1. Search Result
Search Result
Results for "

All sglt2 Inhibitors

" in MCE Product Catalog:

224

Inhibitors & Agonists

136

Screening Libraries

6

Fluorescent Dye

2

Biochemical Assay Reagents

11

Peptides

9

MCE Kits

5

Inhibitory Antibodies

36

Natural
Products

41

Isotope-Labeled Compounds

Cat. No. Product Name Target Research Areas
  • HY-10451S
    Canagliflozin-d4

    JNJ 28431754-d4

    SGLT Cancer Metabolic Disease
    Canagliflozin D4 is a deuterium labeled Canagliflozin. Canagliflozin is a selective SGLT2 inhibitor.
  • HY-10450S
    Dapagliflozin-d5

    BMS-512148-d5

    SGLT Cancer Metabolic Disease
    Dapagliflozin D5 (BMS-512148 D5) is a deuterium labeled Dapagliflozin. Dapagliflozin is a competitive SGLT2 inhibitor.
  • HY-10449A
    Luseogliflozin hydrate

    TS 071 hydrate

    SGLT Metabolic Disease
    Luseogliflozin (TS 071) hydrate is a selective potent and orally active second-generation sodium-glucose co-transporter 2 (SGLT2) inhibitor with an IC50 of 2.26 nM. Luseogliflozin hydrate can be used for the research of type 2 diabetes mellitus (T2DM).
  • HY-106158
    T-1095

    SGLT Metabolic Disease
    T-1095 is a selective and orally active Na +-glucose cotransporter (SGLT) inhibitor with IC50s of 22.8 µM and 2.3 µM for human SGLT1 and SGLT2, respectively. T-1095 can be used for diabetes research.
  • HY-117010
    Kushenol K

    Cytochrome P450 HSV SGLT Infection Metabolic Disease
    Kushenol K, a flavonoid antioxidant isolated from the roots of Sophora flavescens. Kushenol K is a cytochrome P-450 3A4 (CYP3A4) inhibitor with a Ki value of 1.35 μM. Kushenol K shows weak antiviral activity against HSV-2 (EC50 of 147 μM). Kushenol K also inhibits the activity of SGLT1 and SGLT2.
  • HY-14894
    Ipragliflozin

    ASP1941

    SGLT Metabolic Disease
    Ipragliflozin (ASP1941) is an orally active and selective SGLT2 inhibitor with IC50s of 7.38 and 1876 nM, 6.73 and 1166 nM, 5.64 and 1380 nM for human SGLT2 and SGLT1, rat SGLT2 and SGLT1, mouse SGLT2 and SGLT1, respectively. Antidiabetic agent.
  • HY-14894S
    Ipragliflozin-d5

    ASP1941-d5

    SGLT Metabolic Disease
    Ipragliflozin-d5 (ASP1941-d5) is the deuterium labeled Ipragliflozin. Ipragliflozin (ASP1941) is an orally active and selective SGLT2 inhibitor with IC50s of 7.38 and 1876 nM, 6.73 and 1166 nM, 5.64 and 1380 nM for human SGLT2 and SGLT1, rat SGLT2 and SGLT1, mouse SGLT2 and SGLT1, respectively. Antidiabetic agent.
  • HY-13414
    Remogliflozin

    Remogliflozin A

    SGLT Metabolic Disease
    Remogliflozin is a potent and selective inhibitor of SGLT2 (sodium-glucose cotransporter 2) with Kis of 12.4 and 26 nM for human and rat SGLT2, respectively.
  • HY-14902
    Tofogliflozin

    CSG452

    SGLT Metabolic Disease
    Tofogliflozin(CSG-452) is a potent and highly specific sodium/glucose cotransporter 2(SGLT2) inhibitor with Ki values of 2.9, 14.9, and 6.4 nM for human, rat, and mouse SGLT2.
  • HY-109092
    Licogliflozin

    LIK066

    SGLT Metabolic Disease Inflammation/Immunology
    Licogliflozin is a sodium glucose cotransporter (SGLT1 and SGLT2) inhibitor.
  • HY-15461
    Ertugliflozin

    PF-04971729

    SGLT Metabolic Disease
    Ertugliflozin (PF-04971729) is a potent, selective and orally active inhibitor of the sodium-dependent glucose cotransporter 2 (SGLT2), with an IC50 of 0.877 nM for h-SGLT2. Has the potential for the treatment of type 2 diabetes mellitus.
  • HY-15409
    Empagliflozin

    BI 10773

    SGLT Metabolic Disease
    Empagliflozin (BI 107730 is a selective sodium glucose cotransporter-2 (SGLT-2) inhibitor with an IC50 of 3.1 nM for human SGLT-2.
  • HY-15461A
    Ertugliflozin L-pyroglutamic acid

    PF-04971729 L-pyroglutamic acid

    SGLT Metabolic Disease
    Ertugliflozin L-pyroglutamic acid (PF-04971729 L-pyroglutamic acid) is a potent, selective and orally active inhibitor of the sodium-dependent glucose cotransporter 2 (SGLT2), with an IC50 of 0.877 nM for h-SGLT2. Has the potential for the treatment of type 2 diabetes mellitus.
  • HY-109018
    Velagliflozin

    SGLT Metabolic Disease
    Velagliflozin is an orally available sodium-glucose cotransporter 2 (SGLT2) inhibitor, with anti-diabetic activity.
  • HY-15516
    Sotagliflozin

    LX-4211; LP-802034

    SGLT Metabolic Disease
    Sotagliflozin (LX-4211) is a potent dual SGLT2/1 inhibitor. Antidiabetic agents.
  • HY-15409S
    Empagliflozin-d4

    BI 10773-d4

    SGLT Metabolic Disease
    Empagliflozin-d4 is deuterium labeled Empagliflozin. Empagliflozin (BI 107730 is a selective sodium glucose cotransporter-2 (SGLT-2) inhibitor with an IC50 of 3.1 nM for human SGLT-2.
  • HY-13413
    Tofogliflozin (hydrate)

    CSG-452 hydrate

    SGLT Reactive Oxygen Species Metabolic Disease
    Tofogliflozin hydrate (CSG-452 hydrate) is a potent and highly specific sodium/glucose cotransporter 2 (SGLT2) inhibitor with an IC50 of 2.9 nM and Ki values of 2.9 nM, 14.9 nM, and 6.4 nM for human, rat, and mouse SGLT2. Tofogliflozin partially inhibits high glucose-induced reactive oxyen species (ROS) generation in tubular cells.
  • HY-101782
    HSK0935

    SGLT Metabolic Disease
    HSK0935 is a potent, highly selective and orally available SGLT2 inhibitor with an IC50 of 1.3 nM. Antihyperglycemic activities.
  • HY-138944
    SGLT1/2-IN-1

    SGLT Metabolic Disease
    SGLT1/2-IN-1 is a dual SGLT1/SGLT2 inhibitor extract from WO2015032272A1, compound 2 .
  • HY-109144
    Enavogliflozin

    DWP-16001

    SGLT Metabolic Disease
    Enavogliflozin (DWP-16001), an antidiabetic agent, is an orally active, best-in-class and selective sodium-glucose cotransporter-2 (SGLT-2) inhibitor.
  • HY-145357
    SGLT1/2-IN-2

    SGLT Metabolic Disease
    SGLT1/2-IN-2 demonstrates potent dual inhibitory activities (IC50 = 96 nM for SGLT1 and IC50 = 1.3 nM for SGLT2).
  • HY-14894A
    Ipragliflozin (L-Proline)

    SGLT Metabolic Disease
    Ipragliflozin (L-Proline) is a highly potent and selective SGLT2 inhibitor with an IC50 of 2.8 nM; little and NO potency for SGLT1/3/4/5/6.
  • HY-I0383
    Canagliflozin hemihydrate

    JNJ 28431754 hemihydrate

    SGLT Cancer Metabolic Disease
    Canagliflozin hemihydrate (JNJ28431754 hemihydrate) is a selective SGLT2 inhibitor with IC50s of 2 nM, 3.7 nM, and 4.4 nM for mSGLT2, rSGLT2, and hSGLT2 in CHOK cells, respectively.
  • HY-10451
    Canagliflozin

    JNJ 28431754

    SGLT Metabolic Disease Cancer
    Canagliflozin (JNJ 28431754) is a selective SGLT2 inhibitor with IC50s of 2 nM, 3.7 nM, and 4.4 nM for mSGLT2, rSGLT2, and hSGLT2 in CHOK cells, respectively.
  • HY-12608
    TA-1887

    JNJ-39933673

    SGLT Metabolic Disease
    TA-1887 (JNJ-39933673) is a highly potent, selective and orally active SGLT2 inhibitor (IC50: 1.4 nM) with antihyperglycemic effects. TA-1887 can be used in the research of diabetes.
  • HY-123797
    KGA-2727

    SGLT Metabolic Disease
    KGA-2727 is a first selective, high-affinity and orally active SGLT1 inhibitor with Kis of 97.4 nM and 43.5 nM for human and rat SGLT1, respectively. The selectivity ratios (Ki for SGLT2/Ki for SGLT1) of KGA-2727 are 140 (human) and 390 (rat). KGA-2727 has antidiabetic efficacy.
  • HY-10450
    Dapagliflozin

    BMS-512148

    SGLT Metabolic Disease Cancer
    Dapagliflozin (BMS-512148), a new type of drug used to treat diabetes mellitus (DM), is a competitive sodium/glucose cotransporter 2 (SGLT2) inhibitor, which results in excretion of glucose into the urine. Dapagliflozin induces HIF1 expression and attenuates renal IR injury.
  • HY-101122
    LX2761

    SGLT Metabolic Disease
    LX2761 is chemically stable and potent inhibitor against sodium-dependent glucose cotransporter 1 (SGLT1) and SGLT2 in vitro with IC50s of 2.2 nM and 2.7nM for hSGLT1 and hSGLT2, but displays specific SGLT1 inhibition in the gastrointestinal (GI) tract.
  • HY-17638
    Mizagliflozin

    DSP-3235 free base; KGA-3235 free base; GSK-1614235 free base

    SGLT Metabolic Disease
    Mizagliflozin (DSP-3235 free base) is a potent, orally active and selective SGLT1 inhibitor, with a Ki of 27 nM for human SGLT1. Mizagliflozin displays 303-fold selectivity over SGLT2. Mizagliflozin is used as an antidiabetic drug that can modify postprandial blood glucose excursion. Mizagliflozin also exhibits potential in the amelioration of chronic constipation.
  • HY-14945
    Remogliflozin etabonate

    GSK189075

    SGLT Metabolic Disease
    Remogliflozin etabonate (GSK189075) is an orally active, selective and low-affinity sodium glucose cotransporter (SGLT2) inhibitor with Ki values of 1.95 μM, 2.14 μM, 43.1 μM, 8.57 μM for hSGLT2, rSGLT2, hSGLT1, rSGLT1, respectively. Remogliflozin etabonate is a prodrug based on benzylpyrazole glucoside and is metabolized to its active form, Remogliflozin, in the body. Remogliflozin etabonate exhibits antidiabetic efficacy in rodent models.
  • HY-10450A
    Dapagliflozin ((2S)-1,2-propanediol, hydrate)

