a potent inhibitor of interaction between insulin-like growth factor (IGF) and IGF-binding proteins (IGFBPs). NBI-31772 hydrate is also a nonpeptide ligand that releases bioactive IGF-I from the IGF-I/IGFBP-3 complex (Kis=1-24 nM for all six human subtypes). Anxiolytic and antidepressant-like effects [2] .
    NBI-31772 hydrate
  • HY-147786

    TGF-β Receptor Cancer
    TGFβRI-IN-5 (Compound 4b) is a potent inhibitor of TGFβRI with an IC50 of 0.08 μM. TGFβRI-IN-5 displays amazing anticancer activity 5–7 times that of reference agent against all the tested cell lines. TGFβRI-IN-5 enhances apoptosis and arrested G2/M phase of cell cycle .
    TGFβRI-IN-5
  • HY-13271B

    TSA TFA

    HDAC Autophagy Apoptosis Cancer
    Tubastatin A (TSA) TFA is a potent and selective?HDAC6?inhibitor with?IC50?of 15 nM in a cell-free assay, and is selective (1000-fold more) against all other isozymes except HDAC8 (57-fold more). Tubastatin A TFA also inhibits HDAC10 and metallo-β-lactamase domain-containing protein?2 (MBLAC2).
    Tubastatin A TFA
  • HY-101541S1

    Methyl docosahexaenoate-13C22; All cis-DHA methyl ester-13C22

    Isotope-Labeled Compounds Others
    Docosahexaenoic acid- 13C22 methyl ester is the 13C22 labeled Docosahexaenoic acid methyl ester (HY-101541)[1].
    Docosahexaenoic acid-13C22 methyl ester
  • HY-14174

    γ-secretase Neurological Disease Cancer
    MRK-560 is an orally active, brain barrier-penetrating γ-Secretase inhibitor, can potently reduces Aβ peptide in rat brain and cerebrospinal fluid. MRK-560 also decreases mutant NOTCH1 processing by selectively inhibiting PSEN1. MRK-560 can be used in studies of Alzheimer's disease and T-cell acute lymphoblastic leukaemia (T-ALL) [2].
    MRK-560
  • HY-146696

    Epoxide Hydrolase Cardiovascular Disease Neurological Disease Cancer
    mEH-IN-1 (Compound 62) is a potent microsomal epoxide hydrolase (mEH) inhibitor with the IC50 of 2.2 nM. The mEH is a mammalian α/β-fold hydrolase enzyme, expressed in almost all tissues, hydrolyzes a wide range of epoxide containing molecules. The mEH is mainly localized in the endoplasmic reticulum (ER) of eukaryotic cells. mEH-IN-1 can be used for the research of preeclampsia, hypercholanemia and cancer .
    mEH-IN-1
  • HY-118858

    EAAT Neurological Disease Cancer
    UCPH-102 is a highly selective EAAT1 inhibitor with an IC50 of 0.43 µM. UCPH-102 exhibits a specific anti-proliferative effect on T-ALL cells. UCPH-102 also shows good blood-brain permeability, which can be used in studies of amyotrophic lateral sclerosis, Alzheimer’s disease, chronic pain and obsessive compulsive disorder [2] .
    UCPH-102
  • HY-B0216S

    17α-Ethynylestradiol-d4; Ethynylestradiol-d4

    Estrogen Receptor/ERR Endogenous Metabolite Endocrinology Cancer
    Ethynyl Estradiol-d4 is the deuterium labeled Ethynyl Estradiol. Ethynyl Estradiol (17α-Ethynylestradiol;Ethynylestradiol) is an orally bio-active estrogen used in almost all modern formulations of combined oral contraceptive pills. Ethynyl Estradiol-d4 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
    Ethynyl Estradiol-d4
  • HY-N6022

    Others Metabolic Disease
    Byakangelicin, one of the active compounds found in the roots of Angelica gigas, can serve as a modulator to improve brain accumulation of diverse active compounds (Umb, Cur, and Dox) and enhance therapeutic effects . Byakangelicin is likely to increase the expression of all PXR target genes (such as MDR1) and induce a wide range of agent-agent interactions. Byakangelicin can inhibit the effects of sex hormones, it may increase the catabolism of endogenous hormones [2].
    Byakangelicin
  • HY-A0035

    Antibiotic Bacterial Infection
    Faropenem is a potent and orally active beta-lactam antibiotic. Faropenem demonstrates broad-spectrum in vitro antimicrobial activity against many gram-positive and -negative aerobes and anaerobes. Faropenem is resistant to hydrolysis by nearly all beta-lactamases, including extended-spectrum beta-lactamases and AmpC beta-lactamases. Faropenem is developed as an oral proagent, faropenem medoxomil, for the research of respiratory tract infections [2].
    Faropenem
  • HY-P3618

    Somatostatin Receptor Neurological Disease
    Cortistatin 29 is a neuropeptide. Cortistatin 29 alleviates neuropathic pain. Cortistatin 29 binds with high affinity all somatostatin (SS) receptor subtypes and shows IC50 values of 2.8, 7.1, 0.2, 3.0, 13.7 nM for SSTR1, SSTR2, SSTR3, SSTR4, SSTR5, respectively. Cortistatin 29 shows anti-fibrotic effects [2] .
    Cortistatin 29
  • HY-B0228S1

