Search Result
Results for "
Dovitinib-<a href=
" in MedChemExpress (MCE) Product Catalog:
9900
Inhibitors & Agonists
114
Biochemical Assay Reagents
49
Isotope-Labeled Compounds
| Cat. No. |
Product Name |
Target |
Research Areas |
Chemical Structure |
-
- HY-139682
-
|
|
PROTACs
|
Cancer
|
|
Dovitinib RIBOTAC is a targeted RNA degrader that cleaves pre-miR-21 with enhanced potency and selectivity.
|
-
-
- HY-139682A
-
|
|
PROTACs
|
Cancer
|
|
Dovitinib RIBOTAC TFA is a targeted RNA degrader that cleaves pre-miR-21 with enhanced potency and selectivity.
|
-
-
- HY-50905
-
|
CHIR-258; TKI258
|
FLT3
c-Kit
FGFR
VEGFR
PDGFR
c-Fms
|
Cancer
|
|
Dovitinib (CHIR-258) is an orally active, potent multi-targeted tyrosine kinase (RTK) inhibitor with IC50s of 1, 2, 36, 8/9, 10/13/8, 27/210 nM for FLT3, c-Kit, CSF-1R, FGFR1/FGFR3, VEGFR1/VEGFR2/VEGFR3 and PDGFRα/PDGFRβ, respectively. Dovitinib has potent antitumor activity .
|
-
-
- HY-10207
-
|
CHIR-258 lactate; TKI-258 lactate
|
FLT3
c-Kit
FGFR
VEGFR
PDGFR
|
Cancer
|
|
Dovitinib lactate (TKI258 lactate) is a multi-targeted tyrosine kinase inhibitor with IC50s of 1, 2, 8/9, 10/13/8, 27/210 nM for FLT3, c-Kit, FGFR1/3, VEGFR1/2/3 and PDGFRα/β, respectively .
|
-
-
- HY-139996
-
|
|
PROTACs
Apoptosis
FLT3
c-Kit
FGFR
VEGFR
PDGFR
c-Fms
|
Cancer
|
|
Pomalidomide-C5-Dovitinib (compound 2) is a PROTAC containing Pomalidomide, Dovitinib and connected with CRBN. Pomalidomide-C5-Dovitinib shows enhanced antiproliferative effects against FLT3-ITD+ AML cells. Pomalidomide-C5-Dovitinib induces the degradation of the FLT3-ITD and KIT proteins in a ubiquitin-proteasome-dependent manner and completely blocks their downstream signaling pathway. Pomalidomide-C5-Dovitinib has the potential for the research of FLT3-ITD + acute myeloid leukemia .
|
-
-
- HY-50905S
-
|
|
FLT3
c-Kit
FGFR
VEGFR
PDGFR
c-Fms
|
Cancer
|
|
Dovitinib-d8 is the deuterium labeled Dovitinib. Dovitinib (CHIR-258) is a multi-targeted tyrosine kinase inhibitor with IC50s of 1, 2, 8/9, 10/13/8, 27/210 nM for FLT3, c-Kit, FGFR1/FGFR3, VEGFR1/VEGFR2/VEGFR3 and PDGFRα/PDGFRβ, respectively[1][2].
|
-
-
- HY-13892
-
|
CHIR-258 dilactic acid; TKI258 dilactic acid
|
VEGFR
|
Cancer
|
|
Dovitinib (dilactic acid) is an orally active inhibitor of VEGF kinase. Dovitinib (dilactic acid) inhibits receptor tyrosine kinases (RTKs) involved in solid and hematologic cancers and tumor angiogenesis .
|
-
-
- HY-B0062
-
|
TKI258 lactate hydrate; CHIR-258 lactate hydrate
|
FLT3
c-Kit
FGFR
VEGFR
PDGFR
|
Cancer
|
|
Dovitinib lactate hydrate (TKI258 lactate hydrate) is a multi-targeted tyrosine kinase inhibitor with IC50s of 1, 2, 8/9, 10/13/8, 27/210 nM for FLT3, c-Kit, FGFR1/3, VEGFR1/2/3 and PDGFRα/β, respectively .
|
-
-
- HY-P10319
-
|
|
PKA
|
Cardiovascular Disease
Cancer
|
|
RI-STAD-2 is a high-affinity interfering peptide that regulates the subunit RI of protein kinase A (PKA). RI-STAD-2 interferes with the binding of AKAPs and PKA-RI by simulating the interaction between AKAPs' α-helix domain and PKA-RI's dimerization/anchoration (D/D) domain, thereby affecting PKA activity and intracellular localization. RI-STAD-2 can be used to study the role of AKAPs interaction with PKA-RI in pathological processes such as cardiovascular disease and cancer .
|
-
-
- HY-132595
-
-
-
- HY-150751
-
|
ODN A151
|
Toll-like Receptor (TLR)
AIM2
|
Inflammation/Immunology
|
|
ODN TTAGGG (A151), inhibitory oligonucleotide (ODN), is a TLR9, AIM2 and cGAS antagonist. ODN TTAGGG is immunosuppressive and inhibits AIM2 inflammasome activation, as well as cGAS activation, by competing with DNA. ODN TTAGGG can be used in the study of lupus erythematosus and other related autoimmune diseases. ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3' .
|
-
-
- HY-111954
-
-
-
- HY-W039943
-
|
|
Molecular Glues
|
Cancer
|
|
Acetyl-cyclosporin A aldehyde is an acetylated Cyclosporin A (HY-B0579) derivative with a reducing aldehyde group. Cyclosporin A is a potent calmodulin inhibitor and cyclophilin binder that can target the nuclear translocation of NF-AT and cause mitochondrial damage.
|
-
-
- HY-134428
-
|
|
Endogenous Metabolite
|
Metabolic Disease
|
|
Arachidonoyl coenzyme A lithium is an unsaturated fatty acyl coenzyme A, formed by the condensation of the thiol group of coenzyme A with the carboxyl group of arachidonic acid .
|
-
-
- HY-P2149A
-
|
|
Biochemical Assay Reagents
|
Others
|
|
Concanavalin A (agarose) consists of Concanavalin A (HY-P2149) coupled to agarose. Concanavalin A is a tetrameric metalloprotein lectin isolated from Canavalia ensiformis (jack bean). Concanavalin A (agarose) is used for the purification of glycoproteins, polysaccharides and glycolipids as it binds molecules containing α-D-mannopyranosyl, α-D-glucopyranosyl and sterically related residues. Concanavalin A (agarose) has also be used in other application areas including purification of enzyme-antibody conjugates, purification of IgM and separation of membrane vesicles .
|
-
-
- HY-156133
-
|
|
Others
|
Others
|
|
Dihydrospinosyn A aglycone (compound 2) is a derivative of spinosyn A aglycone with a hydrolyzed C9- and C17-glycosidic bond.
|
-
-
- HY-134424
-
|
|
Endogenous Metabolite
|
Metabolic Disease
|
|
Propionyl coenzyme A lithium, a coenzyme A derivative of propionic acid, is an important metabolic intermediate formed by the thioester bond between coenzyme A and propionic acid. The breakdown and production of Propionyl coenzyme A lithim is important for the metabolism of organisms .
|
-
-
- HY-N3226
-
-
-
- HY-P10589
-
|
|
Microtubule/Tubulin
|
Cancer
|
|
Phomopsinamine A is a derivative of Phomopsin A (HY-N6793). Phomopsinamine A is an inhibitor for tubulin polymerization with IC50 of 0.53 μM. Phomopsinamine A inhibits the binding of Vinblastine (HY-13780) to tubulin (IC50 =0.56 μM), promotes the the binding of Colchicine (HY-16569) to tubulin (IC50 =0.32 μM) .
|
-
-
- HY-117175
-
|
(+)-Pandamarilactonine A
|
Others
|
Others
|
|
Pandamarilactonine A converted from Norpandamarilactonine-A of (S)-prolinol .
|
-
-
- HY-132596
-
-
-
- HY-132609
-
|
|
Small Interfering RNA (siRNA)
Transthyretin (TTR)
|
Neurological Disease
|
|
Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis .
|
-
-
- HY-N8488
-
|
|
Others
|
Others
|
|
Anhydro-6-epiophiobolin A, an analog of Ophiobolin A, is a potent inhibitor of photosynthesis (I50s of 6.1 and 1 mM for photosynthesis in Chlorella and Spinach, respectively) .