    BMS-512148 (2S)-1,2-propanediol, hydrate

    SGLT Cancer Metabolic Disease
    Dapagliflozin ((2S)-1,2-propanediol, hydrate) is the S-enantiomer of Dapagliflozin 1,2-propanediol, hydrate. Dapagliflozin ((2S)-1,2-propanediol, hydrate), a new type of drug used to treat diabetes mellitus (DM), is a competitive sodium/glucose cotransporter 2 (SGLT2) inhibitor, which results in excretion of glucose into the urine. Dapagliflozin ((2S)-1,2-propanediol, hydrate) induces HIF1 expression and attenuates renal IR injury.
  • HY-N0142
    Phloretin

    NSC 407292; RJC 02792

    SGLT Endogenous Metabolite GLUT Metabolic Disease Cancer
    Phloretin (NSC 407292; RJC 02792) is a flavonoid extracted from Malus pumila Mill., has anti-inflammatory activities. Phloridzin is a specific, competitive and orally active inhibitor of sodium/glucose cotransporters in the intestine (SGLT1) and kidney (SGLT2). Phloretin inhibits Yeast-made GLUT1 as well as Human erythrocyte GLUT1 with IC50values of 49 μM and 61 μM, respectively.Phloretin has the potential for the treatment of rheumatoid arthritis (RA) and allergic airway inflammation.
  • HY-W004500
    All-trans-retinal

    Endogenous Metabolite Others
    All-trans-retinal is a one of the major vitamin A metabolites in the retina. In physiological conditions, all-trans-RAL is regenerated to the visual chromophore, 11-cis-retinal.
  • HY-W004500S1
    All-trans-retinal-d5

    Endogenous Metabolite Others
    All-trans-retinal-d5 is the deuterium labeled All-trans-retinal. All-trans-retinal is a one of the major vitamin A metabolites in the retina. In physiological conditions, all-trans-RAL is regenerated to the visual chromophore, 11-cis-retinal.
  • HY-N7495
    all-trans-Anhydro Retinol

    Anhydrovitamin A

    Endogenous Metabolite Metabolic Disease
    all-trans-Anhydro Retinol (Anhydrovitamin A) is a metabolite of Vitamin A. all-trans-Anhydro Retinol is used in synthetic multivitamin preparations.
  • HY-107494A
    all-trans-4-Oxoretinoic acid

    All-trans 4-Keto Retinoic Acid

    Endogenous Metabolite Metabolic Disease
    all-trans-4-Oxoretinoic acid, an active metabolite of vitamin A, induces gene transcription via binding to nuclear retinoic acid receptors (RARs).
  • HY-D0987
    Stains-All

    Calmodulin Others Others
    Stains-All, a cationic carbocyanine dye, is a convenient probe to study the structural features of the individual calcium-binding sites of calmodulin (CaM) and related calcium-binding proteins (CaBP).
  • HY-10449
    Luseogliflozin

    TS 071

    SGLT Metabolic Disease
    Luseogliflozin (TS 071) is a potent, selective, orally active sodium-dependent glucose cotransporter (SGLT) 2 inhibitor, with an IC50 of 2.26 nM, about 1765-fold selectivity over SGLT1 (IC50, 3990 nM). Luseogliflozin has the protential for treating type 2 diabetes.
  • HY-124573
    OBI-3424

    TH-3424

    DNA Alkylator/Crosslinker Cancer
    OBI-3424 (TH-3424) is a prodrug that is selectively converted by AKR1C3 (aldo-keto reductase 1C3) to a potent DNA-alkylating agent. OBI-3424 can be used for hepatocellular carcinoma, castrate-resistant prostate cancer, and acute lymphoblastic leukemia (ALL) research.
  • HY-A0143
    Dihomo-γ-linolenic acid

    All-cis-8,11,14-Eicosatrienoic acid

    Endogenous Metabolite Cancer Inflammation/Immunology Cardiovascular Disease
    Dihomo-γ-linolenic acid (all-cis-8,11,14-Eicosatrienoic acid) is a 20-carbon ω-6 fatty acid, with anti-inflammatory and anti-proliferative activities. Dihomo-γ-linolenic acid attenuates atherosclerosis in the apolipoprotein E deficient mouse model system.
  • HY-A0143S
    Dihomo-γ-linolenic acid-d6

    All-cis-8,11,14-Eicosatrienoic acid-d6

    Endogenous Metabolite Cancer Inflammation/Immunology Cardiovascular Disease
    Dihomo-γ-linolenic acid-d6 (all-cis-8,11,14-Eicosatrienoic acid-d6) is the deuterium labeled Dihomo-γ-linolenic acid. Dihomo-γ-linolenic acid (all-cis-8,11,14-Eicosatrienoic acid) is a 20-carbon ω-6 fatty acid, with anti-inflammatory and anti-proliferative activities. Dihomo-γ-linolenic acid attenuates atherosclerosis in the apolipoprotein E deficient mouse model system.
  • HY-136175
    Revumenib

    SNDX-5613

    Epigenetic Reader Domain Cancer
    Revumenib (SNDX-5613) is a potent and specific Menin-MLL inhibitor with a binding Ki of 0.149 nM and a cell based IC50 of 10-20 nM. Revumenib can be used for the research of MLL-rearranged (MLL-r) acute leukemias, including acute lymphoblastic leukemia (ALL) and acute myeloid leukemia (AML).
  • HY-145696
    SJ10542

    PROTACs JAK Cancer Inflammation/Immunology
    SJ10542 is a potent and selective JAK2/3 directing phenyl glutarimide (PG)-PROTAC with DC50s of 14, 11, and 24 nM for JAK2, JAK3, and JAK2-fusion ALL, respectively. SJ10542 utilizes a PG ligand as the cereblon (CRBN) recruiter.
  • HY-117596
    UNC569

    TAM Receptor Cancer
    UNC569 is a potent, reversible, ATP-competitive and orally active Mer kinase inhibitor with an IC50 of 2.9 nM and a Ki of 4.3 nM. UNC569 also inhibits Axl and Tyro3 with IC50s of 37 nM and 48 nM, respectively. UNC569 can be used for acute lymphoblastic leukemia (ALL) and atypical teratoid/rhabdoid tumors research
  • HY-N2302
    Fucoxanthin

    All-trans-Fucoxanthin

    Others Cancer Metabolic Disease Inflammation/Immunology
    Fucoxanthin is a marine carotenoid and shows anti-obesity, anti-diabetic, anti-oxidant, anti-inflammatory and anticancer activities.
  • HY-130640
    (S,R,S)-AHPC-Me-C7 ester

    E3 Ligase Ligand-Linker Conjugates Cancer
    (S,R,S)-AHPC-Me-C7 ester is a E3 ligase ligand-linker conjugate used to synthesise BCL-XL PROTAC degraders.
  • HY-B1960
    Canthaxanthin

    E 161g; All-trans-Canthaxanthin

    Reactive Oxygen Species Endogenous Metabolite Cancer Inflammation/Immunology
    Canthaxanthin is a red-orange carotenoid with various biological activities, such as antioxidant, antitumor properties.
  • HY-14649
    Retinoic acid

    Vitamin A acid; All-trans-Retinoic acid; ATRA

    RAR/RXR PPAR Endogenous Metabolite Autophagy Cancer
    Retinoic acid is a metabolite of vitamin A that plays important roles in cell growth, differentiation, and organogenesis. Retinoic acid is a natural agonist of RAR nuclear receptors, with IC50s of 14 nM for RARα/β/γ. Retinoic acid bind to PPARβ/δ with Kd of 17 nM. Retinoic acid acts as an inhibitor of transcription factor Nrf2 through activation of retinoic acid receptor alpha.
  • HY-101541
    Docosahexaenoic Acid methyl ester

    Methyl docosahexaenoate; All cis-DHA methyl ester

    Others Neurological Disease
    Docosahexaenoic Acid methyl ester is a methylated docosahexaenoic acid analog which can be intercalated into membrane phospholipids without being oxidized or hydrolyzed.
  • HY-B1342S1
    Retinol-d6

    Vitamin A1-d6; All-trans-Retinol-d6

    Endogenous Metabolite Metabolic Disease
    Retinol-d6 (Vitamin A1-d6) is the deuterium labeled Vitamin A. Retinol is an endogenous metabolite.
  • HY-B1342S2
    Retinol-d4

    Vitamin A1-d4; All-trans-Retinol-d4

    Endogenous Metabolite Metabolic Disease
    Retinol-d4 (Vitamin A1-d4) is the deuterium labeled Vitamin A. Retinol is an endogenous metabolite.
  • HY-B1342S
    Retinol-d8

    Vitamin A1-d8; All-trans-Retinol-d8

    Endogenous Metabolite Metabolic Disease
    Retinol-d8 is the deuterium labeled Vitamin A. Retinol is an endogenous metabolite.
  • HY-108604
    Bisindolylmaleimide II

    Bis II

    PKC Cancer Metabolic Disease
    Bisindolylmaleimide II is a general inhibitor of all PKC subtypes.
  • HY-D0889
    Glycylglycine

    Endogenous Metabolite Metabolic Disease
    Glycylglycine is the simplest of all peptides and could function as a gamma-glutamyl acceptor.
  • HY-114227
    Hexidium iodide

    DNA Stain Others Inflammation/Immunology
    Hexidium iodide, a fluorescent nucleic binding acid stain (excitation/emission ~ 518/600 nm), permeants to mammalian cells and selectively stains almost all gram-positive bacteria. Hexidium iodide can bind to the DNA of all bacteria after permeabilization by EDTA.
  • HY-13022
    CC-401 hydrochloride

    CC401 HCl

    JNK Cancer
    CC-401 hydrochloride is a potent inhibitor of all three forms of JNK with Ki of 25 to 50 nM.
  • HY-13022A
    CC-401

    JNK Cancer
    CC-401 is a potent inhibitor of all three forms of JNK with Ki of 25 to 50 nM.
  • HY-147330
    SJ1008030

    PROTACs JAK Cancer
    SJ1008030 (compound 8) is a JAK2 PROTAC which selectively degrades JAK2. SJ1008030 inhibits MHH–CALL-4 cells with an EC50 of 5.4 nM and an IC50 of 32.09 nM. SJ1008030 can be used for the research of leukemia.
  • HY-D1341
    Coumberone

    Others Cancer
    Coumberone is a metabolic fluorogenic probe, and isoform-selective substrate for all AKR1C isoforms. Coumberone can be reduced by all four members of the AKR1C family to its fluorescent alcohol coumberol. Coumberone can be used for the research of AKR1C.
  • HY-113159
    Docosapentaenoic acid 22n-3