    Adenine riboside-13C5; D-Adenosine-13C5

    Apoptosis Nucleoside Antimetabolite/Analog Autophagy Endogenous Metabolite
    Adenosine- 13C5 is the 13C labeled Adenosine[1]. Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular physiology, including neuronal activity, vascular function, platelet aggregation, and blood cell regulation[2][3].
    Adenosine-13C5
  • HY-12076
    BMS 777607
    5+ Cited Publications

    BMS 817378

    c-Met/HGFR TAM Receptor Cancer
    BMS 777607 (BMS 817378) is a Met-related inhibitor for c-Met, Axl, Ron and Tyro3 with IC50s of 3.9 nM, 1.1 nM, 1.8 nM and 4.3 nM, respectively, and 40-fold more selective for Met-related targets than Lck, VEGFR-2, and TrkA/B, with more than 500-fold greater selectivity versus all other receptor and non receptor kinases .
    BMS 777607
  • HY-15558
    Hoechst 33258
    10+ Cited Publications

    bisBenzimide H 33258; H 33258

    Fluorescent Dye Cancer
    Hoechst 33258 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    Hoechst 33258
  • HY-15559
    Hoechst 33342
    45+ Cited Publications

    bisBenzimide H 33342; HOE 33342

    Autophagy Others
    Hoechst 33342 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    Hoechst 33342
  • HY-15560

    HOE 34580

    Amyloid-β Neurological Disease
    Hoechst 34580 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    Hoechst 34580
  • HY-15619

    Nuclear yellow

    Fluorescent Dye Others
    Hoechst S 769121 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    Hoechst S 769121
  • HY-15561

    meta-Hoechst

    Fluorescent Dye Cancer
    HOE-S 785026 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    HOE-S 785026
  • HY-15562

    Fluorescent Dye Others
    HOE 32021 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    HOE 32021
  • HY-15622

    DNA Stain Cancer
    meta-iodoHoechst 33258 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    meta-iodoHoechst 33258
  • HY-15623
    Hoechst 33258 analog
    1 Publications Verification

    DNA Stain Others
    Hoechst 33258 analog is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    Hoechst 33258 analog
  • HY-15626

    Fluorescent Dye Others
    ortho-iodoHoechst 33258 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    ortho-iodoHoechst 33258
  • HY-15627

    Fluorescent Dye Others
    Hoechst 33342 analog is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    Hoechst 33342 analog
  • HY-15629

    DNA Stain Others
    HOE 32020 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    HOE 32020
  • HY-15632

    Fluorescent Dye Others
    para-iodoHoechst 33258 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    para-iodoHoechst 33258
  • HY-15559A
    Hoechst 33342 trihydrochloride
    45+ Cited Publications

    bisBenzimide H 33342 trihydrochloride; HOE 33342 trihydrochloride

    Autophagy Others
    Hoechst 33342 trihydrochloride is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    Hoechst 33342 trihydrochloride
  • HY-15561B

    meta-Hoechst trihydrochloride

    Fluorescent Dye Others
    HOE-S 785026 trihydrochloride is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    HOE-S 785026 trihydrochloride
  • HY-15560B
    Hoechst 34580 tetrahydrochloride
    2 Publications Verification

    HOE 34580 tetrahydrochloride

    Amyloid-β Neurological Disease
    Hoechst 34580 tetrahydrochloride is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    Hoechst 34580 tetrahydrochloride
  • HY-15558A
    Hoechst 33258 trihydrochloride
    10+ Cited Publications

    bisBenzimide H 33258 trihydrochloride; H 33258 trihydrochloride

    Fluorescent Dye Cancer
    Hoechst 33258 trihydrochloride is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    Hoechst 33258 trihydrochloride
  • HY-120323
    DRI-C21045
    1 Publications Verification

    TNF Receptor Inflammation/Immunology
    DRI-C21045 (compound 10) is a potent and selective inhibitor of the CD40-CD40L costimulatory protein-protein interaction (PPI) with an IC50 of 0.17 µM. DRI-C21045 shows concentration-dependent inhibition of the activation of NF-κB and B cell proliferation all induced by CD40L with IC50s of 17.1 µM and 4.5 µM, respectively .
    DRI-C21045
  • HY-111817

    Parasite Infection
    ACT-451840 is an orally active, potent and low-toxicity compound, showing activity against sensitive and resistant plasmodium falciparum strains. ACT-451840 targets all asexual blood stages of the parasite, has a rapid onset of action. ACT-451840 behaves in a way similar to artemisinin derivatives, with very rapid onset of action and elimination of parasite. ACT-451840 can be used for the research of malarial [2] .
    ACT-451840
  • HY-15563

    Fluorescent Dye Others
    HOE 33187 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    HOE 33187
  • HY-120508