|
-
-
- HY-164875
-
-
-
- HY-132602
-
|
MRG-201
|
MicroRNA
|
Inflammation/Immunology
|
|
Remlarsen (MRG-201), a miR-29b mimic, acts a miR-29b agonist. Remlarsen has the potential for preventiong formation of a fibrotic scar or cutaneous fibrosis .
|
-
-
- HY-B1342A
-
-
-
- HY-N10509
-
|
A-Trisaccharide
|
Others
|
Others
|
|
Blood-group A trisaccharide (A-Trisaccharide) is a oligosaccharide present in the urine of blood group A secretors .
|
-
-
- HY-150724
-
|
1018 ISS
|
Toll-like Receptor (TLR)
|
Inflammation/Immunology
Cancer
|
|
ODN 1018 (1018 ISS), an oligodeoxynucleotide, is a TLR-9 agonist. ODN 1018 is also a synthetic immunostimulatory sequence that can be used as vaccine adjuvant. Sequence: 5′-TGACTGTGAACGTTCGAGATGA-3′ .
|
-
-
- HY-N8488A
-
|
|
Others
|
Others
|
|
Anhydroophiobolin A is a potent inhibitor of photosynthesis with IC50s of 77 and 14 mM in the photosynthesis of chlorella and spinach, respectively. Anhydroophiobolin A is an analog of Ophiobolin A .
|
-
-
- HY-D1544
-
|
|
Fluorescent Dye
|
Others
|
|
Uniblue A sodium is a reactive protein stain that can be used in the covalent pre-gel staining of the protein (Ex=594 nM) .
|
-
-
- HY-N3776
-
|
|
Others
|
Others
|
|
Dorsmanin A is a prenylated flavonoid from the twigs of Dorstenia mannii .
|
-
-
- HY-E70259
-
|
|
Endogenous Metabolite
|
Metabolic Disease
|
|
18:2 (n6) Coenzyme A triammonium is a Coenzyme A. 18:2 (n6) Coenzyme A triammonium can be used to determine the effects of lysophospholipid acyltransferase activities in adipocyte differentiation .
|
-
-
- HY-145728
-
|
ISIS-2302
|
Integrin
|
Inflammation/Immunology
|
|
Alicaforsen is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
|
-
-
- HY-112980
-
|
|
DNA/RNA Synthesis
|
Inflammation/Immunology
|
|
Nusinersen is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
|
-
-
- HY-145720
-
-
-
- HY-150750
-
-
-
- HY-132587
-
|
ALN-AT3SC; SAR439774
|
Small Interfering RNA (siRNA)
Factor Xa
|
Others
|
|
Fitusiran (ALN-AT3SC), an small interfering RNA, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .
|
-
-
- HY-118593
-
|
Madumycin II; Antibiotic A 2315A
|
Antibiotic
|
Infection
|
|
A2315A (Madumycin II) is an alanine-containing streptogramin A antibiotic. A2315A is a potent peptidyl transferase center (PTC) inhibitor. A2315A inhibits the ribosome prior to the first cycle of peptide bond formation .
|
-
-
- HY-141474
-
|
|
Biochemical Assay Reagents
|
Others
|
|
Glutaryl coenzyme A lithium is a Glutaryl coenzyme A derivative. Glutaryl coenzyme A is an important endogenous metabolites. Glutaryl coenzyme A lithium can be used in HMG-CoA or Glutaryl-CoA related experiment.
|
-
-
- HY-134095
-
|
|
Drug Derivative
|
Infection
|
|
Erythromycin A N-oxide is a derivative of Erythromycin A and can be used in studies as a chiral selector in capillary electrophoresis .
|
-
-
- HY-148130
-
|
RG6091; RO7248824
|
E1/E2/E3 Enzyme
|
Others
|
|
Rugonersen (RG6091; RO7248824) is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
|
-
-
- HY-143230
-
|
OGX-011
|
Apoptosis
|
Cancer
|
|
Custirsen is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.
|
-
-
- HY-P1957
-
|
|
Parasite
|
Infection
|
|
Dihydrocyclosporin A is a derivative of Cyclosporine A (HY-B0579). Dihydrocyclosporin A significantly inhibites promastigotes and intracellular amastigotes. Dihydrocyclosporin A is highly cytotoxic .
|
-
-
- HY-N6595
-
|
|
Others
|
Others
|
|
Lucidone A is a lanostanoid isolated from the fruiting bodies of G. resinaceum. lucidone A showed inhibitory effects against the increase of ALT and AST levels in HepG2 cells induced by H2O2 compared to a control group in the range of their maximum non-toxic concentration (MNTC) .
|
-
-
- HY-142118
-
|
AP 12009
|
TGF-beta/Smad
|
Cancer
|
|
Trabedersen (AP 12009) is an antisense oligodeoxynucleotide that specifically inhibits TGF-β2 (TGF-beta/Smad). Trabedersen can be used for the study of malignant brain tumors and other solid tumors overexpressing TGF-β2, such as those of the skin, pancreas and colon .
|
-
-
- HY-145726
-
|
|
TNF Receptor
|
Inflammation/Immunology
|
|
ISIS 104838 is an antisense oligonucleotide agent that reduces the production of tumor necrosis factor (TNF-alpha), a substance that contributes to joint pain and swelling in rheumatoid arthritis.
|
-
-
- HY-146245
-
|
CpG 1826
|
Toll-like Receptor (TLR)
Apoptosis
|
Inflammation/Immunology
Cancer
|
|
ODN 1826 (CpG 1826), a class B CpG ODN (oligodeoxynucleotide), is a TLR9 agonist. ODN 1826 promotes Apoptosis. ODN 1826 is an excellent immune stimulator with antitumor activity. ODN 1826 has protective effects on the heart. ODN 1826 sequence: 5’-tccatgacgttcctgacgtt-3’ .
|
-
-
- HY-150729
-
|
|
Toll-like Receptor (TLR)
|
Inflammation/Immunology
|
|
ODN 1982 is a unmethylated oligodeoxyribonucleotide (ODN) with no CpG motif, can be used to prepare DNA vaccines. ODN 1982 inhibits R-848 signaling. ODN 1982 sequence: 5’-tccaggacttctctcaggtt-3’ .
|
-
-
- HY-150726
-
|
|
Toll-like Receptor (TLR)
Bacterial
|
Infection
Neurological Disease
Inflammation/Immunology
|
|
ODN 1668, a class B CpG ODN (oligodeoxynucleotide), is a TLR-9 agonist. ODN 1668 has strong immune regulatory properties, can enhance the level of antibody IgG2 subtype, promote the immune response of T cells and B cells, and can be used in the study of vaccine adjuvants. In addition, CpG ODN 1668 induces an antimicrobial immune response via a CaTLR9 dependent pathway in groupers. Sequence: 5'-tccatgacgttcctgatgct-3’ .
|
-
-
- HY-150725
-
|
|
IFNAR
TNF Receptor
|
Infection
Inflammation/Immunology
Cancer
|
|
ODN 1585 is a potent inducer of IFN and TNFα production. ODN 1585 is a potent stimulator of NK (natural killer) function. ODN 1585 increases CD8+ T-cell function, including the CD8+ T cell-mediated production of IFN-γ. ODN 1585 induces regression of established melanomas in mice. ODN 1585 can confer complete protection against malaria in mice. ODN 1585 can be used for acute myelogenous leukemia (AML) and malaria research. ODN 1585 can be used as a vaccine adjuvant .
|
-
- HY-132593
-
|
WVE-120101
|
Huntingtin
|
Neurological Disease
|
|
Rovanersen (WVE-120101) is an antisense oligonucleotide that specifically targets mutated mRNA copies of the huntington (HTT) gene without affecting healthy mRNA of HTT gene, thereby preventing the production of faulty Huntingtin protein. Rovanersen can be used for huntington’s disease research .
|
-
- HY-150748
-
|
|
Toll-like Receptor (TLR)
|
Inflammation/Immunology
Cancer
|
|
ODN D-SL01, a class B CpG ODN (oligodeoxynucleotide), is a TLR9 agonist. ODN D-SL01 has strong immunostimulatory activity in a variety of vertebrate species and has anticancer activity. ODN D-SL01 sequence: 5'- T-C-G-C-G-A-C-G-T-T-C-G-C-C-C-G-A-C-G-T-T-C-G-G-T-A-3' .