    Endogenous Metabolite Metabolic Disease
    Docosapentaenoic acid (22n-3) is a component of phospholipids found in all animal cell membranes.
  • HY-P9906
    Bevacizumab

    Anti-Human VEGF, Humanized Antibody

    VEGFR Cancer
    Bevacizumab, a humanized IgG1 monoclonal antibody, specifically binds to all VEGF-A isoforms with high affinity.
  • HY-14531
    Talarozole

    R115866

    RAR/RXR Cytochrome P450 Autophagy Inflammation/Immunology
    Talarozole (R115866) is an oral systemic all-trans retinoic acid metabolism blocking agent (RAMBA) which increases intracellular levels of endogenous all-trans retinoic acid (RA). Talarozole inhibits both CYP26A1 and CYP26B1 with IC50s of 5.4 and 0.46 nM, respectively.
  • HY-121324
    Prometryn

    Others Others
    Prometryn could improves the control of all weed species and increased lint yield compared with the systems.
  • HY-B1216
    Oxeladin citrate

    Others Inflammation/Immunology
    Oxeladin citrate is a cough suppressant, is a highly potent and effective drug used to treat all types of cough of various etiologies.
  • HY-N2318
    Podocarpic acid

    TRP Channel Neurological Disease
    Podocarpic acid is a natural product, which has the best all-round positive effect and acts as a novel TRPA1 activator.
  • HY-12808
    STF-118804

    NAMPT Apoptosis Cancer
    STF-118804 is a highly specific NAMPT inhibitor; reduces the viability of most B-ALL cell lines with IC50 <10 nM.
  • HY-P9906A
    Bevacizumab (PBS)

    Anti-Human VEGF, Humanized Antibody (PBS)

    VEGFR Cancer
    Bevacizumab, a humanized IgG1 monoclonal antibody, specifically binds to all VEGF-A isoforms with high affinity.
  • HY-W017770
    S-Adenosyl-L-methionine disulfate tosylate

    Ademetionine disulfate tosylate; S-Adenosyl methionine disulfate tosylate; AdoMet disulfate tosylate

    Endogenous Metabolite Neurological Disease Cancer
    S-Adenosyl-L-methionine disulfate tosylate (Ademetionine disulfate tosylate) is the principal biological methyl donor synthesized in all mammalian cells but most abundantly in the liver.
  • HY-130573
    DMAPP

    DimethylAllyl diphosphate

    Others Metabolic Disease
    DMAPP (Dimethylallyl pyrophosphate) is an isoprenoid precursor. DMAPP, as an isomer of isopentenyl pyrophosphate (IPP), exists in virtually all life forms.
  • HY-Y0258
    Benzocaine

    Sodium Channel Bacterial Neurological Disease
    Benzocaine shares a common receptor with all othe rLAs in the voltage-gated Na + channel, with an IC50 of 0.8 mM tested with a potential of +30 mV.
  • HY-107383
    Tetrahydrobiopterin

    (Rac)-Sapropterin

    NO Synthase Endogenous Metabolite Inflammation/Immunology
    Tetrahydrobiopterin ((Rac)-Sapropterin) is a cofactor of the aromatic amino acid hydroxylases enzymes and also acts as an essential cofactor for all nitric oxide synthase (NOS) isoforms.
  • HY-13701
    Nelarabine

    506U78; GW 506U78; Nelzarabine

    Nucleoside Antimetabolite/Analog Apoptosis Cancer
    Nelarabine (506U78) is a nucleoside analogue and can be used for the research of T cell acute lymphoblastic leukemia (T-ALL).
  • HY-14802
    Talarozole (R enantiomer)

    (R)-Talarozole

    Cytochrome P450 Cancer
    Talarozole R enantiomer is a potent and selective inhibitor of cytochrome P450 26-mediated breakdown of endogenous all-trans retinoic acid for the treatment of psoriasis and acne.
  • HY-130573A
    Dimethylallyl Pyrophosphate triammonium salt

    DimethylAllyl diphosphate triammonium

    Others Metabolic Disease
    DMAPP (Dimethylallyl pyrophosphate) triammonium is an isoprenoid precursor. DMAPP triammonium, as an isomer of isopentenyl pyrophosphate (IPP), exists in virtually all life forms.
  • HY-N0913
    Manninotriose

    Others Endogenous Metabolite Others
    Manninotriose is a novel and important player in the RFO(Raffinose family oligosaccharides) metabolism of red dead deadnettle; potential to improve the side effects of MTX for ALL treatment.
  • HY-N2022
    Castanospermine

    Glucosidase Cancer
    Castanospermine inhibits all forms of α- and β-glucosidases, especially glucosidase l (required for glucoprotein processing by transfer of mannose and glucose from asparagine-linked lipids).
  • HY-B0216
    Ethynyl Estradiol

    17α-Ethynylestradiol; Ethynylestradiol

    Estrogen Receptor/ERR Endogenous Metabolite Endocrinology Cancer
    Ethynyl Estradiol (17α-Ethynylestradiol;Ethynylestradiol) is an orally bio-active estrogen used in almost all modern formulations of combined oral contraceptive pills.
  • HY-14614D
    S-Adenosyl-L-methionine iodide

    S-Adenosyl methionine iodide; Ademetionine iodide; AdoMet iodide

    Endogenous Metabolite Metabolic Disease Cancer
    S-(5'-Adenosyl)-L-methionine iodide (S-Adenosyl-L-methionine iodide) is an important methyl donor that is found in all living organisms.
  • HY-14817
    Indeglitazar

    PPM 204

    PPAR Metabolic Disease
    Indeglitazar (PPM 204) is an orally available PPAR pan-agonist for all three PPARα, PPARδ and PPARγ.
  • HY-P1486
    Angiotensinogen (1-14), human

    Endogenous Metabolite Cardiovascular Disease
    Angiotensinogen (1-14), human is a fragment of the renin substrate angiotensinogen. Angiotensinogen is naturally occurring substrate for renin and a precursor for all angiotensin peptides.
  • HY-123786
    NSC745887

    Others Cancer
    NSC745887 (compound 25) is an anti-cancer agent. NSC745887 exhibits dose-dependent inhibition of proliferation in all 60 cancer cell lines.
  • HY-P1486A
    Angiotensinogen (1-14), human TFA

    Endogenous Metabolite Cardiovascular Disease
    Angiotensinogen (1-14), human TFA is a fragment of the renin substrate angiotensinogen. Angiotensinogen is naturally occurring substrate for renin and a precursor for all angiotensin peptides.
  • HY-112542
    Nemadectin

    CL-287088; LL-F28249 α

    Parasite Antibiotic Infection
    Nemadectin (CL-287088), an orally active broad-spectrum endectocide, is highly efficacious against natural infections of all the major canine gastrointestinal helminthes. Anthelmintic activity.
  • HY-U00189
    Sch412348

    Adenosine Receptor Neurological Disease
    Sch412348 is a potent competitive antagonist of the human adenosine A2A receptor (Ki=0.6 nM) and has >1000-fold selectivity over all other adenosine receptors.
  • HY-147092
    Oryzalin

    Microtubule/Tubulin Others
    Oryzalin is a dinitroaniline herbicide, binding to plant tubulin and inhibits microtubule (MT) polymerization in vitro. Oryzalin depolymerizes MTs and prevented the polymerization of new MTs at all stages of the mitotic cycle.
  • HY-W004260
    Arachidic acid

    Icosanoic acid

    Endogenous Metabolite Others
    Arachidonic acid (Icosanoic acid), a long-chain fatty acid, is present in all mammalian cells, typically esterified to membrane phospholipids, and is one of the most abundant polyunsaturated fatty acids present in human tissue.
  • HY-14608
    L-Glutamic acid

    Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
  • HY-Y0258S
    Benzocaine-d4

    Sodium Channel Neurological Disease
    Benzocaine-d4 is the deuterium labeled Benzocaine. Benzocaine shares a common receptor with all othe rLAs in the voltage-gated Na + channel, with an IC50 of 0.8 mM tested with a potential of +30 mV.
  • HY-16911
    AFN-1252

    API-1252; Debio 1452

    Bacterial Antibiotic Infection
    AFN-1252(Debio 1452) is a potent inhibitor of enoyl-acyl carrier protein reductase (FabI), inhibited all clinical isolates of Staphylococcus aureus and Staphylococcus epidermidis at concentrations of ≤0.12 μg/ml.
  • HY-136522
    S2116

    Histone Demethylase Apoptosis Cancer
    S2116, a N-alkylated tranylcypromine (TCP) derivative, is a potent lysine-specific demethylase 1 (LSD1) inhibitor. S2116 increases H3K9 methylation and reciprocal H3K27 deacetylation at super-enhancer regions. S2116 induces apoptosis in TCP-resistant T-cell acute lymphoblastic leukemia (T-ALL) cells by repressing transcription of the NOTCH3 and TAL1 genes. S2116 significantly retardes the growth of T-ALL cells in xenotransplanted mice.
  • HY-Y0258S1
    Benzocaine-(ethyl-d5)

    Sodium Channel Neurological Disease
    Benzocaine-(ethyl-d5) is the deuterium labeled Benzocaine. Benzocaine shares a common receptor with all othe rLAs in the voltage-gated Na + channel, with an IC50 of 0.8 mM tested with a potential of +30 mV.
  • HY-125652
    Macrosphelide A

    Antibiotic Others Infection
    Macrosphelide A is a macrolide antibiotic. Macrosphelide A inhibits growth of some ascomycetes, basidiomycetes, oomycetes and all four Gram-positive bacteria tested, including the medically important Staphylococcus aureus with a MIC of ≤500 μg/mL.
  • HY-146809
    Galectin-3 antagonist 2

    Galectin Cancer
    Galectin-3 is a β Galactoside specific carbohydrate recognition protein (lectin) has the ability to promote the migration of B cell precursor acute lymphoblastic leukemia (BCP-ALL) cells and withstand drug therapy.
  • HY-14608A
    L-Glutamic acid monosodium salt

    iGluR Apoptosis Ferroptosis Endogenous Metabolite Neurological Disease
    L-Glutamic acid monosodium salt acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). (S)-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
  • HY-12866
    Larotrectinib

    LOXO-101; ARRY-470

    Trk Receptor Apoptosis Cancer
    Larotrectinib (LOXO-101) is an ATP-competitive oral, selective inhibitor of the tropomyosin-related kinase (TRK) family receptors, with low nanomolar 50% inhibitory concentrations against all three isoforms (TRKA, B, and C).
  • HY-120234
    Z-LLNle-CHO

    Z-Leu-Leu-Nle-CHO; GSII

    γ-secretase Proteasome Apoptosis Cancer
    Z-LLNle-CHO (Z-Leu-Leu-Nle-CHO) is a γ-secretase inhibitor I. Z-LLNle-CHO induces caspase and ROS-dependent apoptosis by blocking the Akt-mediated pro-survival pathway. Z-LLNle-CHO can be used in cancer research, such as breast cancer and leukaemia.
  • HY-128607
    Mcl1-IN-9