    AN-9; Pivalyloxymethyl butyrate

    HDAC Bcr-Abl Apoptosis Inflammation/Immunology Cancer
    Pivanex (AN-9), a derivative of Butyric acid, is an orally active HDAC inhibitor. Pivanex down-regulates bcr-abl protein and enhances apoptosis. Pivanex has antimetastic and antiangiogenic properties .
    Pivanex
  • HY-15624

    DNA Stain Cancer
    Hoechst 33258 analog 2 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    Hoechst 33258 analog <em>2</em>
  • HY-15625

    DNA Stain Others
    Hoechst 33258 analog 3 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    Hoechst 33258 analog 3
  • HY-15628

    DNA Stain Others
    Hoechst 33258 analog 5 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    Hoechst 33258 analog 5
  • HY-15630

    Fluorescent Dye Cancer
    Hoechst 33342 analog 2 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    Hoechst 33342 analog <em>2</em>
  • HY-15631
    Hoechst 33258 analog 6
    3 Publications Verification

    Fluorescent Dye Others
    Hoechst 33258 analog 6 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    Hoechst 33258 analog 6
  • HY-15630A

    Fluorescent Dye Others
    Hoechst 33342 analog 2 trihydrochloride is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution .
    Hoechst 33342 analog <em>2</em> trihydrochloride
  • HY-112831
    Osoresnontrine
    1 Publications Verification

    BI-409306

    Phosphodiesterase (PDE) Neurological Disease
    Osoresnontrine (BI-409306) is a potent and selective PDE9A inhibitor, with an IC50 of 52 nM, and shows weak activity against other PDEs, such as PDE1A (IC50, 1.4 µM), PDE1C (IC50, 1.0 µM), PDE2A, PDE3A, PDE4B, PDE5A, PDE6AB, PDE7A, and PDE10A (IC50 all > 10 μM); Osoresnontrine can be used in the research of memory enhancement in CNS disorders.
    Osoresnontrine
  • HY-D0819
    CY5-SE
    5+ Cited Publications

    Cy5 NHS Ester; Sulfo-Cyanine5 Succinimidyl Ester

    Fluorescent Dye Others
    Cy5-SE (Cy5 NHS Ester) is a reactive dye for the labeling of amino-groups in peptides, proteins, and oligonucleotides. This dye requires small amount of organic co-solvent (such as DMF or DMSO) to be used in labeling reaction. This reagent is ideal for very cost-efficient labeling of soluble proteins, as well as all kinds of peptides and oligonucleotides. This reagent also works well in organic solvents for small molecule labeling. Excitation (nm):649, Emission (nm): 670.
    CY5-SE
  • HY-108584

    BMS-204352

    Potassium Channel Neurological Disease
    Flindokalner (BMS-204352) is a potassium channel modulator. Flindokalner is a positive modulator of all neuronal Kv7 channel subtypes expressed in HEK293 cells. Flindokalner is also a large conductance calcium-activated K channel (BKca) positive modulator. Flindokalner shows a negative modulatory activity at Kv7.1 channels (Ki=3.7 μM), and acts as a negative modulator of GABAA receptors. Flindokalner shows anxiolytic efficacy in vivo [2].
    Flindokalner
  • HY-112724

    SHR0302

    JAK Apoptosis Inflammation/Immunology Cancer
    Ivarmacitinib (SHR0302) is a potent and orally active all members of the JAK family inhibitor, particularly JAK1. The selectivity of Ivarmacitinib for JAK1 is >10-fold for JAK2, 77-fold for JAK3, 420-fold for Tyk2. Ivarmacitinib inhibits JAK1-STAT3 phosphorylation and induces the apoptosis of hepatic stellate cells. Ivarmacitinib has anti-proliferative and anti-inflammatory effects [2].
    Ivarmacitinib
  • HY-109538

    Secretin Receptor Neurological Disease Metabolic Disease
    Secretin (swine), a neuroendocrine hormone, is the first hormone to be identifie and is secreted by S cells that are localized primarily in the mucosa of the duodenum. Secretin also is a 27-amino acid peptide, which acts on secretin receptors. Secretin is expressed by cells in all mature enteroendocrine cell subsets and can be prompted by fatty acids. Secretin stimulates the secretion of pancreatic water and bicarbonate. Secretin exerts various effects in organs, can be used for the research of digestive system, central nervous system and energy metabolism [2].
    Secretin (swine)
  • HY-134978A

    SHMT Cancer
    (+)SHIN2 is a serine hydroxymethyltransferase (SHMT) inhibitor, whose target can be traced with 13C-serine. (+)SHIN2 increases survival in NOTCH1-driven mouse primary acute lymphoblastic leukemia (T-ALL) in vivo with a synergistic effect with Methotrexate (HY-14519) . (+)SHIN2 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
    (+)SHIN<em>2</em>
  • HY-148921

    Fungal Infection
    SDH-IN-2 is a potent succinate dehydrogenase (SDH) inhibitor with an IC50 of 0.55 μg/mL. SDH-IN-2 is also an antifungal agent. SDH-IN-2 inhibits phytopathogenic fungia with average EC50 values of 3.82-9.81 μg/mL for all the fungi . SDH-IN-2 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
    SDH-IN-<em>2</em>
  • HY-B0228S9