|
-
- HY-132591
-
-
- HY-132610
-
|
ALN-AS1
|
Small Interfering RNA (siRNA)
|
Neurological Disease
|
|
Givosiran (ALN-AS1) is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid and porphobilinogen levels. Givosiran can be used for the research of acute intermittent porphyria .
|
-
- HY-147278
-
-
- HY-148089
-
|
|
Transthyretin (TTR)
|
Neurological Disease
|
|
Eplontersen is a triantennary N-acetyl galactosamine (GalNAc3-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases .
|
-
- HY-138146
-
|
4-oxo Withaferin A
|
Others
|
Cancer
|
|
4-Dehydrowithaferin A is the analogue of withaferin A. Withaferin A is a withanolide isolated from Withania somnifera. 4-Dehydrowithaferin A has the potential for the research of multiple myeloma .
|
-
- HY-147217
-
|
ISIS 505358
|
HBV
|
Infection
|
|
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
|
-
- HY-132589
-
-
- HY-132579
-
|
RG6042; IONIS-HTTRx
|
Huntingtin
|
Neurological Disease
|
|
Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD) .
|
-
- HY-132580
-
|
BIIB067; ISIS-SOD1Rx
|
DNA/RNA Synthesis
|
Neurological Disease
|
|
Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS) .
|
-
- HY-150740
-
|
|
Toll-like Receptor (TLR)
|
Inflammation/Immunology
|
|
ODN 21595 is a Guanine-Modified TLR7 and TLR9 inhibitor. ODN 21595 inhibits the release of IFN-α and IL-6 with no cytotoxic. ODN 21595 reduces the expression of CD86 and HLA-DR. ODN 21595 has the potential for the research of systemic lupus erythematosus (SLE) .
|
-
- HY-150738
-
-
- HY-150736
-
|
|
Toll-like Receptor (TLR)
|
Infection
Inflammation/Immunology
|
|
ODN 20844, a guanine-modified inhibitory oligonucleotide (INH-ODN), is a TLR7 and TLR9 (Toll-like receptor) inhibitor, and its parent is INH-ODN 2088. ODN 20844 disrupts TLR7- and TLR9-mediated immune cell immune responses. ODN 20844 sequence: 5'-TCCTGGCGc7GGGAAGT-3' .
|
-
- HY-150744
-
|
|
Toll-like Receptor (TLR)
|
Inflammation/Immunology
|
|
ODN 24888 is an guanine-modified inhibitory oligonucleotides (INH-ODN), shows potent inhibition on TLR7/TLR9-mediated signaling. ODN 24888 impairs IFN-α level and NF-κB activation, inhibits IL-6 release. ODN 24888 involves in immune and inflammatory responses, can be used as a vaccine adjuvant .
|
-
- HY-150215
-
-
- HY-150216
-
-
- HY-118874
-
|
|
Bcl-2 Family
Apoptosis
|
Cancer
|
|
Oblimersen is a BCL-2 inhibitor targeting BCL-2 RNA. Oblimersen specifically binds to the first six codons of the bcl-2 mRNA sequence, resulting in degradation of bcl-2 mRNA and induces apoptosis by down-regulating expression of Bcl-2. Oblimersen can be used for cancer research .
|
-
- HY-148412
-
|
EN101; ODN 7040; BL 7040
|
Cholinesterase (ChE)
|
Others
|
|
Monarsen (EN101) is a synthetic 20-base antisense oligodeoxynucleotide directed against the human AChE gene. Monarsen is used in the study of Autoimmune myasthenia gravis (MG), a neuromuscular disorder caused by autoantibodies directed against the acetylcholine receptor (AChR).
|
-
- HY-148413
-
|
ISIS 3521 sodium
|
PKC
|
Cancer
|
|
Aprinocarsen (ISIS 3521) sodium, a specific antisense oligonucleotide inhibitor of protein kinase C-alpha (PKC-α). Aprinocarsen sodium is a 20-mer oligonucleotide, it regulates cell differentiation and proliferation. Aprinocarsen sodium inhibits the growth of human tumor cell lines in nude mice. Aprinocarsen sodium shows the value as a chemotherapeutic compound of human cancers .
|
-
- HY-W596782
-
|
Chaetochromin
|
Others
|
Neurological Disease
|
|
Chaetochromin A (Compound 1) is a fungal metabolite. Chaetochromin A shows inhibitory effect on botulinum neurotoxin serotype A (BoNT A) (IC50= 24.6 μM) .
|
-
- HY-W145690
-
|
A-Pentasaccharide
|
Others
|
Inflammation/Immunology
|
|
Blood group A pentasaccharide (A-Pentasaccharide), an oligosaccharide in urine, can inhibit the binding of anti-A antibody to blood group A substance .
|
-
- HY-150741
-
|
|
Toll-like Receptor (TLR)
IFNAR
Interleukin Related
|
Infection
Inflammation/Immunology
Cancer
|
|
ODN?2216 is a human-specific TLR9 (toll-like receptor 9) ligand or agonist. ODN?2216 induces high amounts of IFN-α and IFN-β. ODN 2216 induces IFN-α by pDC (plasmacytoid DC) and IL-12 (p40) production by DC (dendritic cells). ODN 2216 stimulates IFN-γ production in peripheral blood mononuclear cells (PBMC), which is indirect and mediated by IFN-α/β. ODN 2216 can activate NK cells and promote IFN-γ production of TCR-triggered CD4 + T cells .
|
-
- HY-150742
-
|
|
Toll-like Receptor (TLR)
|
Inflammation/Immunology
|
|
ODN 2336 is a A-Class CpG ODN (oligodeoxynucleotides), is a potent TLR9 agonist. ODN 2336 induces the production of IFN-α. ODN 2336 up-regulates the expression of IP-10 mRNA and IL-18 mRNA. ODN 2336 can be used as adjuvant of vaccines .
|
-
- HY-150213
-
|
|
CDK
|
Inflammation/Immunology
|
|
ODN BW001 is an oligodeoxynucleotide (ODN). ODN BW001 plays a regulatory role in the proliferation and activation of osteoblast .
|
-
- HY-147267
-
-
- HY-148511
-
|
CMP-001
|
Toll-like Receptor (TLR)
|
Cancer
|
|
Vidutolimod (CMP-001) is a CpG-A oligodeoxynucleotide. Vidutolimod is a Toll-like receptor 9 (TLR9) agonist, which activates plasmacytoid dendritic cells (pDCs) and triggers interferon alpha (IFNα) release, leading to a cascade of anti-tumor immune effects.
|
-
- HY-132586
-
|
NS-065/NCNP-01
|
Nucleoside Antimetabolite/Analog
|
Metabolic Disease
|
|
Viltolarsen (NS-065/NCNP-01) is a phosphorodiamidate morpholino antisense oligonucleotide. Viltolarsen binds to exon 53 of the dystrophin mRNA precursor and restores the amino acid open-reading frame by skipping exon 53, resulting in the production of a shortened dystrophin protein that contains essential functional portions. Viltolarsen has the potential for Duchenne muscular dystrophy (DMD) research .
|
-
- HY-147252
-
-
- HY-14929A
-
|
GR181413A
|
Others
|
Others
|
|
Migalastat (GR181413A free base) hydrochloride is an orally active α-galactosidase A molecular chaperone, with an IC50 value of 0.04 μM for human α-Gal A. Migalastat binds to the active site of certain unstable mutant forms of α-galactosidase A, facilitating their transport to the lysosome. After dissociation in the acidic environment, Migalastat enables the mutant α-galactosidase A to exhibit biological activity .
|
-
- HY-N12044
-
|
|
Apoptosis
|
Cancer
|
|
Asparanin A is an apoptosis inducer with anticancer activity. Asparanin A induces cell cycle arrest in the G0/G1 phase through mitochondria and PI3K/AKT signaling pathways, inhibiting cancer cell growth. Asparanin A also demonstrated in vivo efficacy in a mouse xenograft model of Ishikawa endometrial carcinoma, significantly inhibiting tumor growth .
|
-
- HY-132601
-
|
MRG-106
|
MicroRNA
|
Cancer
|
|
Cobomarsen (MRG-106) is an oligonucleotide inhibitor of miR-155. Cobomarsen inhibits multiple gene pathways associated with cell survival (including JAK/STAT, MAPK/ERK and PI3K/AKT). Cobomarsen can be used for the research of B-cell lymphoma .