    Bcl-2 Family Cancer
    Mcl1-IN-9 is a potent myeloid cell leukemia-1 (Mcl-1) Inhibitor with an IC50 of 446 nM in reengineered BCR-ABL+ B-ALL cells and a Ki of 0.03 nM.
  • HY-111778
    EHMT2-IN-1

    Histone Methyltransferase Cancer
    EHMT2-IN-1 is a potent EHMT inhibitor, with IC50s of all <100 nM for EHMT1 peptide, EHMT2 peptide and cellular EHMT2. Used in the research of blood disorder or cancer.
  • HY-139748
    ETX0462

    Antibiotic Bacterial Infection
    ETX0462 is a gram-negative chemotype antibiotic. ETX0462 has potent in vitro and in vivo activity against Pseudomonas aeruginosa plus all other Gram-negative ESKAPE pathogens, Stenotrophomonas maltophilia and biothreat pathogens.
  • HY-111904
    EHMT2-IN-2

    Histone Methyltransferase Cancer
    EHMT2-IN-2 is a potent EHMT inhibitor, with IC50s of all <100 nM for EHMT1 peptide, EHMT2 peptide and cellular EHMT2. Used in the research of blood disease or cancer.
  • HY-136523
    S2157

    Histone Demethylase Apoptosis Cancer
    S2157, a N-alkylated tranylcypromine (TCP) derivative, is a potent lysine-specific demethylase 1 (LSD1) inhibitor. S2157 increases H3K9 methylation and reciprocal H3K27 deacetylation at super-enhancer regions. S2157 induces apoptosis in TCP-resistant T-cell acute lymphoblastic leukemia (T-ALL) cells by repressing transcription of the NOTCH3 and TAL1 genes. S2157 efficiently pass through the blood-brain barrier and can almost completely eradicate CNS leukemia in mice transplanted with T-ALL cells.
  • HY-N0086
    N6-Methyladenosine

    6-Methyladenosine; N-Methyladenosine

    Endogenous Metabolite Influenza Virus Infection
    N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
  • HY-21088
    3-Amino-2-piperidinone

    Cyclo-ornithine

    Endogenous Metabolite Metabolic Disease
    3-aminopiperidine-2-one is a metabolite from all living organisms. 3-aminopiperidine-2-one is a delta-lactam that is 2-piperidone substituted at position 3 by an amino group.
  • HY-145568
    Feniralstat

    Ser/Thr Protease Metabolic Disease Cardiovascular Disease
    Feniralstat (compound 30), a pyrazole derivative, is a potent kallikrein inhibitor with an IC50 of 6.7 nM for Human plasma kallikrein (pKal). Feniralstat has no inhibition on Human KLKl, Human FXIa, Human Factor Xlla (all IC50>40 μM).
  • HY-N3841
    ε-​Viniferin

    epsilon-Viniferin

    Cytochrome P450 Inflammation/Immunology
    ε-Viniferin, the dimer of Resveratrol and isolated from Vitis vinifera, displays a potent inhibitory for all the CYP activities, with Ki values from 0.5-20 μM. ε-Viniferin possesses potent antioxidant capacity.
  • HY-18732A
    L-NMMA acetate

    Tilarginine acetate; Methylarginine acetate

    NO Synthase Endogenous Metabolite Cardiovascular Disease Cancer
    L-NMMA acetate is a nitric oxide synthase inhibitor of all NOS isoforms including NOS1, NOS2, and NOS3. The Ki values for nNOS (rat), eNOS (human), and iNOS (mouse) are approximately 0.18, 0.4, and 6 µM, respectively.
  • HY-147217
    Bepirovirsen

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
  • HY-134438
    Hexanoyl coenzyme A trilithium

    Endogenous Metabolite Metabolic Disease
    Hexanoyl coenzyme A trilithium is a hexanoyl-based medium-chain fatty acyl coenzyme A that is present in all organisms. Hexanoyl coenzyme A trilithium can be used as a precursor for cannabinoid biosynthesis and acts as a competitive inhibitor of medium-chain acyl coenzyme A dehydrogenase (MCAD).
  • HY-W004260S4
    Arachidic acid-d4

    Icosanoic acid-d4

    Endogenous Metabolite
    Arachidic acid-d4 is the deuterium labeled Arachidic acid. Arachidonic acid (Icosanoic acid), a long-chain fatty acid, is present in all mammalian cells, typically esterified to membrane phospholipids, and is one of the most abundant polyunsaturated fatty acids present in human tissue.
  • HY-12866A
    Larotrectinib sulfate

    LOXO-101 sulfate; ARRY-470 sulfate

    Trk Receptor Apoptosis Cancer
    Larotrectinib sulfate (LOXO-101 sulfate; ARRY-470 sulfate) is an ATP-competitive oral, selective inhibitor of the tropomyosin-related kinase (TRK) family receptors, with low nanomolar 50% inhibitory concentrations against all three isoforms (TRKA, B, and C).
  • HY-109014
    Tenofovir exalidex

    CMX-157

    HIV HBV Nucleoside Antimetabolite/Analog Infection
    Tenofovir exalidex (CMX157) is a lipid conjugate of the acyclic nucleotide analog Tenofovir with activity against both wild-type and antiretroviral drug-resistant HIV strains, including multidrug nucleoside/nucleotide analog-resistant viruses. Tenofovir exalidex is active against all major subtypes of HIV-1 and HIV-2 in fresh human PBMCs and against all HIV-1 strains evaluated in monocyte-derived macrophages, with EC50s ranging between 0.2 and 7.2 nM. CMX157 is orally available and has no apparent toxicity. Tenofovir exalidex also shows antiviral activity against HBV.
  • HY-116055
    (2R)-Glycerol-O-β-D-galactopyranoside

    3-O-β-D-Galactopyranosyl-sn-glycerol

    Others Others
    (2R)-Glycerol-O-β-D-galactopyranoside (3-O-β-D-Galactopyranosyl-sn-glycerol) is a good substrate for all three components of the lac operon, i.e. β-galactosidase, the lactose transporter and thiogalactoside transacetylase.
  • HY-115766
    Anabaseine

    nAChR Neurological Disease
    Anabaseine is a non-selective nicotinic agonist. Anabaseine stimulates all AChRs, preferentially stimulates skeletal muscle and brain α7 subtypes. Anabaseine is also a weak partial agonist at α4β2 nAChRs.
  • HY-128602
    c-Kit-IN-2

    c-Kit Cancer
    c-Kit-IN-2 is a c-KIT inhibitor with an IC50 of 82 nM, shows superior antiproliferative activities against all the three GIST cell lines, GIST882, GIST430, and GIST48, with GI50s of 3, 1, and 2 nM, respectively.
  • HY-N1372
    (R)-Fangchinoline

    Thalrugosine; Thaligine

    Bacterial Antibiotic Cancer Infection Inflammation/Immunology Cardiovascular Disease
    (R)-Fangchinoline (Thalrugosine), a alkaloids from Stephania tetrandra,exhibits antimicrobial and hypotensive activity. The roots and stems of several plants from genus Stephania are all used as traditional Chinese medicine and have been used for treatment of fever, diarrhea, dyspepsia and urinary disease.
  • HY-14608S8
    L-Glutamic acid-d3

    Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid-d3 is the deuterium labeled L-Glutamic acid. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
  • HY-111791
    ACY-1083

    HDAC Cancer
    ACY-1083 is a selective and brain-penetrating HDAC6 inhibitor with an IC50 of 3 nM and is 260-fold more selective for HDAC6 than all other classes of HDAC isoforms. ACY-1083 effectively reverses chemotherapy-induced peripheral neuropathy.
  • HY-131940
    3-O-Methyl-N-acetyl-D-glucosamine

    3-O-Methyl-GlcNAc

    Others Metabolic Disease
    3-O-Methyl-N-acetyl-D-glucosamine is a potent inhibitor of N-acetylglucosamine kinase. 3-O-Methyl-N-acetyl-D-glucosamine potently inhibits glucose phosphorylation by N-acetylglucosamine kinase whereas glucokinase is not at all affected by this hexosamine.
  • HY-14608S7
    L-Glutamic acid-d5

    Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid-d5 is the deuterium labeled L-Glutamic acid. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
  • HY-136688
    MI-389

    PROTACs Cancer
    MI-389 is a PROTAC translation termination factor GSPT1 degrader. MI-389 disrupts a target that is a shared dependency in different AML and ALL cell lines, and that MI-389 action is dependent on the CRL4 CRBN E3 ligase.
  • HY-12949
    ML204

    TRP Channel Neurological Disease
    ML204 is a potent, selective TRPC4/TRPC5 channel inhibitor, with at least 19-fold selectivity against TRPC6 and no appreciable effect on all other TRP channels, nor on voltage-gated sodium, potassium, or Ca 2+ channels.
  • HY-11012
    TDZD-8

    GSK-3β Inhibitor I; NP 01139

    GSK-3 Cancer
    TDZD-8 is an inhibitor of GSK-3β, with an IC50 of 2 μM; TDZD-8 shows less potent activities against Cdk-1/cyclin B, CK-II, PKA, and PKC, with all IC50s of >100 μM.
  • HY-B0216S1
    Ethynyl Estradiol-d7

    17α-Ethynylestradiol-d7; Ethynylestradiol-d7

    Estrogen Receptor/ERR Endogenous Metabolite Endocrinology Cancer
    Ethynyl Estradiol-d7 (17α-Ethynylestradiol-d7) is the deuterium labeled Ethynyl Estradiol. Ethynyl Estradiol (17α-Ethynylestradiol;Ethynylestradiol) is an orally bio-active estrogen used in almost all modern formulations of combined oral contraceptive pills.
  • HY-141716
    SW2_110A

    Histone Methyltransferase Cancer
    SW2_110A is a selective chromobox 8 chromodomain (CBX8 ChD) inhibitor with a Kd of 800 nM. SW2_110A shows minimal 5-fold selectivity for CBX8 ChD over all other CBX paralogs in vitro.
  • HY-W004260S3
    Arachidic acid-13C

    Icosanoic acid-13C

    Endogenous Metabolite Cancer
    Arachidic acid-13C is the 13C labeled Arachidic acid. Arachidonic acid (Icosanoic acid), a long-chain fatty acid, is present in all mammalian cells, typically esterified to membrane phospholipids, and is one of the most abundant polyunsaturated fatty acids present in human tissue.
  • HY-B0216S
    Ethynyl Estradiol-d4

    17α-Ethynylestradiol-d4; Ethynylestradiol-d4

    Estrogen Receptor/ERR Endogenous Metabolite Endocrinology Cancer
    Ethynyl Estradiol-d4 (17α-Ethynylestradiol-d4) is the deuterium labeled Ethynyl Estradiol. Ethynyl Estradiol (17α-Ethynylestradiol;Ethynylestradiol) is an orally bio-active estrogen used in almost all modern formulations of combined oral contraceptive pills.
  • HY-P1783
    M2e, human