    Apoptosis Nucleoside Antimetabolite/Analog Autophagy Endogenous Metabolite
    Adenosine- 13C10, 15N5 is the 13C and 15N labeled Adenosine[1]. Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular physiology, including neuronal activity, vascular function, platelet aggregation, and blood cell regulation[2][3].
    Adenosine-13C10,15N5
  • HY-N7434S

    Diethylnitrosamine-d4; DEN-d4

    DNA/RNA Synthesis Cancer
    N-Nitrosodiethylamine-d4 is the deuterium labeled N-Nitrosodiethylamine[1]. N-Nitrosodiethylamine (Diethylnitrosamine) is a potent hepatocarcinogenic dialkylnitrosoamine. N-Nitrosodiethylamine is mainly present in tobacco smoke, water, cheddar cheese, cured, fried meals and many alcoholic beverages. N-Nitrosodiethylamine is responsible for the changes in the nuclear enzymes associated with DNA repair/replication. N-Nitrosodiethylamine results in various tumors in all animal species. The main target organs are the nasal cavity, trachea, lung, esophagus and liver.
    N-Nitrosodiethylamine-d4
  • HY-N7434S1

    Diethylnitrosamine-d10; DEN-d10

    DNA/RNA Synthesis Cancer
    N-Nitrosodiethylamine-d10 is the deuterium labeled N-Nitrosodiethylamine[1]. N-Nitrosodiethylamine (Diethylnitrosamine) is a potent hepatocarcinogenic dialkylnitrosoamine. N-Nitrosodiethylamine is mainly present in tobacco smoke, water, cheddar cheese, cured, fried meals and many alcoholic beverages. N-Nitrosodiethylamine is responsible for the changes in the nuclear enzymes associated with DNA repair/replication. N-Nitrosodiethylamine results in various tumors in all animal species. The main target organs are the nasal cavity, trachea, lung, esophagus and liver.
    N-Nitrosodiethylamine-d10
  • HY-153394

    Fungal Infection
    Aflatoxin Q1 is a hydroxy metabolite of Aflatoxin B1 (AFB1), which is a mycotoxin produced by Aspergillus flavus (A. flavus). Aflatoxin Q1, as well as and aflatoxin B1 8,9-oxide, is the major oxidative products formed from aflatoxin B1 in human liver microsomes, at all substrate concentrations. the 3 alpha-hydroxylation of aflatoxin B1 to aflatoxin Q1 is a potentially significant detoxication pathway [2].
    Aflatoxin Q1
  • HY-112724A

    SHR0302 sulfate

    JAK Apoptosis Inflammation/Immunology Cancer
    Ivarmacitinib (SHR0302) sulfate is a potent and orally active all members of the JAK family inhibitor, particularly JAK1. The selectivity of Ivarmacitinib for JAK1 is >10-fold for JAK2, 77-fold for JAK3, 420-fold for Tyk2. Ivarmacitinib inhibits JAK1-STAT3 phosphorylation and induces the apoptosis of hepatic stellate cells. Ivarmacitinib has anti-proliferative and anti-inflammatory effects [2].
    Ivarmacitinib sulfate
  • HY-122912

    ALDH1Ai 673A

    Aldehyde Dehydrogenase (ALDH) Necroptosis Cancer
    ALDH1A inhibitor 673A is an ALDH1A inhibitor. ALDH1A inhibitor 673A inhibits all three ALDH1A family members (IC50: 246 nM, 230 nM, 348 nM for ALDH1A1, ALDH1A2, ALDH1A3 respectively. ALDH1A inhibitor 673A induces necroptotic cell death preferentially in CD133+ ovarian CSCs. ALDH1A inhibitor 673A also inhibits chemotherapy-resistant tumor growth .
    ALDH1A inhibitor 673A
  • HY-15257
    Mavoglurant
    2 Publications Verification

    AFQ056

    mGluR Neurological Disease
    Mavoglurant (AFQ056) is a potent, selective, non-competitive and orally active mGluR5 antagonist, with an IC50 of 30 nM. Mavoglurant shows a >300 fold selectivity for the mGluR5 over all targets (238) tested. Mavoglurant can be used for the research of Fragile X syndrome (FXS), and L-dopa induced dyskinesias in Parkinson's disease [2]. Mavoglurant is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
    Mavoglurant
  • HY-15627A

    Fluorescent Dye DNA Stain Others
    Hoechst 33342 analog trihydrochloride is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution . Storage: Keep away from light.
    Hoechst 33342 analog trihydrochloride
  • HY-19760

    Epigenetic Reader Domain Inflammation/Immunology
    I-BET282 is a pan-inhibitor of all eight BET bromodomains, and selectivity over other representative bromodomain-containing proteins. I-BET282 shows pIC50s ranging 6.4-7.7 for BRD2 (BD1/BD2), BRD2 (BD1/BD), BRD3 (BD1/BD), and BRD4 (BD1/BD) .
    I-BET282
  • HY-118743