|
-
- HY-109591
-
|
|
Biochemical Assay Reagents
|
Others
|
|
Oleoyl coenzyme A (Oleoyl-CoA) is a thioester of oleic acid and coenzyme A. Oleoyl coenzyme A has a role as an Escherichia coli metabolite and a mouse metabolite .
|
-
- HY-D1633
-
|
|
Fluorescent Dye
|
Others
|
|
4-Methylumbelliferyl-β-D-galactopyranoside 6-sulfate is a fluorescent dye. 4-Methylumbelliferyl-β-D-galactopyranoside 6-sulfate can be used in the diagnosis of mucopolysaccharidosis IV A by detecting activity of galactose-6-sulphate sulphatase .
|
-
- HY-D1633A
-
|
|
Fluorescent Dye
|
Others
|
|
4-Methylumbelliferyl-β-D-galactopyranoside 6-sulfate sodium is a fluorescent dye. 4-Methylumbelliferyl-β-D-galactopyranoside 6-sulfate sodium can be used in the diagnosis of mucopolysaccharidosis IV A by detecting activity of galactose-6-sulphate sulphatase .
|
-
- HY-103398
-
-
- HY-158097
-
|
|
Influenza Virus
|
Infection
|
|
IAV-IN-2 (Compound MC-22) inhibits for Influenza A Virus (IAV) through blocking the entry of IAV into host cell via clathrin-mediated endocytosis (CME) .
|
-
- HY-E70270
-
-
- HY-143713
-
|
|
Aurora Kinase
|
Cancer
|
|
Aurora A inhibitor 1 is a potent and selective inhibitor of Aurora A. Aurora A has been implicated in cancers of diverse histological origin and may possess oncogenic properties when overexpressed. Aurora A inhibitor 1 has the potential for the research of cancer diseases mediated by aurora a (extracted from patent WO2021147974A1, compound 49) .
|
-
- HY-134425
-
|
|
Endogenous Metabolite
|
Metabolic Disease
|
|
β-Methylcrotonyl coenzyme A lithium is an intermediate in leucine metabolism and can be used as a substrate to study the specificity and kinetics of β-methylcrotonyl coenzyme A carboxylase (MCCase) .
|
-
- HY-N7332
-
|
|
P-glycoprotein
|
Cancer
|
|
Pepluanin A is a natural compound isolated from Euphorbia peplus L. Pepluanin A shows a very high activity for a jatrophane diterpene, outperforming Cyclosporin A by a factor of at least 2 in the inhibition of Pgp-mediated Daunomycin (HY-13062A) transport [1]
|
-
- HY-N10352
-
|
|
Others
|
Cancer
|
|
4-epi-Withaferin A (compound 28) is the analogue of Withaferin A. 4-epi-Withaferin A enhances cytotoxicity and cytoprotective heat-shock-inducing activity (HSA). 4-epi-Withaferin A has the potential for the research of protein aggregation-associated diseases by stimulating cellular defense mechanisms .
|
-
- HY-134438
-
|
|
Endogenous Metabolite
|
Metabolic Disease
|
|
Hexanoyl coenzyme A trilithium is a hexanoyl-based medium-chain fatty acyl coenzyme A that is present in all organisms. Hexanoyl coenzyme A trilithium can be used as a precursor for cannabinoid biosynthesis and acts as a competitive inhibitor of medium-chain acyl coenzyme A dehydrogenase (MCAD) .
|
-
- HY-14929
-
|
GR181413A free base; 1-Deoxygalactonojirimycin
|
Others
|
Others
|
|
Migalastat (GR181413A free base) is an orally active α-galactosidase A molecular chaperone, with an IC50 value of 0.04 μM for human α-Gal A. Migalastat binds to the active site of certain unstable mutant forms of α-galactosidase A, facilitating their transport to the lysosome. After dissociation in the acidic environment, Migalastat enables the mutant α-galactosidase A to exhibit biological activity .
|
-
- HY-142706
-
|
|
Monoamine Oxidase
HDAC
|
Cancer
|
|
MAO A/HDAC-IN-1 is a dual?inhibitor?of monoamine oxidase A (MAO A) and HDAC. MAO A/HDAC-IN-1 can be used for glioma research . MAO A/HDAC-IN-1 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
|
-
- HY-144307
-
|
|
Aurora Kinase
PKC
|
Cancer
|
|
Aurora A/PKC-IN-1 (Compound 2e) is a potent dual inhibitor of Aurora A (AurA) and PKC (α, β1, β2, and θ) kinases with IC50s of 6.9 nM and 16.9 nM for AurA and PKCα, respectively. Aurora A/PKC-IN-1 has antiproliferative activity in breast cancer cells and antimetastatic activity .
|
-
- HY-N10355
-
|
|
Apoptosis
|
Cancer
|
27-TBDMS-4-Dehydrowithaferin A, a withaferin A derivative, exhibits potent antiproliferative effects on the tumor cells.27-TBDMS-4-Dehydrowithaferin A induces tumor cells apoptosis. 27-TBDMS-4-Dehydrowithaferin A is a anticancer agent .
|
-
- HY-131303
-
|
Heptadecanoyl-CoA
|
Biochemical Assay Reagents
|
Metabolic Disease
|
|
Heptadecanoyl Coenzyme A (Heptadecanoyl-CoA), long-chain acyl-coenzymes A (acyl-CoAs) (LCACoA), is an intermediate in lipid metabolism. Heptadecanoyl Coenzyme A can be used for the research of glucose metabolism .
|
-
- HY-134136
-
|
|
Endogenous Metabolite
|
Metabolic Disease
|
|
Octanoyl coenzyme A is a fatty acyl coenzyme A derivative. Octanoyl coenzyme A can inhibit citrate synthase (CS) and glutamate dehydrogenase (GDH) with IC50 values of 0.4-1.6 mM .
|
-
- HY-11011
-
|
|
Src
|
Inflammation/Immunology
|
|
A-770041 is a selective and orally active Src-family Lck inhibitor. A-770041 inhibits Lck with an IC50 value of 147 nM with the presence of 1 mM ATP. A-770041 shows 300-fold selective to Lck over Fyn, the other Src family kinase involved in T-cell signaling. A-770041 can be used for the research of acute rejection .
|
-
- HY-134136A
-
|
|
Biochemical Assay Reagents
|
Cancer
|
|
Octanoyl coenzyme A lithium is a fatty acyl coenzyme A derivative. Octanoyl coenzyme A lithium can inhibit citrate synthase (CS) and glutamate dehydrogenase (GDH) with IC50 values of 0.4-1.6 mM .
|
-
- HY-134136B
-
|
|
Biochemical Assay Reagents
|
Metabolic Disease
|
|
Octanoyl coenzyme A triammonium is a medium-chain acyl coenzyme A. Octanoyl coenzyme A triammonium can inhibit citrate synthase (CS) and glutamate dehydrogenase (GDH) with IC50 values of 0.4-1.6 mM .
|
-
- HY-109561
-
|
EYE001; NX1838
|
VEGFR
|
Metabolic Disease
Inflammation/Immunology
|
|
Pegaptanib sodium is an RNA aptamer directed against vascular endothelial growth factor (VEGF)-165. Pegaptanib could be used for the study of neovascular age-related macular degeneration (AMD) .
|
-
- HY-109591A
-
|
Oleoyl-CoA lithium
|
Biochemical Assay Reagents
|
Others
|
|
Oleoyl coenzyme A (Oleoyl-CoA) lithium is a thioester of oleic acid and coenzyme A. Oleoyl coenzyme A lithium has a role as an Escherichia coli metabolite and a mouse metabolite .
|
-
- HY-N0365
-
|
|
HIV
|
Infection
|
|
Sennoside A is an anthraquinone glycoside found in senna (Cassia angustifolia). Sennoside A is an HIV-1 inhibitor (IC50=3.8 μM) that inhibits HIV-1 replication. Sennoside A also inhibits HIV-1 reverse transcriptase (RT)-related DNA polymerase (RDDP) and ribonuclease H (Ribonuclease H) with IC50s of 1.9 μM and 5.3 μM, respectively .
|
-
- HY-132613
-
|
|
Small Interfering RNA (siRNA)
|
Metabolic Disease
|
|
Lumasiran sodium, an investigational RNA interference (RNAi) therapeutic agent, reduces hepatic oxalate production by targeting glycolate oxidase. Lumasiran sodium reduces urinary oxalate excretion, the cause of progressive kidney failure in primary hyperoxaluria type 1 (PH1) .