    Influenza Virus Infection
    M2e, human, consisting of the 23 extracellular residues of M2 (the third integral membrane protein of influenza A), has been remarkably conserved in all human influenza A, which is a valid and versatile vaccine candidate to protect against any strain of human influenza A.
  • HY-141438
    SIM1

    PROTACs Epigenetic Reader Domain Cancer
    SIM1 is a potent von Hippel-Lindau (VHL)-based trivalent PROTAC capable of degradation for all BET family members, with preference for BRD2 degradation (IC50=1.1 nM; Kd=186 nM). SIM1 shows sustained anti-cancer activity.
  • HY-B0228S6
    Adenosine-d2

    Adenine riboside-d2; D-Adenosine-d2

    Nucleoside Antimetabolite/Analog Endogenous Metabolite Autophagy Apoptosis Cancer Metabolic Disease
    Adenosine-d2 is the deuterium labeled Adenosine. Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular physio
  • HY-12949A
    ML204 hydrochloride

    TRP Channel Neurological Disease
    ML204 hydrochloride is a novel, potent, selective TRPC4/TRPC5 channel inhibitor, with at least 19-fold selectivity against TRPC6 and no appreciable effect on all other TRP channels, nor on voltage-gated sodium, potassium, or Ca 2+ channels.
  • HY-B0228S8
    Adenosine-d1-2

    Adenine riboside-d1-2; D-Adenosine-d1-2

    Nucleoside Antimetabolite/Analog Endogenous Metabolite Autophagy Apoptosis Cancer Metabolic Disease
    Adenosine-d1-2 is the deuterium labeled Adenosine. Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular phys
  • HY-W004260S
    Arachidic acid-d2

    Icosanoic acid-d2

    Endogenous Metabolite Others
    Arachidic acid-d2 (Icosanoic acid-d2) is the deuterium labeled Arachidic acid. Arachidonic acid (Icosanoic acid), a long-chain fatty acid, is present in all mammalian cells, typically esterified to membrane phospholipids, and is one of the most abundant polyunsaturated fatty acids present in human tissue.
  • HY-B0228S7
    Adenosine-d1-1

    Adenine riboside-d1-1; D-Adenosine-d1-1

    Nucleoside Antimetabolite/Analog Endogenous Metabolite Autophagy Apoptosis Cancer Metabolic Disease
    Adenosine-d1-1 is the deuterium labeled Adenosine. Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular phys
  • HY-14608S
    L-Glutamic acid-13C

    Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid-13C is the 13C-labeled L-Glutamic acid. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
  • HY-134978A
    (+)SHIN2

    Others Cancer
    (+)SHIN2 is a serine hydroxymethyltransferase (SHMT) inhibitor, whose target can be traced with 13C-serine. (+)SHIN2 increases survival in NOTCH1-driven mouse primary acute lymphoblastic leukemia (T-ALL) in vivo with a synergistic effect with Methotrexate (HY-14519).
  • HY-147958
    Antibacterial agent 113

    Bacterial Infection
    Antibacterial agent 113 (compound 3) is a potent antibacterial agent. Antibacterial agent 113 shows antibacterial activity against P.aeruginosa, S.mutans, B.subtilis, E.coli, E.faecalis, S.typhimuriumand, and S.aureus microorganisms, with MIC values all of 156.25 μM.
  • HY-P1212
    Cortistatin 14, human, rat

    CST-14, human, rat

    Somatostatin Receptor Neurological Disease
    Cortistatin 14, human, rat (CST-14, human, rat), a neuropeptide with neuronal depressant and sleep modulating properties, can bind to all five cloned somatostatin receptors (SSTRs) and ghrelin receptor to exert its biological activities and co-exists with GABA within the cortex and hippocampus.
  • HY-W004260S2
    Arachidic acid-d3

    Icosanoic acid-d3

    Endogenous Metabolite Others
    Arachidic acid-d3 (Icosanoic acid-d3) is the deuterium labeled Arachidic acid. Arachidonic acid (Icosanoic acid), a long-chain fatty acid, is present in all mammalian cells, typically esterified to membrane phospholipids, and is one of the most abundant polyunsaturated fatty acids present in human tissue.
  • HY-W004260S1
    Arachidic acid-d39

    Icosanoic acid-d39

    Endogenous Metabolite Others
    Arachidic acid-d39 (Icosanoic acid-d39) is the deuterium labeled Arachidic acid. Arachidonic acid (Icosanoic acid), a long-chain fatty acid, is present in all mammalian cells, typically esterified to membrane phospholipids, and is one of the most abundant polyunsaturated fatty acids present in human tissue.
  • HY-120508
    Pivanex

    AN-9; Pivalyloxymethyl butyrate

    HDAC Bcr-Abl Apoptosis Cancer Inflammation/Immunology
    Pivanex (AN-9), a derivative of Butyric acid, is an orally active HDAC inhibitor. Pivanex down-regulates bcr-abl protein and enhances apoptosis. Pivanex has antimetastic and antiangiogenic properties.
  • HY-120548
    KBU2046

    HSP Cancer
    KBU2046 is an oral, highly selective inhibitor of cell motility and cell invasion in vitro. KBU2046 binds chaperone heterocomplexes, selectively alters binding of client proteins that regulate motility, and lacks all of the hallmarks of classical HSP90 inhibitors. KBU2046 inhibits cancer metastasis and prolongs life.
  • HY-115475
    SW-100

    HDAC Neurological Disease
    SW-100, a selective histone deacetylase 6 (HDAC6) inhibitor with an IC50 of 2.3 nM, shows at least 1000-fold selectivity for HDAC6 relative to all other HDAC isozymes. SW-100 displays a significantly improved ability to cross the blood-brain-barrier.
  • HY-14608S1
    L-Glutamic acid-1-13C

    Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid-1-13C is the 13C-labeled L-Glutamic acid. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
  • HY-12824
    RNPA1000

    Antibiotic Bacterial Infection
    RNPA1000, an antibiotic, is a potent RnpA inhibitor and inhibits RnpA-mediated cellular RNA degradation. RNPA1000 inhibits tRNA maturation with an IC50 of 175 μM. RNPA1000 displays broad-spectrum antimicrobial activities and inhibits staphylococcal and all Gram-positive bacterial pathogens activity.
  • HY-14608S6
    L-Glutamic acid-5-13C

    Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid-5-13C is the 13C-labeled L-Glutamic acid. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
  • HY-P9951
    Ranibizumab

    RG-6321

    VEGFR Cardiovascular Disease
    Ranibizumab (RG-6321) is a humanized anti-VEGF monoclonal antibody fragment and can recognize all VEGF-A isoforms (VEGF110, VEGF121, and VEGF165). Ranibizumab slows vision loss in vivo and is used for wet age-related macular degeneration (AMD) research.
  • HY-B0228S5
    Adenosine-13C

    Adenine riboside-13C; D-Adenosine-13C

    Nucleoside Antimetabolite/Analog Endogenous Metabolite Autophagy Apoptosis Cancer Metabolic Disease
    Adenosine-13C is the 13C labeled Adenosine. Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular physiology,
  • HY-112547
    CRT5

    CRT0066051

    PKD Others
    CRT5, a pyrazine benzamide, is a potent and selective inhibitor for all three isoforms of PKD in endothelial cells treated with VEGF (IC50s = 1, 2, and 1.5 nM for PKD1, PKD2, and PKD3, respectively). CRT5 decreases VEGF-induced endothelial migration, proliferation and tubulogenesis.
  • HY-144297
    HDAC1-IN-3

    HDAC Parasite Infection
    HDAC1-IN-3 is a potent Pf HDAC1 inhibitor. HDAC1-IN-3 shows antimalarial activity in wild-type and multidrug-resistant parasite strains. HDAC1-IN-3 shows a significant in vivo killing effect against all life cycles of parasites.
  • HY-12866S
    Larotrectinib-d7

    LOXO-101-d7; ARRY-470-d7

    Trk Receptor Apoptosis Cancer
    Larotrectinib-d7 (LOXO-101-d7) is the deuterium labeled Larotrectinib. Larotrectinib (LOXO-101) is an ATP-competitive oral, selective inhibitor of the tropomyosin-related kinase (TRK) family receptors, with low nanomolar 50% inhibitory concentrations against all three isoforms (TRKA, B, and C).
  • HY-14608S2
    L-Glutamic acid-15N

    Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid-15N is the 15N-labeled L-Glutamic acid. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
  • HY-14608S5
    L-Glutamic acid-13C5

    Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid-13C5 is the 13C-labeled L-Glutamic acid. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
  • HY-B0228S2
    Adenosine-2′-13C

    Adenine riboside-2′-13C; D-Adenosine-2′-13C

    Nucleoside Antimetabolite/Analog Endogenous Metabolite Autophagy Apoptosis Cancer Metabolic Disease
    Adenosine-2′-13C is the 13C labeled Adenosine. Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular physiolo
  • HY-N8356A
    9-cis-Vitamin A palmitate

    9-cis-Retinyl palmitate

    Endogenous Metabolite Others
    9-cis-Vitamin A palmitate (9-cis-Retinyl palmitate) is a 9-cis isomer formed by vitamin A palmitate in corn flakes. 9-cis-Vitamin A palmitate has a biological activity of 26% of all-trans-vitamin A palmitate, the most biologically ac-tive form of vitamin A.
  • HY-N8356
    13-cis-Vitamin A palmitate

    13-cis-Retinyl palmitate

    Endogenous Metabolite Others
    13-cis-Vitamin A palmitate (13-cis-Retinyl palmitate) is a 13-cis isomer formed by vitamin A palmitate in corn flakes. 13-cis-Vitamin A palmitate has a biological activity of 75% of all-trans-vitamin A palmitate, the most biologically ac-tive form of vitamin A.
  • HY-P1783A
    M2e, human TFA

    Influenza Virus Infection
    M2e, human TFA, consisting of the 23 extracellular residues of M2 (the third integral membrane protein of influenza A), has been remarkably conserved in all human influenza A. M2e, human TFA is a valid and versatile vaccine candidate to protect against any strain of human influenza A.
  • HY-B0228S3
    Adenosine-3′-13C

    Adenine riboside-3′-13C; D-Adenosine-3′-13C

    Nucleoside Antimetabolite/Analog Endogenous Metabolite Autophagy Apoptosis Cancer Metabolic Disease
    Adenosine-3′-13C is the 13C labeled Adenosine. Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular physiolo
  • HY-B0228S4
    Adenosine-1′-13C

    Adenine riboside-1′-13C; D-Adenosine-1′-13C

    Nucleoside Antimetabolite/Analog Endogenous Metabolite Autophagy Apoptosis Cancer Metabolic Disease
    Adenosine-1′-13C is the 13C labeled Adenosine. Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular physiolo
  • HY-118743
    KMN-80