    Prostaglandin Receptor Metabolic Disease
    KMN-80, a derivative of PGE1 (HY-B0131), is a selective and potent agonist of EP4 receptor with an IC50 and a Ki of 3 nM and 2.35 nM, respectively. KMN-80 is against EP3 receptor with an IC50 of 1.4 μM and >10 μM for all other prostanoid receptors . KMN-80 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
    KMN-80
  • HY-14572

    SN 27858

    DNA Alkylator/Crosslinker Drug Metabolite Cancer
    PR-104A (SN 27858) is the alcohol metabolite of phosphate proagent PR-104. PR-104A is a hypoxia-selective DNA cross-linking agent/DNA-damaging agent and cytotoxin. Antitumor Activity . PR-104A is metabolized under hypoxia by the 1-electron NADPH:cytochrome P450 oxidoreductase. PR-104A can be used for the research of relapsed/refractory T-lineage acute lymphoblastic leukemia (T-ALL) [2].
    PR-104A
  • HY-111329

    ILS-JGB-1741

    Sirtuin Apoptosis Cancer
    JGB1741 (ILS-JGB-1741) is a potent and specific SIRT1 activity inhibitor with an IC50 of ∼15 μM. JGB1741 is a weak SIRT2 and SIRT3 inhibitor with an all IC50>100 μM. JGB1741 increases the acetylated p53 levels leading to p53-mediated apoptosis with modulation of Bax/Bcl2 ratio, cytochrome c release and PARP cleavage. JGB1741 has the potential for breast cancer research .
    JGB1741
  • HY-107506

    mGluR Neurological Disease
    Ro 67-4853 is a positive allosteric modulator (PAM) of mGluR1 (pEC50=7.16 for rmGlu1a receptor). Ro67-4853 exhibits activity at all group I mGlu receptors including hmGlu1, rmGlu1, and rmGlu5. Ro 67-4853 enhances the potency of L-Glu by interacting with the transmembrane domain (TMD) of the receptor. Ro 67-4853 potentiates sensory synaptic responses to repetitive vibrissa stimulation [2] .
    Ro 67-4853
  • HY-100978

    DL-Hexanoylcarnitine chloride

    Endogenous Metabolite Metabolic Disease
    (±)-Hexanoylcarnitine chloride is a fatty acid metabolite that breaks down fatty acids into energy that can be used by the body. (±)-Hexanoylcarnitine chloride also serves as a specific and easily detectable biomarker for rat skeletal muscle toxicity. Cerivastatin (HY-129458) and TMPD (HY-W012145) induce an increase in Hexanoylcarnitine in rats in a metabolomic analysis of the rectus femoris muscle. In type 2 diabetes, Hexanoylcarnitine is also significantly associated with and improves prediction of all-cause mortality. Hexanoylcarnitine is a biomarker for the identification of novel pathogenic pathways [2].
    (±)-Hexanoylcarnitine chloride
  • HY-N0086S

    6-Methyladenosine-d3; N-Methyladenosine-d3

    Isotope-Labeled Compounds Infection
    N6-Methyladenosine-d3 (6-Methyladenosine-d3; N-Methyladenosine-d3) is a deuterium labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
    N6-Methyladenosine-d3
  • HY-P5843

    Enterovirus Infection
    Citrullinated LL-37 3cit is a citrullinated LL-37 (HY-P1222) peptide. Citrullinated LL-37 3cit lacks all antiviral activity at 10 μg/mL and retains some activity against HRV at 30 μg/mL. Citrullinated LL-37 3cit reduces the immunomodulatory activity of LL-37. Citrullinated LL-37 3cit shows a moderate loss in the ability to reduce HRV-induced CCL5 secretion .
    Citrullinated LL-37 4cit
  • HY-B0228S13

    Adenine riboside-13C10; D-Adenosine-13C10

    Isotope-Labeled Compounds Nucleoside Antimetabolite/Analog Endogenous Metabolite Autophagy Apoptosis Metabolic Disease Cancer
    Adenosine- 13C10 (Adenine riboside- 13C10; D-Adenosine- 13C10) is 13C-labeled Adenosine (HY-B0228). Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular physiology, including neuronal activity, vascular function, platelet aggregation, and blood cell regulation.
    Adenosine-13C10
  • HY-B0228S12

    Adenine riboside-d13; D-Adenosine-d13

    Isotope-Labeled Compounds Nucleoside Antimetabolite/Analog Endogenous Metabolite Autophagy Apoptosis Metabolic Disease Cancer
    Adenosine-d13 (Adenine riboside-d13; D-Adenosine-d13) is deuterium labeled Adenosine (HY-B0228). Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular physiology, including neuronal activity, vascular function, platelet aggregation, and blood cell regulation.
    Adenosine-d13
  • HY-N0086S2

    6-Methyladenosine-13C4; N-Methyladenosine-13C4

    Isotope-Labeled Compounds Influenza Virus Endogenous Metabolite Infection
    N6-Methyladenosine- 13C4 (6-Methyladenosine- 13C4; N-Methyladenosine- 13C4) is 13C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
    N6-Methyladenosine-13C4
  • HY-19336
    BAZ2-ICR
    1 Publications Verification