|
-
- HY-132588
-
|
ALN-G01
|
Small Interfering RNA (siRNA)
|
Metabolic Disease
|
|
Lumasiran (ALN-G01), a siRNA product, reduces hepatic oxalate production by targeting glycolate oxidase. By silencing the gene encoding glycolate oxidase, Lumasiran depletes glycolate oxidase and thereby inhibits the synthesis of oxalate, which is the toxic metabolite that is directly associated with the clinical manifestations of Primary hyperoxaluria type 1 (PH1) .
|
-
- HY-134426
-
|
|
Endogenous Metabolite
|
Metabolic Disease
|
|
DL-β-Hydroxybutyryl coenzyme A lithium is an intermediate in the fermentation of butyric acid and the metabolism of lysine and tryptophan, and is produced from β-hydroxybutyric acid by short-chain-CoA synthase .
|
-
- HY-155721
-
|
22-(4′-Pyridinecarbonyl) jorunnamycin A
|
Akt
mTOR
|
Cancer
|
|
22-(4′-py)-JA is a semisynthetic derivative of junamycin A (JA) that can be isolated from the Thai blue sponge (Xestospongia sp.). 22-(4′-py)-JA has antimetastatic activity and can inhibit AKT/mTOR/p70S6K signaling. 22-(4′-py)-JA inhibits tumor cell invasion and tube formation in human umbilical vein endothelial cells (HUVEC), downregulates metalloproteinases (MMP-2 and MMP-9), hypoxia-inducible factor 1α (HIF-1α) and vascular endothelial growth factor (VEGF). 22-(4′-py)-JA has potent anticancer activity against non-small cell lung cancer (NSCLC) .
|
-
- HY-N6677
-
|
Apocarotenal
|
Cytochrome P450
|
Cancer
|
|
β-Apo-8'-carotenal (Apocarotenal), a provitamin A carotenoid, is an inducer of CYPlA1 and CYPlA2 in rat. β-Apo-8'-carotenal is present in many fruits and vegetables .
|
-
- HY-118548
-
|
|
Drug Metabolite
|
Endocrinology
|
|
Tetranor-PGAM is a tetranor-prostaglandin A metabolite. Tetranor-PGAM is a dehydration product of tetranor-PGEM (HY-114988). Tetranor-PGAM can be measured as a surrogate for tetranor-PGEM levels in urine .
|
-
- HY-106770
-
|
|
Monoamine Oxidase
|
Neurological Disease
|
|
Esuprone is a brain-penetrant, orally active and selective MAO A inhibitor with an IC50 of 7.3 nM. Esuprone can be used for neurological research .
|
-
- HY-106445
-
|
BM 41332
|
Others
|
Inflammation/Immunology
|
|
Ciamexon is selective immunosuppressive agent. Ciamexon can be used to study endocrine ophthalmopathies and diabetes mellitus .
|
-
- HY-161606
-
|
|
PARP
|
Cancer
|
|
PARP-1/2/7-IN-1 (compound 86) is a potent inhibitor of PARP-1/2/7, with the IC50 of ＜ 10 nM .
|
-
- HY-161607
-
|
|
PARP
|
Cancer
|
|
PARP7-IN-21 (compound 128) is a potent inhibitor of PARP7, with the IC50 of ＜ 10 nM .
|
-
- HY-107494
-
|
4-Keto 13-cis-retinoic acid; 4-Oxoisotretinoin; Ro 22-6595
|
Endogenous Metabolite
|
Others
|
|
13-cis-4-Oxoretinoic acid (4-Keto 13-cis-retinoic acid) is a metabolite of vitamin A in human plasma .
|
-
- HY-123304
-
|
|
Influenza Virus
|
Infection
|
|
MBX2546 is a influenza A virus inhibitor with the Kd values of 5.3μM and ＞ 100 μM for H1 Hemagglutinin and H3 Hemagglutinin, respectively .
|
-
- HY-159834
-
|
SLC-D011
|
Others
|
Others
|
|
Progerinin is a progerin-lamin A binding inhibitor .
|
-
- HY-147425
-
-
- HY-150747
-
|
|
IFNAR
|
Inflammation/Immunology
|
|
ODN 6016 is a CpG-A oligonucleotides. ODN 6016 can induce IFN-α production, can be used for researching immune disorders including immunodeficiency caused by HIV-1. ODN 6016 sequence: T-sp-C-G-A-C-G-T-C-G-T-G-G-sp-G-sp-G-sp-G .
|
-
- HY-148827
-
|
HYBO-165
|
PKA
|
Cancer
|
|
GEM231 is an 18mer antisense oligonucleotide targeting the mRNA of the PKA-I (RIα regulatory subunit of cAMP dependent protein kinase type I ). GEM231 induces cell growth arrest, apoptosis, and differentiation in a variety of cancer cell lines in vitro and in tumors in vivo.
|
-
- HY-132604
-
|
ARO-AAT
|
Small Interfering RNA (siRNA)
|
Metabolic Disease
|
|
Fazirsiran (ARO-AAT) is a second-generation RNAi agent. Fazirsiran consistes of a cholesterol-conjugated RNAi trigger (chol-RNAi) to selectively degrade Alpha1-antitrypsin (AAT) mRNA by RNAi and a melittin-derived peptide conjugated to N-acetylgalactosamine (NAG) formulated as the excipient EX1 to promote endosomal escape of the chol-RNAi in hepatocytes . Fazirsiran can be used in the study of Alpha-1 Antitrypsin Deficiency (AATD) liver disease.
|
-
- HY-145721
-
|
GED-0301
|
TGF-beta/Smad
|
Inflammation/Immunology
|
|
Mongersen (GED-0301) is a specific and orally active SMAD7 antisense oligonucleotide. Mongersen restores TGF-β1 activity leading to inhibition of inflammatory signals. Mongersen can attenuate Crohn's disease-like experimental colitis in mice .
|
-
- HY-155577
-
|
|
Monoamine Oxidase
HSP
|
Cancer
|
|
MAO A/HSP90-IN-1 (4-b) is a MAO A/HSP90 dual inhibitor with IC50 value of 1.77 μM and 0.019 μM in Glioblastoma (GBM) GL26 cells and HSP90α, respectively. MAO A/HSP90-IN-1 (4-b) can inhibit MAO A activity, HSP90 binding and the expression of HER2 and phospho-Akt to inhibit the growth of GBM, they also reduce PD-L1 expression, which inhibits T cell activation. MAO A/HSP90-IN-1 (4-b) have potential to inhibit tumor immune escape. MAO A/HSP90-IN-1 (4-b) can be used for brain tumor-related diseases research .
|
-
- HY-P3107
-
|
|
Endogenous Metabolite
|
Inflammation/Immunology
|
|
Homodestcardin, a destruxinbased cyclodepsipeptide, is a immunosuppressant. Homodestcardin, a fungal metabolite, displays pronounced activities against concanavalin A (Con A) activation, with an IC50 value of 0.86 μM .
|
-
- HY-19519A
-
|
DF 2156A
|
CXCR
|
Infection
Inflammation/Immunology
Cancer
|
Ladarixin sodium (DF 2156A) is an orally active, allosteric non-competitive and dual CXCR1 and CXCR2 antagonist. Ladarixin sodium can be used for the research of COPD and asthma .
|
-
- HY-132598
-
|
SPC-3649
|
MicroRNA
HCV
|
Infection
Inflammation/Immunology
|
|
Miravirsen (SPC-3649) is a potent miR-122 inhibitor and inhibits the biogenesis of miR-122. Miravirsen is a 15-nucleotide locked nucleic acid-modified phosphorothioate antisense oligonucleotide. Miravirsen inhibits HCV replication. Miravirsen can be used in research of HCV infection .
|
-
- HY-N11939
-
|
|
HIV
|
Infection
|
|
Kadsuralignan A (compound 1) is a dibenzocyclooctadiene lignan isolated from the leaves and stems of Schisandra lancifolia. Kadsuralignan A has anti-HIV activity with EC50=2.23 μg/mL .
|
-
- HY-P5740
-
|
|
Bacterial
|
Infection
|
|
Cacaoidin is a glycosylated lantibiotic isolated from a Streptomyces cacaoi strain. Cacaoidin has potent antibacterial activity against Gram-positive pathogens including Clostridium difficile .