    Prostaglandin Receptor Metabolic Disease
    KMN-80, a derivative of PGE1 (HY-B0131), is a selective and potent agonist of EP4 receptor with an IC50 and a Ki of 3 nM and 2.35 nM, respectively. KMN-80 is against EP3 receptor with an IC50 of 1.4 μM and >10 μM for all other prostanoid receptors.
  • HY-N2181
    Acetylshikonin

    Cytochrome P450 Cholinesterase (ChE) Apoptosis Cancer Inflammation/Immunology
    Acetylshikonin, derived from the root of Lithospermum erythrorhizon, has anti-cancer and antiinflammation activity. Acetylshikonin is a non-selective cytochrome P450 inhibitor against all P450s (IC50 values range from 1.4-4.0 μM). Acetylshikonin is an AChE inhibitor and exhibits potent antiapoptosis activity.
  • HY-114672
    MBCQ

    Phosphodiesterase (PDE) Cardiovascular Disease
    MBCQ is a potent and selective cGMP-specific phosphodiesterase (PDE V; PDE5) inhibitor with an IC50 of 19 nM. MBCQ lacks inhibitory activity toward other PDE isozymes (all IC50s>100 μM). MBCQ dilates coronary arteries via specific inhibition of cGMP-PDE.
  • HY-N7539
    Cognac oil

    Others Metabolic Disease
    Cognac oil, mainly found in wine lees, has unique fatty acid profiles, including Palmitic acid (59.26%), Linoleic acid (11.92%), Myristic acid (8.97%), Oleic acid (8.3%) and other fatty acids. Cognac oil leads to a general increase in the permeation of R6G (Rhodamine 6G) across all the membranes.
  • HY-P9951A
    Ranibizumab (anti-VEGF)

    RG-6321 (anti-VEGF)

    VEGFR Cardiovascular Disease
    Ranibizumab (RG-6321) (anti-VEGF) is a humanized anti-VEGF monoclonal antibody fragment and can recognize all VEGF-A isoforms (VEGF110, VEGF121, and VEGF165). Ranibizumab (anti-VEGF) slows vision loss in vivo and is used for wet age-related macular degeneration (AMD) research.
  • HY-15985A
    CTX-0294885 hydrochloride

    Others Cancer Metabolic Disease Inflammation/Immunology
    CTX-0294885 hydrochloride is a broad spectrum kinase inhibitor that can capture 235 kinases from MDA-MB-231 cells, and can capture all members of the AKT family. CTX-0294885 hydrochloride is a powerful reagent for analysis of kinome signaling networks that can be used for the research of diseases like inflammation, diabetes, and cancer.
  • HY-P1852
    TIP 39, Tuberoinfundibular Neuropeptide

    Adenylate Cyclase Neurological Disease
    TIP 39, Tuberoinfundibular Neuropeptide is a neuropeptide and parathyroid hormone 2 receptor (PTH2R) agonist. TIP 39 is highly conserved among species. TIP39 from all species activates adenylyl cyclase and elevates intracellular calcium levels through parathyroid hormone 2 receptor (PTH2R).
  • HY-P2315
    Human β-defensin-1

    HβD-1

    Antibiotic Bacterial Infection
    Human β-defensin-1 (HβD-1) is a cysteine-rich cationic skin-antimicrobial peptide (SAP) produced by all epithelial surfaces, but also by circulatory cells and cells of the reproductive tract. Human β-defensin-1 has antimicrobial activities against a broad-sperm bacteria.
  • HY-15985
    CTX-0294885

    Akt Cancer Metabolic Disease Inflammation/Immunology
    CTX-0294885 is a broad spectrum kinase inhibitor that can capture 235 kinases from MDA-MB-231 cells, and can capture all members of the AKT family. CTX-0294885 is a powerful reagent for analysis of kinome signaling networks that can be used for the research of diseases like inflammation, diabetes, and cancer.
  • HY-14608S9
    L-Glutamic acid-15N,d5

    Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid-15N,d5 is the deuterium and 15N-labeled L-Glutamic acid. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
  • HY-B0228
    Adenosine

    Adenine riboside; D-Adenosine

    Nucleoside Antimetabolite/Analog Autophagy Apoptosis Endogenous Metabolite Cancer Metabolic Disease
    Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular physiology, including neuronal activity, vascular function, platelet aggregation, and blood cell regulation.
  • HY-100765
    BI-0252

    MDM-2/p53 E1/E2/E3 Enzyme Cancer
    BI-0252 is an orally active, selective MDM2-p53 inhibitor with an IC50 of 4 nM. BI-0252 can induce tumor regressions in all animals of a mouse SJSA-1 xenograft, with concomitant induction of the tumor protein p53 (TP53) target genes and markers of apoptosis.
  • HY-126195
    Fluoflavine

    ML-090

    NADPH Oxidase Cardiovascular Disease
    Fluoflavine (ML-090) is a selective NOX1 inhibitor with an IC50 of 90 nM. Fluoflavine has >100 selectivity for NOX1 over NOX2, NOX3, NOX4 (all IC50>10 μM). ML-090 has an IC50 of 360 nM in HEK293 cells.
  • HY-14608S3
    L-Glutamic acid-13C5,15N

    Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid-13C5,15N is the 13C- and 15N-labeled L-Glutamic acid. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
  • HY-15257
    Mavoglurant

    AFQ056

    mGluR Neurological Disease
    Mavoglurant (AFQ056) is a potent, selective, non-competitive and orally active mGluR5 antagonist, with an IC50 of 30 nM. Mavoglurant shows a >300 fold selectivity for the mGluR5 over all targets (238) tested. Mavoglurant can be used for the research of Fragile X syndrome (FXS), and L-dopa induced dyskinesias in Parkinson's disease.
  • HY-147149
    BPN-15477

    Others Neurological Disease
    BPN-15477 is a potent SMC (splicing modulator compound) that restores correct splicing of ELP1 (Elongator complex protein 1) exon 20. BPN-15477 corrects splicing of the ELP1 transcript, significantly increases the level of functional protein in vivo in all tissues, including brain. BPN-15477 can be used for frontotemporal dementia research.
  • HY-111056
    UK122

    Ser/Thr Protease Cancer
    UK122 is a potent and selective urokinase-type plasminogen activator (uPA) inhibitor with an IC50 of 0.2 μM. UK122 shows no or little inhibition of tissue-type PA (tPA), plasmin, thrombin, and trypsin (all IC50>100 μM). UK122, 4-oxazolidinone analogue, is an anticancer agent and inhibits cancer cell migration and invasion.
  • HY-114286
    PXS-5153A

    Monoamine Oxidase Inflammation/Immunology
    PXS-5153A is a potent, selective, orally active and fast-acting lysyl oxidase like 2/3 enzymatic (LOXL2/LOXL3) inhibitor, with an IC50 of <40 nM for LOXL2 across all mammalian species and an IC50 of 63 nM for human LOXL3. PXS-5153A could reduce crosslinks and ameliorates fibrosis.
  • HY-13271
    Tubastatin A Hydrochloride

    Tubastatin A HCl; TSA HCl

    HDAC Autophagy Apoptosis Cancer
    Tubastatin A Hydrochloride (Tubastatin A HCl) is a potent and selective HDAC6 inhibitor with IC50 of 15 nM in a cell-free assay, and is selective (1000-fold more) against all other isozymes except HDAC8 (57-fold more). Tubastatin A Hydrochloride also inhibits HDAC10 and metallo-β-lactamase domain-containing protein 2 (MBLAC2).
  • HY-B1030
    Lanatoside C

    Autophagy Enterovirus Cardiovascular Disease Cancer
    Lanatoside C is a cardiac glycoside, can be used in the treatment of congestive heart failure and cardiac arrhythmia.Lanatoside C has an IC50 of 0.19 μM for dengue virus infection in HuH-7 cells. Lanatoside C can effectively inhibit all four serotypes of dengue virus, flavivirus Kunjin, alphavirus Chikungunya, Sindbis virus and the human enterovirus 71.
  • HY-13271A
    Tubastatin A

    HDAC Autophagy Apoptosis Cancer
    Tubastatin A is a potent and selective HDAC6 inhibitor with an IC50 of 15 nM in a cell-free assay, and is selective (1000-fold more) against all other isozymes except HDAC8 (57-fold more). Tubastatin A also inhibits HDAC10 and metallo-β-lactamase domain-containing protein 2 (MBLAC2).
  • HY-138061
    DENV-IN-2

    DNA/RNA Synthesis Infection
    DENV-IN-2 is a potent dengue viral replication inhibitor extracted from patent WO2018215315A1, compound 6AB, has an EC50 of 0.016 nM. DENV-IN-2 shows high potent activity against all four serotypes of the Dengue virus with EC50s ranging from 0.013 to 0.029 nM.
  • HY-137892
    GSK620

    Epigenetic Reader Domain Inflammation/Immunology
    GSK620 is a potent and orally active pan-BD2 inhibitor with excellent broad selectivity, developability and in vivo oral pharmacokinetics. GSK620 is highly selective for the BET-BD2 family of proteins, with >200-fold selectivity over all other bromodomains. GSK620 shows an anti-inflammatory phenotype in human whole blood.
  • HY-100233
    IQ-1S free acid

    JNK Cancer Inflammation/Immunology
    IQ-1S free acid is a prospective inhibitor of NF-κB/activating protein 1 (AP-1) activity with an IC50 of 2.3±0.41 μM. IQ-1S free acid has binding affinity (Kd values) in the nanomolar range for all three JNKs with Kds of 100 nM, 240 nM, and 360 nM for JNK3, JNK1, and JNK2, respectively.
  • HY-110135A
    NBI-31772 hydrate

    IGF-1R Neurological Disease
    NBI-31772 hydrate is a potent inhibitor of interaction between insulin-like growth factor (IGF) and IGF-binding proteins (IGFBPs). NBI-31772 hydrate is also a nonpeptide ligand that releases bioactive IGF-I from the IGF-I/IGFBP-3 complex (Kis=1-24 nM for all six human subtypes). Anxiolytic and antidepressant-like effects.
  • HY-14608S4
    L-Glutamic acid-13C5,15N,d5

    Endogenous Metabolite iGluR Ferroptosis Apoptosis Neurological Disease
    L-Glutamic acid-13C5,15N,d5 is the deuterium, 13C-, and 15-labeled L-Glutamic acid. L-Glutamic acid acts as an excitatory transmitter and an agonist at all subtypes of glutamate receptors (metabotropic, kainate, NMDA, and AMPA). L-Glutamic acid shows a direct activating effect on the release of DA from dopaminergic terminals.
  • HY-114286A
    PXS-5153A monohydrochloride

    Monoamine Oxidase Inflammation/Immunology
    PXS-5153A monohydrochloride is a potent, selective, orally active and fast-acting lysyl oxidase like 2/3 enzymatic (LOXL2/LOXL3) inhibitor, with an IC50 of <40 nM for LOXL2 across all mammalian species and an IC50 of 63 nM for human LOXL3. PXS-5153A monohydrochloride could reduce crosslinks and ameliorates fibrosis.
  • HY-N7434
    N-Nitrosodiethylamine