    Epigenetic Reader Domain Cancer
    BAZ2-ICR is a potent, selective, cell active and orally active BAZ2A/B bromodomains inhibitor with IC50s of 130 nM and 180 nM, and Kds of 109 nM and 170 nM, respectively. BAZ2-ICR shows 10-15-fold selectivity for binding BAZ2A/B over CECR2 and >100-fold selectivity over all other bromodomains. BAZ2-ICR is an epigenetic chemical probe .
    BAZ<em>2</em>-ICR
  • HY-19760B

    Epigenetic Reader Domain Inflammation/Immunology
    I-BET282E is a pan-inhibitor of all eight BET bromodomains, and selectivity over other representative bromodomain-containing proteins. I-BET282E shows pIC50s ranging 6.4-7.7 for BRD2 (BD1/BD2), BRD2 (BD1/BD), BRD3 (BD1/BD), and BRD4 (BD1/BD) .
    I-BET282E
  • HY-16936

    LRRK2 Neurological Disease
    JH-II-127 is an orally active, highly potent, selective and brain-permeable LRRK2 inhibitor, with IC50s of 6, 2 and 48 nM for wild-type LRRK2 and LRRK2-G2019S and mutant LRRK2-A2016T. JH-II-127 inhibits Ser935 phosphorylation in all tissues of mice, including the brain. JH-II-127 can be used in the study of parkinson's syndrome .
    JH-II-127
  • HY-19476

    Virus Protease Infection
    AG-7404 is an inhibitor of picornaviral 3C protease, with anti-poliovirus activity (EC50=0.080-0.674 μM). AG-7404 has synergy with V-073 (HY-104074) or BTA798 (HY-106254), and fully inhibits all V-073-resistant variants . AG-7404 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
    AG-7404
  • HY-B0228S11

    Adenine riboside-15N5; D-Adenosine-15N5

    Isotope-Labeled Compounds Cancer
    Adenosine- 15N5 (Adenine riboside- 15N5; D-Adenosine- 15N5) is the 15N labled Adenosine (HY-B0228). Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular physiology, including neuronal activity, vascular function, platelet aggregation, and blood cell regulation [2].
    Adenosine-15N5
  • HY-19995
    GSK137647A
    1 Publications Verification

    GSK 137647

    Free Fatty Acid Receptor Metabolic Disease
    GSK137647A (GSK 137647) is a potent, selective free fatty acid receptor 4 (FFA4) agonist with pEC50 values of 6.3, 6.2, and 6.1 for human, mouse and rat FFA4, and pEC50 values < 4.5 for all three species for FFA1, FFA2, and FFA3, respectively. GSK137647A has anti-inflammatory activity. GSK137647A induces insulin secretion and inhibits epithelial ion transport, GSK137647A is related to regulation of glucose homeostasis and anti-inflammatory response [2].
    GSK137647A
  • HY-110105

    Potassium Channel Neurological Disease
    NS8593 hydrochloride is a potent and selective small conductance Ca 2+-activated K + channels (SK channels) inhibitor. NS8593 hydrochloride reversibly inhibits SK3-mediated currents with a Kd value of 77 nM. NS8593 hydrochloride inhibits all the SK1-3 subtypes Ca 2+-dependently (Kds of 0.42, 0.60, and 0.73 μM, respectively, at 0.5 μM Ca 2+), and does not affect the Ca 2+-activated K + channels of intermediate and large conductance (hIK and hBK channels, respectively) [2].
    NS8593 hydrochloride
  • HY-144094

    Histone Methyltransferase Cancer
    EZH2-IN-9 is a potent inhibitor of EZH2. EZH2 overexpression or mutations in the SET region (Y641F, Y641N, A687V, A677G point mutations) all lead to abnormal elevation of H3K27me3 and promote the growth and development of many types of tumors, such as breast cancer, prostate cancer, leukemia, etc. EZH2-IN-9 has the potential for the research of cancer diseases (extracted from patent WO2021180235A1, compound 17) .
    EZH<em>2</em>-IN-9
  • HY-143616

    Histone Methyltransferase Cancer
    EZH2-IN-7 is a potent inhibitor of EZH2. EZH2 overexpression or mutations in the SET region (Y641F, Y641N, A687V, A677G point mutations) all lead to abnormal elevation of H3K27me3 and promote the growth and development of many types of tumors, such as breast cancer, prostate cancer, leukemia, etc. EZH2-IN-7 has the potential for the research of cancer diseases (extracted from patent WO2021129629A1, compound 259) .
    EZH<em>2</em>-IN-7
  • HY-19975
    RN-1734
    5+ Cited Publications

    TRP Channel Neurological Disease
    RN-1734 is selective antagonist of the TRPV4 channel, completely antagonizes 4αPDD-mediated activation of TRPV4 with comparable, low micromolar IC50s for all three species (hTRPV4: 2.3 μM, mTRPV4: 5.9 μM, rTRPV4: 3.2 μM) . RN-1734 clearly decreases the production of tumor necrosis factor α (TNF-α) and interleukin 1β (IL-1β) without altering the number of olig2-positive cells [2].
    RN-1734
  • HY-120878
    CXCR2-IN-2
    1 Publications Verification