|
-
- HY-153346
-
|
|
Ras
ERK
Apoptosis
|
Cancer
|
|
RMC-6291 is an orally active and covalent inhibitor of KRAS G12C(ON). RMC-6291 forms a tri-complex within tumor cells between KRAS G12C(ON) and cyclophilin A (CypA). Thus, RMC-6291 prevents KRAS G12C(ON) from signaling via steric blockade of RAS effector binding. RMC-6291 inhibits ERK signaling and induced apoptosis in KRASG12C-mutant H358 cells. RMC-6291 also inhibits the proliferation of KRAS G12C mutant cells with a median IC50 of 0.11 nM .
|
-
- HY-129037
-
|
|
BCRP
|
Cancer
|
|
BCRP-IN-1 (compound 48) is a potent inhibitor of breast cancer resistance protein (BCRP), with IC50s of 2.92 μM and 2.46 μM in Hoechst 33342 assay and Pheophorbide A assay, respectively .
|
-
- HY-W340234
-
|
|
Others
|
Others
|
|
4,5-Dibromo-2-pyrrolic acid (compound 2) is an immunosuppressive compound. 4,5-Dibromo-2-pyrrolic acid suppresses the proliferative response of splenocytes to suboptimal concentrations of the mitogen, concanavalin A (Con A) .
|
-
- HY-134348
-
|
8-(4-Hydroxyphenylthio)-2'-O-Me-cAMP
|
Ras
|
Cardiovascular Disease
|
|
8-pHPT-2'-O-Me-cAMP is a cAMP analog and an Epac agonist. 8-pHPT-2'-O-Me-cAMP can be used in cardiac research .
|
-
- HY-161820
-
|
|
Influenza Virus
|
Infection
|
|
IAV-IN-3 (Compound (R,S)-16s) is an anti-influenza A virus (IAV) agent (EC50 = 0.134 μM) with weak cytotoxicity (CC50 = 15.35 μM for MDCK cells). IAV-IN-3 inhibits IAV polymerase with an IC50 of 0.045 μM .
|
-
- HY-P10682
-
|
|
Bacterial
|
Infection
|
|
PuroA is a tryptophan-rich domain of Puroindoline a that exerts antibacterial activity through interaction with bacterial membranes .
|
-
- HY-149034
-
|
S5
|
Influenza Virus
|
Infection
Cancer
|
|
Influenza A virus-IN-8 (S5) is a macrocyclic peptide with no cytotoxic. Influenza A virus-IN-8 is also a potent Influenza A Virus (IAV) inhibitor (with sufficient protease stability) with IC50s of 6.7 and 6.6 nM for H1 and H5 variants, respectively. Influenza A virus-IN-8 shows good affinitiescan to H1 variants, binds to a conserved region in the HA stem with a Kd of 1.0 nM .
|
-
- HY-19519
-
|
DF 2156A free base
|
CXCR
|
Inflammation/Immunology
Cancer
|
Ladarixin (DF 2156A free base) is an orally active, allosteric non-competitive and dual CXCR1 and CXCR2 antagonist. Ladarixin can be used for the research of COPD and asthma .
|
-
- HY-145727
-
|
ISIS 304801
|
Apolipoprotein
|
Endocrinology
|
|
Volanesorsen (ISIS 304801) is an antisense oligonucleotide inhibitor of apolipoprotein CIII (apo-CIII) mRNA that reduces triglyceride levels and improves insulin resistance. Volanesorsen is being studied in the treatment of hypertriglyceridemia, familial chylosiderosis syndrome, and type 2 diabetes .
|
-
- HY-108719
-
-
- HY-108764
-
|
ISIS 301012
|
Apolipoprotein
HCV
|
Metabolic Disease
|
|
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
|
-
- HY-147410
-
|
ION-363
|
DNA/RNA Synthesis
Others
|
Neurological Disease
|
|
Ulefnersen (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
|
-
- HY-112543
-
|
|
Influenza Virus
|
Infection
|
|
S119-8 is a broad spectrum inhibitor of influenza A and B viruses, showing activity against multiple influenza B viruses and an oseltamivir-resistant influenza A virus, but does not inhibit a non-influenza virus, vesicular stomatitis nirus (VSV) .
|
-
- HY-101873S
-
-
- HY-114128
-
|
|
Factor VIII
|
Others
|
|
Turoctocog alfa is a recombinant coagulation factor VIII (FVIII) from chinese hamster ovary (CHO) cells. Turoctocog alfa can be used for researching haemophilia A .
|
-
- HY-W039102
-
|
|
Amino Acid Derivatives
|
Cancer
|
|
N-Fmoc-N,O-dimethyl-L-serine is a serine derivative that can be used for coibamide A synthesis. Coibamide A is a marine natural product with potent antiproliferative activity against human cancer cells .
|
-
- HY-W019823
-
-
- HY-E70188
-
|
EC:3.1.6.4; GALNS
|
Biochemical Assay Reagents
|
Cancer
|
|
N-Acetylgalactosamine-6-Sulfatase (GALNS) is a potential general biomarker for multiple malignancies (such as lung cancer, breast cancer, head and neck cancer, etc.). N-Acetylgalactosamine-6-Sulfatase deficiency causes mucopolysaccharidosis type IVA (MPS IVA), also known as Morquio A syndrome. N-Acetylgalactosamine-6-Sulfatase can be used in MPS IVA as well as cancer research .
|
-
- HY-160628
-
|
|
Free Fatty Acid Receptor
|
Metabolic Disease
|
|
GPR120 Agonist 4 (example 1) is a GPR120 agonist，with the EC50 values of 1 μM and 0.35 μM for β-arrestin A and Calcium A. GPR120 Agonist 4 can be used for the research of type II diabetes mellitus .
|
-
- HY-E70249
-
|
S-[(3S)-3-Hydroxydecanoate]-CoA
|
Endogenous Metabolite
|
Others
|
|
3-Hydroxydecanoyl-CoA (S-[(3S)-3-Hydroxydecanoate]-CoA) is a coenzyme, which is the main substrate for the synthesis enzyme PhaC1 of 1-benzyloxycarbonyl piperidine-4-yl acetic acid (PHA) in P. aeruginosa .
|
-
- HY-12201A
-
|
|
Aurora Kinase
|
Cancer
|
|
TAK-901 hydrochloride is a multi-targeted aurora inhibitor with IC50s of 21 and 15 nM for aurora A and B, respectively .
|
-
- HY-158682
-
|
|
Bacterial
|
Infection
|
|
LpxC-IN-13 (Compound 13) is a LpxC inhibitor, with an IC50 18.06 nM. LpxC-IN-13 effectively inhibits Gram-negative bacterial infection .
|
-
- HY-19249
-
-
- HY-23193
-
|
|
Influenza Virus
|
Infection
|
|
BMS-199945 is a influenza virus fusion inhibitor with the IC50 values of 0.57 μM and approximately 1 μM aganist influenza A/WSN/33 virus-induced hemolysis of chicken RBC and in the trypsin protection assay, respectively .
|
-
- HY-145729
-
|
AZD9150
|
STAT
Apoptosis
|
Cancer
|
|
Danvatirsen is an antisense oligonucleotide targeting STAT3 with potential antitumor activity. Danvatirsen binds to STAT3 mRNA, thereby inhibiting translation of the transcript. Suppression of STAT3 expression induces tumor cell apoptosis and decreases tumor cell growth.
|
-
- HY-147406
-
-
- HY-B1558A
-
|
MCI-2016
|
Monoamine Oxidase
|
Neurological Disease
|
|
Bifemelane hydrochloride (MCI-2016) is a potent, selective and competitive inhibitor of monoamine oxidase A (MAO-A), with a Ki of 4.20 μM. Bifemelane hydrochloride also inhibits MAO-B noncompetitively with a Ki of 46.0 μM. Bifemelane hydrochloride has a potent antidepressant activity and can be used for the research of cognitive and emotional disturbances related to cerebrovascular disease .
|
-
- HY-112273
-
|
|
Aurora Kinase
|
Cancer
|
|
CD532 is a potent Aurora A kinase inhibitor with an IC50 of 45 nM. CD532 has the dual effect of blocking Aurora A kinase activity and driving degradation of MYCN. CD532 also can directly interact with AURKA and induces a global conformational shift. CD532 can be used for the research of cancer .