    Diethylnitrosamine

    DNA/RNA Synthesis Cancer
    N-Nitrosodiethylamine (Diethylnitrosamine) is a potent hepatocarcinogenic dialkylnitrosoamine. N-Nitrosodiethylamine is mainly present in tobacco smoke, water, cheddar cheese, cured, fried meals and many alcoholic beverages. N-Nitrosodiethylamine is responsible for the changes in the nuclear enzymes associated with DNA repair/replication. N-Nitrosodiethylamine results in various tumors in all animal species. The main target organs are the nasal cavity, trachea, lung, esophagus and liver.
  • HY-147786
    TGFβRI-IN-5

    TGF-β Receptor Cancer
    TGFβRI-IN-5 (Compound 4b) is a potent inhibitor of TGFβRI with an IC50 of 0.08 μM. TGFβRI-IN-5 displays amazing anticancer activity 5–7 times that of reference drug against all the tested cell lines. TGFβRI-IN-5 enhances apoptosis and arrested G2/M phase of cell cycle.
  • HY-146696
    mEH-IN-1

    Epoxide Hydrolase Cancer Neurological Disease Cardiovascular Disease
    mEH-IN-1 (Compound 62) is a potent microsomal epoxide hydrolase (mEH) inhibitor with the IC50 of 2.2 nM. The mEH is a mammalian α/β-fold hydrolase enzyme, expressed in almost all tissues, hydrolyzes a wide range of epoxide containing molecules. The mEH is mainly localized in the endoplasmic reticulum (ER) of eukaryotic cells. mEH-IN-1 can be used for the research of preeclampsia, hypercholanemia and cancer.
  • HY-14174
    MRK-560

    γ-secretase Cancer Neurological Disease
    MRK-560 is an orally active, brain barrier-penetrating γ-Secretase inhibitor, can potently reduces Aβ peptide in rat brain and cerebrospinal fluid. MRK-560 also decreases mutant NOTCH1 processing by selectively inhibiting PSEN1. MRK-560 can be used in studies of Alzheimer's disease and T-cell acute lymphoblastic leukaemia (T-ALL).
  • HY-118858
    UCPH-102

    Others Cancer Neurological Disease
    UCPH-102 is a highly selective EAAT1 inhibitor with an IC50 of 0.43 µM. UCPH-102 exhibits a specific anti-proliferative effect on T-ALL cells. UCPH-102 also shows good blood-brain permeability, which can be used in studies of amyotrophic lateral sclerosis, Alzheimer’s disease, chronic pain and obsessive compulsive disorder.
  • HY-P3618
    Cortistatin 29

    Somatostatin Receptor Neurological Disease
    Cortistatin 29 is a neuropeptide. Cortistatin 29 alleviates neuropathic pain. Cortistatin 29 binds with high affinity all somatostatin (SS) receptor subtypes and shows IC50 values of 2.8, 7.1, 0.2, 3.0, 13.7 nM for SSTR1, SSTR2, SSTR3, SSTR4, SSTR5, respectively. Cortistatin 29 shows anti-fibrotic effects.
  • HY-A0035
    Faropenem

    Antibiotic Bacterial Infection
    Faropenem is a potent and orally active beta-lactam antibiotic. Faropenem demonstrates broad-spectrum in vitro antimicrobial activity against many gram-positive and -negative aerobes and anaerobes. Faropenem is resistant to hydrolysis by nearly all beta-lactamases, including extended-spectrum beta-lactamases and AmpC beta-lactamases. Faropenem is developed as an oral prodrug, faropenem medoxomil, for the research of respiratory tract infections.
  • HY-111817
    ACT-451840

    Parasite Infection
    ACT-451840 is an orally active, potent and low-toxicity compound, showing activity against sensitive and resistant plasmodium falciparum strains. ACT-451840 targets all asexual blood stages of the parasite, has a rapid onset of action. ACT-451840 behaves in a way similar to artemisinin derivatives, with very rapid onset of action and elimination of parasite. ACT-451840 can be used for the research of malarial.
  • HY-B0228S
    Adenosine-d1

    Adenine riboside-d1; D-Adenosine-d1

    Nucleoside Antimetabolite/Analog Autophagy Apoptosis Endogenous Metabolite Cancer Metabolic Disease
    Adenosine-d1 (Adenine riboside-d1) is the deuterium labeled Adenosine. Adenosine (Adenine riboside), a ubiquitous endogenous autacoid, acts through the enrollment of four G protein-coupled receptors: A1, A2A, A2B, and A3. Adenosine affects almost all aspects of cellular physiology, including neuronal activity, vascular function, platelet aggregation, and blood cell regulation.
  • HY-N6022
    Byakangelicin

    Others Metabolic Disease
    Byakangelicin, one of the active compounds found in the roots of Angelica gigas, can serve as a modulator to improve brain accumulation of diverse active compounds (Umb, Cur, and Dox) and enhance therapeutic effects. Byakangelicin is likely to increase the expression of all PXR target genes (such as MDR1) and induce a wide range of drug-drug interactions. Byakangelicin can inhibit the effects of sex hormones, it may increase the catabolism of endogenous hormones.
  • HY-120323
    DRI-C21045

    TNF Receptor Inflammation/Immunology
    DRI-C21045 (compound 10) is a potent and selective inhibitor of the CD40-CD40L costimulatory protein-protein interaction (PPI) with an IC50 of 0.17 µM. DRI-C21045 shows concentration-dependent inhibition of the activation of NF-κB and B cell proliferation all induced by CD40L with IC50s of 17.1 µM and 4.5 µM, respectively.
  • HY-112724
    Ivarmacitinib

    SHR0302

    JAK Apoptosis Cancer Inflammation/Immunology
    Ivarmacitinib (SHR0302) is a potent and orally active all members of the JAK family inhibitor, particularly JAK1. The selectivity of Ivarmacitinib for JAK1 is >10-fold for JAK2, 77-fold for JAK3, 420-fold for Tyk2. Ivarmacitinib inhibits JAK1-STAT3 phosphorylation and induces the apoptosis of hepatic stellate cells. Ivarmacitinib has anti-proliferative and anti-inflammatory effects.
  • HY-108584
    Flindokalner

    BMS-204352

    Potassium Channel Neurological Disease
    Flindokalner (BMS-204352) is a potassium channel modulator. Flindokalner is a positive modulator of all neuronal Kv7 channel subtypes expressed in HEK293 cells. Flindokalner is also a large conductance calcium-activated K channel (BKca) positive modulator. Flindokalner shows a negative modulatory activity at Kv7.1 channels (Ki=3.7 μM), and acts as a negative modulator of GABAA receptors. Flindokalner shows anxiolytic efficacy in vivo.
  • HY-112831
    Osoresnontrine

    BI-409306

    Phosphodiesterase (PDE) Neurological Disease
    Osoresnontrine (BI-409306) is a potent and selective PDE9A inhibitor, with an IC50 of 52 nM, and shows weak activity against other PDEs, such as PDE1A (IC50, 1.4 µM), PDE1C (IC50, 1.0 µM), PDE2A, PDE3A, PDE4B, PDE5A, PDE6AB, PDE7A, and PDE10A (IC50 all > 10 μM); Osoresnontrine can be used in the research of memory enhancement in CNS disorders.
  • HY-12076
    BMS 777607

    BMS 817378

    c-Met/HGFR TAM Receptor Cancer
    BMS 777607 (BMS 817378) is a Met-related inhibitor for c-Met, Axl, Ron and Tyro3 with IC50s of 3.9 nM, 1.1 nM, 1.8 nM and 4.3 nM, respectively, and 40-fold more selective for Met-related targets than Lck, VEGFR-2, and TrkA/B, with more than 500-fold greater selectivity versus all other receptor and non receptor kinases.
  • HY-107506
    Ro 67-4853

    mGluR Neurological Disease
    Ro 67-4853 is a positive allosteric modulator (PAM) of mGluR1 (pEC50=7.16 for rmGlu1a receptor). Ro67-4853 exhibits activity at all group I mGlu receptors including hmGlu1, rmGlu1, and rmGlu5. Ro 67-4853 enhances the potency of L-Glu by interacting with the transmembrane domain (TMD) of the receptor. Ro 67-4853 potentiates sensory synaptic responses to repetitive vibrissa stimulation.
  • HY-19760
    I-BET282

    Epigenetic Reader Domain Inflammation/Immunology
    I-BET282 is a pan-inhibitor of all eight BET bromodomains, and selectivity over other representative bromodomain-containing proteins. I-BET282 shows pIC50s ranging 6.4-7.7 for BRD2 (BD1/BD2), BRD2 (BD1/BD), BRD3 (BD1/BD), and BRD4 (BD1/BD).
  • HY-14572
    PR-104A

    SN 27858

    DNA Alkylator/Crosslinker Drug Metabolite Cancer
    PR-104A (SN 27858) is the alcohol metabolite of phosphate prodrug PR-104. PR-104A is a hypoxia-selective DNA cross-linking agent/DNA-damaging agent and cytotoxin. Antitumor Activity. PR-104A is metabolized under hypoxia by the 1-electron NADPH:cytochrome P450 oxidoreductase. PR-104A can be used for the research of relapsed/refractory T-lineage acute lymphoblastic leukemia (T-ALL).
  • HY-111329
    JGB1741

    ILS-JGB-1741

    Sirtuin Apoptosis Cancer
    JGB1741 (ILS-JGB-1741) is a potent and specific SIRT1 activity inhibitor with an IC50 of ∼15 μM. JGB1741 is a weak SIRT2 and SIRT3 inhibitor with an all IC50>100 μM. JGB1741 increases the acetylated p53 levels leading to p53-mediated apoptosis with modulation of Bax/Bcl2 ratio, cytochrome c release and PARP cleavage. JGB1741 has the potential for breast cancer research.
  • HY-N8356AS
    9-cis-Vitamin A palmitate-d5

    9-cis-Retinyl palmitate-d5

    Endogenous Metabolite Others
    9-cis-Vitamin A palmitate-d5 (9-cis-Retinyl palmitate-d5) is the deuterium labeled 9-cis-Vitamin A palmitate. 9-cis-Vitamin A palmitate (9-cis-Retinyl palmitate) is a 9-cis isomer formed by vitamin A palmitate in corn flakes. 9-cis-Vitamin A palmitate has a biological activity of 26% of all-trans-vitamin A palmitate, the most biologically ac-tive form of vitamin A.
  • HY-16936
    JH-II-127

    LRRK2 Neurological Disease
    JH-II-127 is an orally active, highly potent, selective and brain-permeable LRRK2 inhibitor, with IC50s of 6, 2 and 48 nM for wild-type LRRK2 and LRRK2-G2019S and mutant LRRK2-A2016T. JH-II-127 inhibits Ser935 phosphorylation in all tissues of mice, including the brain. JH-II-127 can be used in the study of parkinson's syndrome.
  • HY-19336
    BAZ2-ICR