    CXCR Inflammation/Immunology
    CXCR2-IN-2 is a selective, brain penetrant, and orally bioavailable CXCR2 antagonist (IC50=5.2 nM/1 nM in β-arrestin assay/CXCR2 Tango assay, respectively). CXCR2-IN-2 displays ~730-fold selectivity over CXCR1 and >1900-fold selectivity over all other chemokine receptors. CXCR2-IN-2 inhibits human whole blood Gro-α induced CD11b expression with an IC50 of 0.04 μM .
    CXCR<em>2</em>-IN-<em>2</em>
  • HY-139254

    IDR3O; I3O

    CDK GSK-3 JNK Neurological Disease
    Indirubin-3′-oxime (IDR3O), a synthetic derivative of indirubin, is a potent inhibitor of cyclin-dependent kinases (CDKs) and glycogen synthase kinase 3β (GSK3β). Indirubin-3′-oxime directly inhibits the activity of all three isoforms of JNK (JNK1, JNK2, and JNK3), with IC50s of 0.8 μM, 1.4 μM, and 1.0 μM, respectively. Indirubin-3′-oxime can enhance height growth via activation of Wnt/β-catenin signaling in chondrocytes [2] .
    Indirubin-3′-oxime
  • HY-121744
    PS10
    1 Publications Verification

    PDHK Inflammation/Immunology
    PS10 is a novel, potent and ATP-competitive pan-PDK inhibitor, inhibits all PDK isoforms with IC50 of 0.8 μM, 0.76 μM, 2.1 μM and 21.3 μM for PDK2, PDK4, PDK1, and PDK3, respectively. PS10 shows high affinity for PDK2 (Kd= 239 nM) than for Hsp90 (Kd= 47 μM) . PS10 improves glucose tolerance, stimulates myocardial carbohydrate oxidation in diet-induced obesity. PS10 has the potential for the investigation of diabetic cardiomyopathy [2].PDK: pyruvate dehydrogenase kinase
    PS10
  • HY-10015
    PAP-1
    5+ Cited Publications

    5-(4-Phenoxybutoxy)psoralen

    Potassium Channel Inflammation/Immunology
    PAP-1 (5-(4-Phenoxybutoxy)psoralen) is a potent, selective, and orally active Kv1.3 blocker (EC50=2 nM). PAP-1 blocks Kv1.3 in a use-dependent manner and acts by preferentially binding to the C-type inactivated state of the channel. PAP-1 exhibits 23-fold selectivity over Kv1.5 (EC50=45 nM), and further displays 33- to 125-fold selectivity over all other Kv1-family channels. PAP-1 does not exhibit cytotoxic or phototoxic effects [2].
    PAP-1
  • HY-108596

    Potassium Channel Inflammation/Immunology
    BL-1249 is a nonsteroidal anti-inflammatory agent (NSAID) and a potassium channel activator. BL-1249 potently activates K2P2.1 (TREK-1) and K2P10.1 (TREK-2) with EC50 values of 5.5 μM and 8.0 μM, respectively. BL-1249 extracellular application activates all TREK subfamily members but has no effect on other K2P subfamilies. BL-1249 exhibits more selective for the bladder (EC50 of 1.26 μM) than vascular tissue (EC50 of 21.0 μM) [2].
    BL-1249
  • HY-15724
    Vercirnon
    1 Publications Verification

    GSK-1605786; CCX282-B; Traficet-EN

    CCR Inflammation/Immunology Endocrinology
    Vercirnon (GSK1605786A) is an orally bioavailable, selective, and potent antagonist of CCR9. Vercirnon inhibits CCR9-mediated Ca 2+ mobilization and chemotaxis on Molt-4 cells with IC50 values of 5.4 and 3.4 nM, respectively. Vercirnon is selective for CCR9 over CCR1-12 and CX3CR1-7 (IC50s>10 µM for all). Vercirnon is an equipotent inhibitor of CCL25-directed chemotaxis of both splice forms of CCR9 (CCR9A and CCR9B) with IC50 values of 2.8 and 2.6 nM, respectively .
    Vercirnon
  • HY-15724A
    Vercirnon sodium
    1 Publications Verification

    GSK-1605786 sodium; CCX282-B sodium; Traficet-EN sodium

    CCR Inflammation/Immunology Endocrinology
    Vercirnon (GSK1605786A) sodium is an orally bioavailable, selective, and potent antagonist of CCR9. Vercirnon sodium inhibits CCR9-mediated Ca 2+ mobilization and chemotaxis on Molt-4 cells with IC50 values of 5.4 and 3.4 nM, respectively. Vercirnon sodium is selective for CCR9 over CCR1-12 and CX3CR1-7 (IC50s>10 µM for all). Vercirnon sodium is an equipotent inhibitor of CCL25-directed chemotaxis of both splice forms of CCR9 (CCR9A and CCR9B) with IC50 values of 2.8 and 2.6 nM, respectively .
    Vercirnon sodium
  • HY-19978