|
-
- HY-135042
-
|
|
Toll-like Receptor (TLR)
|
Neurological Disease
|
|
CAY10614 is a potent TLR4 antagonist. CAY10614 inhibits the lipid A-induced activation of TLR4, with an IC50 of 1.675 μM. CAY10614 can improve survival of mice in lethal endotoxin shock model .
|
-
- HY-112273A
-
|
|
Aurora Kinase
|
Cancer
|
|
CD532 hydrochloride is a potent Aurora A kinase inhibitor with an IC50 of 45 nM. CD532 hydrochloride has the dual effect of blocking Aurora A kinase activity and driving degradation of MYCN. CD532 hydrochloride also can directly interact with AURKA and induces a global conformational shift. CD532 hydrochloride can be used for the research of cancer .
|
-
- HY-131504A
-
|
|
Glycosidase
|
Metabolic Disease
|
|
Valienamine is the alpha-glucosidase inhibitor. Valienamine is the key functional component of many natural glycosidase inhibitors including the crop protectant validamycin A and the antidiabetic agent acarbose .
|
-
- HY-N8805
-
|
|
Others
|
Cancer
|
|
Nortrachelogenin-8'-O-β-glucoside is a natural product that can be isolated from the dried roots of Pulsatilla koreana. Nortrachelogenin-8'-O-β-glucoside inhibits cancer cell proliferation and reduces hormone dependence .
|
-
- HY-P3850
-
|
|
Neurokinin Receptor
|
Neurological Disease
|
|
(D-Pro2,D-Trp6,8,Nle10)-Neurokinin B is a competitive antagonist of Neurokinin B (Neurokinin Receptor) with a pA2 of 5.5. (D-Pro2,D-Trp6,8,Nle10)-Neurokinin B shows no influence on Substance P or Neurokinin A .
|
-
- HY-P3912
-
|
|
COX
Interleukin Related
|
Infection
|
|
Endotoxin inhibitor a synthetic peptide that binds lipid A with high affinity, thereby detoxifying LPS (HY-D1056) and preventing LPS-induced cytokine release in vivo. Endotoxin inhibitor inhibits the febrile response to LPS with very low toxicity and lethality .
|
-
- HY-148528
-
|
|
Others
|
Cancer
|
|
SC-VC-PAB-N-Me-L-Ala-Maytansinol (compound B1) can be used to synthesis MCC-Maytansinoid A. SC-VC-PAB-N-Me-L-Ala-Maytansinol can be used as a control compound for the cancer research .
|
-
- HY-130581
-
|
|
Bacterial
Antibiotic
|
Infection
|
|
Lipid X is a novel monosaccharide precursor of Lipid A (the active moiety of gram-negative endotoxin). Lipid X is protective against endotoxin administered to mice and sheep and against life-threatening gram-negative infections in mice .
|
-
- HY-101169
-
|
|
Monoamine Oxidase
|
Neurological Disease
|
|
Tetrindole mesylate is a selective inhibitor of monoamine oxidase A (MAO A). Tetrindole mesylate inhibits rat brain mitochondrial MAO A in a competitive manner with a Ki value of 0.4 μM and inhibits MAO B with a Ki of 110 μM. Tetrindole mesylate has antidepressant activity .
|
-
- HY-N12179
-
|
|
Bacterial
|
Others
|
|
Brevianamide M (compound 4) is a metabolite of Aspergillus versicolor. This is an endophytic fungus isolated from the marine brown alga Sargassum. Brevianamide M has antimicrobial activity against Escherichia coli and Staphylococcus aureus .
|
-
- HY-118259
-
-
- HY-163618
-
|
|
Fluorescent Dye
Monoamine Oxidase
|
Cancer
|
|
DHMQ is a NIR fluorescent probe that binds to the propylamino group of monoamine oxidase A (MAO-A). DHMQ tracks MAO-A activity in real-time by using fluorescence imaging on mice and cells .
|
-
- HY-14837
-
|
Enisamium iodide
|
Influenza Virus
SARS-CoV
|
Infection
|
|
Amizon (Enisamium iodide) is a broad-spectrum antiviral agent for influenza A and B. Amizon is an inhibitor for SARS-CoV-2 RNA polymerase .
|
-
- HY-122370A
-
|
|
Aurora Kinase
|
Cancer
|
|
Tripolin B is an ATP-competitive Aurora kinase inhibitor with IC50 values of 2.5 µM and 6 µM for Aurora A and Aurora B kinases, respectively. Tripolin B does not inhibit Aurora kinase in cells .
|
-
- HY-W892911
-
|
|
Influenza Virus
|
Infection
|
|
AV-5080 is an orally active neuraminidase inhibitor. AV-5080 can be used for the research of influenza A and B viruses .
|
-
- HY-147080
-
|
ARC1905
|
Complement System
|
Others
|
|
Avacincaptad pegol (ARC1905) sodium is a 40KDa PEG-conjugated aptamer. Avacincaptad pegol sodium targets complement factor 5 (C5), inhibits the cleavage of C5 into C5a and C5b, limits inflammatory stimulation and complement membrane attack complex (MAC), and is used to study age-related macular degeneration (AMD). Avacincaptad pegol sodium limits irregular cell apoptosis by targeting downstream factors in the complement cascade while preserving the early steps of the complement system. Avacincaptad pegol sodium treats Geographic atrophy (GA) mice .
|
-
- HY-148457
-
|
|
Complement System
|
Infection
Inflammation/Immunology
|
|
Avacincaptad pegol, which is a pegylated aptamer, has garnered significant attention as a C5 complement inhibitor that may reduce inflammation-related retinal pigment epithelium (RPE) damage. Avacincaptad pegol caqn be used for the research of stargardt macular dystrophy (STGD1) and geographic atrophy (GA) .
|
-
- HY-B1311
-
|
SKF-525A; U-5446; RP-5171
|
Cytochrome P450
Monoamine Oxidase
Bcl-2 Family
Survivin
PARP
|
Neurological Disease
Inflammation/Immunology
Cancer
|
|
Proadifen (SKF-525A) hydrochloride is a non-competitive Cytochrome P450 inhibitor with an IC50 value of 19 μM. Proadifen hydrochloride reduces monoamine oxidase A (MAO-A) activity and reverses the antidepressantlike behavioral effect of Imipramine (HY-B1490A) and Desipramine (HY-B1272A) in rats. Proadifen hydrochloride also reduces N, N-dimethyltryptamine (DMT) metabolism in liver microsomes and inhibits N-demethylationand Acridone (HY-W007771) formation. Proadifen hydrochloride augments Lipopolysaccharide (LPS) (HY-D1056)-induced fever and exacerbates Prostaglandin E2 (PGE2) (HY-101952) levels in the rat. Proadifen hydrochloride is promising for research of metabolism-related deseases, ovarian carcinoma, inflammation and dopamine neurons-related deseases .
|
-
- HY-B1606
-
|
Chlorthymol; 6-Chlorothymol
|
GABA Receptor
Bacterial
|
Neurological Disease
Inflammation/Immunology
|
|
Chlorothymol (Chlorthymol) is a potent GABAA receptor subunit LGC-37 positive modulator. Chlorothymol is an effective anticonvulsant. Chlorothymol is protective in several mouse seizure assays, including the 6-Hz 44-mA model of pharmacoresistant seizures. Chlorothymol possess GABAergic, membrane-modifying, antioxidant and topical antiseptic properties .
|
-
- HY-15127R
-
|
|
RAR/RXR
Endogenous Metabolite
Autophagy
|
Cancer
|
|
Isotretinoin (Standard) is the analytical standard of Isotretinoin. This product is intended for research and analytical applications. Isotretinoin (13-cis-Retinoic acid) is an orally active vitamin A derivative and is often be used for the research of severe acne. Isotretinoin also shows anticancer activity .
|
-
- HY-N11770
-
|
|
Others
|
Others
|
|
Rhamnetin 3-O-β-D-glucopyranoside is a flavonoid, that can be isolated from the roots of Polygala sibirica L. (Polygalaceae) .
|
-
- HY-15127
-
|
13-cis-Retinoic acid
|
RAR/RXR
Endogenous Metabolite
Autophagy
|
Cancer
|
|
Isotretinoin (13-cis-Retinoic acid) is an orally active vitamin A derivative and is often be used for the research of severe acne. Isotretinoin also shows anticancer activity .