    Epigenetic Reader Domain Cancer
    BAZ2-ICR is a potent, selective, cell active and orally active BAZ2A/B bromodomains inhibitor with IC50s of 130 nM and 180 nM, and Kds of 109 nM and 170 nM, respectively. BAZ2-ICR shows 10-15-fold selectivity for binding BAZ2A/B over CECR2 and >100-fold selectivity over all other bromodomains. BAZ2-ICR is an epigenetic chemical probe.
  • HY-19760B
    I-BET282E

    Epigenetic Reader Domain Inflammation/Immunology
    I-BET282E is a pan-inhibitor of all eight BET bromodomains, and selectivity over other representative bromodomain-containing proteins. I-BET282E shows pIC50s ranging 6.4-7.7 for BRD2 (BD1/BD2), BRD2 (BD1/BD), BRD3 (BD1/BD), and BRD4 (BD1/BD).
  • HY-144094
    EZH2-IN-9

    Histone Methyltransferase Cancer
    EZH2-IN-9 is a potent inhibitor of EZH2. EZH2 overexpression or mutations in the SET region (Y641F, Y641N, A687V, A677G point mutations) all lead to abnormal elevation of H3K27me3 and promote the growth and development of many types of tumors, such as breast cancer, prostate cancer, leukemia, etc. EZH2-IN-9 has the potential for the research of cancer diseases (extracted from patent WO2021180235A1, compound 17).
  • HY-19995
    GSK137647A

    GSK 137647

    Free Fatty Acid Receptor Metabolic Disease
    GSK137647A (GSK 137647) is a potent, selective free fatty acid receptor 4 (FFA4) agonist with pEC50 values of 6.3, 6.2, and 6.1 for human, mouse and rat FFA4, and pEC50 values < 4.5 for all three species for FFA1, FFA2, and FFA3, respectively. GSK137647A has anti-inflammatory activity. GSK137647A induces insulin secretion and inhibits epithelial ion transport, GSK137647A is related to regulation of glucose homeostasis and anti-inflammatory response.
  • HY-143616
    EZH2-IN-7

    Histone Methyltransferase Cancer
    EZH2-IN-7 is a potent inhibitor of EZH2. EZH2 overexpression or mutations in the SET region (Y641F, Y641N, A687V, A677G point mutations) all lead to abnormal elevation of H3K27me3 and promote the growth and development of many types of tumors, such as breast cancer, prostate cancer, leukemia, etc. EZH2-IN-7 has the potential for the research of cancer diseases (extracted from patent WO2021129629A1, compound 259).
  • HY-120878
    CXCR2-IN-2

    CXCR Inflammation/Immunology
    CXCR2-IN-2 is a selective, brain penetrant, and orally bioavailable CXCR2 antagonist (IC50=5.2 nM/1 nM in β-arrestin assay/CXCR2 Tango assay, respectively). CXCR2-IN-2 displays ~730-fold selectivity over CXCR1 and >1900-fold selectivity over all other chemokine receptors. CXCR2-IN-2 inhibits human whole blood Gro-α induced CD11b expression with an IC50 of 0.04 μM.
  • HY-110105
    NS8593 hydrochloride

    Potassium Channel Neurological Disease
    NS8593 hydrochloride is a potent and selective small conductance Ca 2+-activated K + channels (SK channels) inhibitor. NS8593 hydrochloride reversibly inhibits SK3-mediated currents with a Kd value of 77 nM. NS8593 hydrochloride inhibits all the SK1-3 subtypes Ca 2+-dependently (Kds of 0.42, 0.60, and 0.73 μM, respectively, at 0.5 μM Ca 2+), and does not affect the Ca 2+-activated K + channels of intermediate and large conductance (hIK and hBK channels, respectively).
  • HY-19975
    RN-1734

    TRP Channel Neurological Disease
    RN-1734 is selective antagonist of the TRPV4 channel, completely antagonizes 4αPDD-mediated activation of TRPV4 with comparable, low micromolar IC50s for all three species (hTRPV4: 2.3 μM, mTRPV4: 5.9 μM, rTRPV4: 3.2 μM). RN-1734 clearly decreases the production of tumor necrosis factor α (TNF-α) and interleukin 1β (IL-1β) without altering the number of olig2-positive cells.
  • HY-139254
    Indirubin-3′-oxime

    IDR3O; I3O

    CDK GSK-3 JNK Neurological Disease
    Indirubin-3′-oxime (IDR3O), a synthetic derivative of indirubin, is a potent inhibitor of cyclin-dependent kinases (CDKs) and glycogen synthase kinase 3β (GSK3β). Indirubin-3′-oxime directly inhibits the activity of all three isoforms of JNK (JNK1, JNK2, and JNK3), with IC50s of 0.8 μM, 1.4 μM, and 1.0 μM, respectively. Indirubin-3′-oxime can enhance height growth via activation of Wnt/β-catenin signaling in chondrocytes.
  • HY-121744
    PS10

    PDHK Inflammation/Immunology
    PS10 is a novel, potent and ATP-competitive pan-PDK inhibitor, inhibits all PDK isoforms with IC50 of 0.8 μM, 0.76 μM, 2.1 μM and 21.3 μM for PDK2, PDK4, PDK1, and PDK3, respectively. PS10 shows high affinity for PDK2 (Kd= 239 nM) than for Hsp90 (Kd= 47 μM). PS10 improves glucose tolerance, stimulates myocardial carbohydrate oxidation in diet-induced obesity. PS10 has the potential for the investigation of diabetic cardiomyopathy.PDK: pyruvate dehydrogenase kinase
  • HY-151837
    H-L-Phe(4-NH-Poc)-OH hydrochloride

    Others Others
    H-L-Phe(4-NH-Poc)-OH (hydrochloride) is a click chemistry reagent containing an azide group. Used as a modified Phe or Tyr analogue in protein and peptide biosynthesis. Propargyloxycarbonyl, commonly abbreviated as Poc or Pryoc, can either be used as alkyne component for standard Click conjugation or in combination with tetrazine linkers in copper-free Diels-Alder type Click reactions. It also has applications as unusual protecting group for amines, hydroxy functions and as esters. All 3 are stable to neat TFA, but can be cleaved at ambient temperature with Co2(CO)8 in TFA:DCM. Deprotection with other transition metals like palladium have also been reported.
  • HY-19978
    RO-3

    P2X Receptor Neurological Disease
    RO-3 is a potent, CNS-penetrant, and orally active P2X3 and P2X2/3 antagonist with pIC50s of 5.9 and 7.0 for human homomultimeric P2X3 and heteromultimeric P2X2/3 receptors, respectively. RO-3 shows selectivity for P2X3 and P2X2/3 over all other functional homomultimeric P2X receptors (IC50 >10 μM at P2X1,2,4,5,7).
  • HY-10015
    PAP-1

    5-(4-Phenoxybutoxy)psoralen

    Potassium Channel Inflammation/Immunology
    PAP-1 (5-(4-Phenoxybutoxy)psoralen) is a potent, selective, and orally active Kv1.3 blocker (EC50=2 nM). PAP-1 blocks Kv1.3 in a use-dependent manner and acts by preferentially binding to the C-type inactivated state of the channel. PAP-1 exhibits 23-fold selectivity over Kv1.5 (EC50=45 nM), and further displays 33- to 125-fold selectivity over all other Kv1-family channels. PAP-1 does not exhibit cytotoxic or phototoxic effects.
  • HY-108596
    BL-1249

    Potassium Channel Inflammation/Immunology
    BL-1249 is a nonsteroidal anti-inflammatory drug (NSAID) and a potassium channel activator. BL-1249 potently activates K2P2.1 (TREK-1) and K2P10.1 (TREK-2) with EC50 values of 5.5 μM and 8.0 μM, respectively. BL-1249 extracellular application activates all TREK subfamily members but has no effect on other K2P subfamilies. BL-1249 exhibits more selective for the bladder (EC50 of 1.26 μM) than vascular tissue (EC50 of 21.0 μM).
  • HY-15724A
    Vercirnon sodium

    GSK-1605786 sodium; CCX282-B sodium; Traficet-EN sodium

    CCR Inflammation/Immunology Endocrinology
    Vercirnon (GSK1605786A) sodium is an orally bioavailable, selective, and potent antagonist of CCR9. Vercirnon sodium inhibits CCR9-mediated Ca 2+ mobilization and chemotaxis on Molt-4 cells with IC50 values of 5.4 and 3.4 nM, respectively. Vercirnon sodium is selective for CCR9 over CCR1-12 and CX3CR1-7 (IC50s>10 µM for all). Vercirnon sodium is an equipotent inhibitor of CCL25-directed chemotaxis of both splice forms of CCR9 (CCR9A and CCR9B) with IC50 values of 2.8 and 2.6 nM, respectively.
  • HY-15724
    Vercirnon

    GSK-1605786; CCX282-B; Traficet-EN

    CCR Inflammation/Immunology Endocrinology
    Vercirnon (GSK1605786A) is an orally bioavailable, selective, and potent antagonist of CCR9. Vercirnon inhibits CCR9-mediated Ca 2+ mobilization and chemotaxis on Molt-4 cells with IC50 values of 5.4 and 3.4 nM, respectively. Vercirnon is selective for CCR9 over CCR1-12 and CX3CR1-7 (IC50s>10 µM for all). Vercirnon is an equipotent inhibitor of CCL25-directed chemotaxis of both splice forms of CCR9 (CCR9A and CCR9B) with IC50 values of 2.8 and 2.6 nM, respectively.
  • HY-151824
    Boc-L-Phe(4-NH-Poc)-OH

    Others Others
    Boc-L-Phe(4-NH-Poc)-OH is a click chemistry reagent containing an azide group. Used as an orthogonally protected building block in peptide synthesis. Propargyloxycarbonyl, commonly abbreviated as Poc or Pryoc, can either be used as alkyne component for standard Click conjugation or in combination with tetrazine linkers in copper-free Diels-Alder type Click reactions. It also has applications as unusual protecting group for amines, hydroxy functions and as esters. All 3 are stable to neat TFA, but can be cleaved at ambient temperature with Co2(CO)8 in TFA:DCM. Deprotection with other transition metals like palladium have also been reported.
  • HY-131997
    2'MeO6MF

    GABA Receptor Inflammation/Immunology Neurological Disease
    2'MeO6MF is a brain-penetrant positive allosteric modulator at α2β1γ2L and all α1-containing GABAA receptors. 2'MeO6MF also can directly activate α2β2/3 and α2β2/3γ2L GABAA receptors. 2'MeO6MF has anxiolytic and psychomotor stabilizing properties. 2'MeO6MF offers neuroprotection and improved functional recovery and dampens the stroke-induced inflammatory response.