    P2X Receptor Neurological Disease
    RO-3 is a potent, CNS-penetrant, and orally active P2X3 and P2X2/3 antagonist with pIC50s of 5.9 and 7.0 for human homomultimeric P2X3 and heteromultimeric P2X2/3 receptors, respectively. RO-3 shows selectivity for P2X3 and P2X2/3 over all other functional homomultimeric P2X receptors (IC50 >10 μM at P2X1,2,4,5,7) .
    RO-3
  • HY-P99965

    SKY59; RO7112689

    Complement System Cardiovascular Disease Metabolic Disease
    Crovalimab (SKY59; RO7112689) is a novel humanized antibody against C5 in a pH-dependent manner with KDs of 15.2 nM and 16.8 μM at pH 7.4 and 5.8, respectively. Crovalimab binds human FcRn with great affinity (KD: 17 μM at pH 6.0). Crovalimab can block cleavage of C5 by the C5 convertase and inhibite the activity of a C5 variant (p.Arg885His). Crovalimab inhibits C5b-9 formation significantly in all three complement pathways, the classical pathway (CP), lectin pathway (LP), and alternative pathway (AP). Crovalimab has the potential for paroxysmal nocturnal hemoglobinuria (PNH) and complement-mediated diseases research [2].
    Crovalimab
  • HY-131997

    GABA Receptor Neurological Disease Inflammation/Immunology
    2'MeO6MF is a brain-penetrant positive allosteric modulator at α2β1γ2L and all α1-containing GABAA receptors. 2'MeO6MF also can directly activate α2β2/3 and α2β2/3γ2L GABAA receptors. 2'MeO6MF has anxiolytic and psychomotor stabilizing properties. 2'MeO6MF offers neuroprotection and improved functional recovery and dampens the stroke-induced inflammatory response [2].
    <em>2</em>'MeO6MF
  • HY-P1925A
    GO-203 TFA
    2 Publications Verification

    PI3K Reactive Oxygen Species Apoptosis Cancer
    GO-203 TFA is a potent MUC1-C oncoprotein inhibitor. GO-203 TFA is an all D-amino acid peptide that consists of a poly-R transduction domain linked to a CQCRRKN motif that binds to the MUC1-C cytoplasmic tail and blocks MUC1-C homodimerization. GO-203 TFA downregulates TIGAR (TP53-induced glycolysis and apoptosis regulator) protein synthesis by inhibiting the PI3K-AKT-S6K1 pathway. GO-203 TFA induces the production of ROS and loss of mitochondrial transmembrane potential. GO-203 TFA inhibits the growth of colon cancer cells in vitro and as xenografts in nude mice [2].
    GO-203 TFA
  • HY-P5380

    MMP Others
    TNO211 is a biological active peptide. (Matrix Metalloproteinases (MMPs) are a large family of endopeptidases. Collectively, MMPs can degrade all kinds of extracellular matrix proteins, and can also process a number of bioactive molecules. They are known to be involved in the cleavage of cell surface receptors, the release of apoptotic ligands, and chemokine/cytokine inactivation. MMPs are also thought to play a major role in cell behaviors such as cell proliferation, migration (adhesion/dispersion), differentiation, angiogenesis, apoptosis, and host defense.This peptide is a highly soluble fluorogenic MMP substrate for MMP-2, 8, 12, 13 and 14, containing the MMP cleavable Gly-Leu bond and EDANS/DABCYL. Fluorogenic assays using TNO211 are sensitive and can detect MMP activity in culture medium from endothelial cells and untreated synovial fluid from patients. Abs/Em = 340/490 nm.)
    TNO211
  • HY-151824

    ADC Linker Others
    Boc-L-Phe(4-NH-Poc)-OH is a click chemistry reagent containing an azide group. Used as an orthogonally protected building block in peptide synthesis. Propargyloxycarbonyl, commonly abbreviated as Poc or Pryoc, can either be used as alkyne component for standard Click conjugation or in combination with tetrazine linkers in copper-free Diels-Alder type Click reactions. It also has applications as unusual protecting group for amines, hydroxy functions and as esters. All 3 are stable to neat TFA, but can be cleaved at ambient temperature with Co2(CO)8 in TFA:DCM. Deprotection with other transition metals like palladium have also been reported [2]. Boc-L-Phe(4-NH-Poc)-OH is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
    Boc-L-Phe(4-NH-Poc)-OH
  • HY-151837

    ADC Linker Others
    H-L-Phe(4-NH-Poc)-OH (hydrochloride) is a click chemistry reagent containing an azide group. Used as a modified Phe or Tyr analogue in protein and peptide biosynthesis. Propargyloxycarbonyl, commonly abbreviated as Poc or Pryoc, can either be used as alkyne component for standard Click conjugation or in combination with tetrazine linkers in copper-free Diels-Alder type Click reactions. It also has applications as unusual protecting group for amines, hydroxy functions and as esters. All 3 are stable to neat TFA, but can be cleaved at ambient temperature with Co2(CO)8 in TFA:DCM. Deprotection with other transition metals like palladium have also been reported [2]. H-L-Phe(4-NH-Poc)-OH (hydrochloride) is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
    H-L-Phe(4-NH-Poc)-OH hydrochloride