|
-
- HY-N0035
-
-
- HY-120994
-
|
|
PKA
|
Neurological Disease
Inflammation/Immunology
|
|
Rp-8-CPT-cAMPS sodium, a cAMP analog, is a potent and competitive antagonist of cAMP-induced activation of cAMP-dependent PKA I and II. Rp-8-CPT-cAMPS sodium preferentially selects site A of RI compares to site A of RII and site B of RII compares to site B of RI .
|
-
- HY-120994A
-
|
|
PKA
|
Neurological Disease
Inflammation/Immunology
|
|
Rp-8-CPT-cAMPS, a cAMP analog, is a potent and competitive antagonist of cAMP-induced activation of cAMP-dependent PKA I and II. Rp-8-CPT-cAMPS preferentially selects site A of RI compares to site A of RII and site B of RII compares to site B of RI .
|
-
- HY-120994B
-
|
|
PKA
|
Neurological Disease
Inflammation/Immunology
|
|
Sp-8-CPT-cAMPS, a cAMP analog, is a potent and selective activator of the cAMP-dependent protein kinas A (PKA I and PKA II). Sp-8-CPT-cAMPS selects site A of RI compares to site A of RII by 153-fold and site B of RII compares to site B of RI by 59-fold .
|
-
- HY-131907
-
|
|
Bacterial
|
Infection
|
|
LpxC-IN-5 is a potent non-hydroxamate LpxC (UDP-3-O-acyl-N-acetylglucosamine deacetylase) inhibitor with an IC50 of 20 nM. LpxC-IN-5 shows antibacterial activity against E. coli ATCC25922, P. aeruginosa ATCC27853, K. pneumoniae ATCC13883 and P. aeruginosa 5567 with MIC of 16, 4, 64, and 4 μg/mL, respectively .
|
-
- HY-138294
-
|
|
Ras
Raf
|
Cancer
|
|
RAS/RAS-RAF-IN-1 is a potent RAS and RAS-RAF inhibitor. RAS/RAS-RAF-IN-1 has a KD of 5.0 μΜ-15 μΜ for cyclophilin A (CYPA) binding affinity. RAS/RAS-RAF-IN-1 has antitumor activity .
|
-
- HY-15720B
-
|
|
ROCK
Aurora Kinase
CaMK
|
Neurological Disease
|
|
Glycyl H-1152 hydrochloride (compound 18) is a glycyl derivative of Rho-kinase inhibitors H-1152 dihydrochloride. Glycyl H-1152 hydrochloride inhibits ROCKII, Aurora A, CAMKII and PKG, with IC50s of 0.0118, 2.35, 2.57 and 3.26 μM respectively. Glycyl H-1152 hydrochloride has higher selective than H-1152 hydrochloride .
|
-
- HY-118135
-
|
4MU-α-Gal
|
Fluorescent Dye
|
Others
|
|
4-Methylumbelliferyl-α-D-galactopyranoside (4MU-α-Gal), a substrate for α-galactosidase A (GLA), is a blue pro-fluorogenic substrate. 4-Methylumbelliferyl-α-D-galactopyranoside forms two products, galactose and fluorescent 4MU, upon cleavage by GLA .
|
-
- HY-143495
-
|
|
RSV
Influenza Virus
|
Infection
|
|
RSV-IN-3 (Compound 1) is a dual inhibitor of respiratory syncytial virus (RSV) and influenza virus A (IAV). RSV-IN-3 shows anti-RSV activity (EC50 = 32.70 μM) .
|
-
- HY-143496
-
|
|
RSV
Influenza Virus
|
Infection
|
|
RSV-IN-4 (Compound 2) is a dual inhibitor of respiratory syncytial virus (RSV) and influenza virus A (IAV). RSV-IN-4 shows anti-RSV activity (EC50 = 11.76 μM) .
|
-
- HY-W018582
-
|
|
Fungal
|
Infection
|
|
N-Phenylacrylamide is a special polymer showing high affinity with Ochratoxin A, a colorless and crystalline mycotoxin compound. N-Phenylacrylamide can be applied in the field of mycotoxin extraction, and be used for the security research of agricultural commodities and foods made from cereals and grapes .
|
-
- HY-P3383
-
|
PL-5
|
Bacterial
|
Infection
|
|
Peceleganan (PL-5) is an artificial antimicrobial cecropin A (1-10) × melittin B (3-18) hybrid (10+16)-peptide analogue. Peceleganan inhibits wound infection .
|
-
- HY-151413
-
|
|
Neurokinin Receptor
|
Neurological Disease
|
|
MEN 10207 is a selective NK-2 tachykinin receptor (Neurokinin Receptor) antagonist. MEN 10207 has pA2 values of 5.2, 7.9 and 4.9 in three monoreceptor in vitro assays for NK-1, NK-2 and NK-3 tachykinin receptors, respectively.
|
-
- HY-P9940
-
|
|
Factor VIII
|
Cardiovascular Disease
|
|
Emicizumab is a bispecific monoclonal antibody that bridges activated factor IX and factor X to replace the function of missing activated factor VIII, thereby restoring hemostasis. Emicizumab can be used for hemophilia A research .
|
-
- HY-P3383A
-
|
PL-5 acetate
|
Bacterial
|
Infection
|
|
Peceleganan (PL-5) acetate is an artificial antimicrobial cecropin A (1-10) × melittin B (3-18) hybrid (10+16)-peptide analogue. Peceleganan acetate inhibits wound infection .
|
-
- HY-P99770
-
|
514-G3
|
Bacterial
|
Infection
|
|
Omodenbamab is an anti-SpA (Staphylococcal protein A) human monoclonal antibody with a KD value of 0.0467 nM. Omodenbamab circumvents a key S. aureus evasion mechanism by targeting the cell wall moiety Protein A (SpA). Omodenbamab can be used in research of S. aureus bloodstream infection .
|
-
- HY-P99750
-
|
CT-P23
|
Influenza Virus
|
Infection
|
|
Navivumab (CT-P23) is an influenza A virus hemagglutinin HA monoclonal antibody. neutralizes H1, H2, H5, and H9 influenza A viruses by binding to the stem fusion domain in HA2 .
|
-
- HY-N8556
-
|
|
Others
|
Others
|
|
3,4,5-Trimethoxyphenyl-(6' -o-galloyl) -o-β-d-Glucopyranoside is a phenylpropanoside derived from natural the bark of Streblus ilicifolius (Vidal) .
|
-
- HY-N7346
-
|
|
HSV
Cholinesterase (ChE)
|
Infection
|
|
Lucidadiol is a natural compound isolated from Ganoderma lucidum. Lucidadiol exhibits acetylcholinesterase-inhibitory activity, with IC50 values of 31 μM. Lucidadiol shows antiviral activity against influenza virus type A and HSV type 1 .
|
-
- HY-N12360A
-
|
|
UGT
|
Others
|
|
2,3-Dehydrosilybin B is an enantiomer formed by the oxidation of the natural flavonolignans silybin A .
|
-
- HY-157249
-
|
|
Influenza Virus
|
Infection
|
|
Antiviral agent 43 (compound 16) is a potent and orally active influenza A viruses entry inhibitor. Antiviral agent 43 inhibits replications of influenza A strains VH04-H5N1 and PR8-H1N1 with EC50s of 240 nM and 72 nM, respectively .
|
-
- HY-157323
-
|
|
HDAC
Apoptosis
|
Cancer
|
|
HDAC6-IN-28 (compound 10C) is a potent inhibitor of HDAC6 with an IC50 of 261 nM. HDAC6-IN-28 significantly induces apoptosis and S-phase arrest in B16-F10 cells. HDAC6-IN-28 efficiently increases the expression of acetylated-α-tubulin in vitro and in vivo .
|
-
- HY-N12110
-
|
|
Toll-like Receptor (TLR)
SARS-CoV
|
Infection
|
|
SMU-CX1 is a specific TLR3 inhibitor (IC50: 0.11 μM) with IC50 ranging from 0.14-0.33 μM against multiple influenza A virus subtypes. SMU-CX1 inhibits the viral PB2 and NP proteins with an IC50 of 0.43 μM for SARS-CoV-2 activity. SMU-CX1 also inhibits inflammatory factors in host cells, including IFN-β, IP-10, and CCL-5 .
|
-
- HY-E70266
-
-
- HY-136991
-
|
|
Antibiotic
|
Others
|
|
Basacv is a DNA-polyintercalating bifunctional compound with DNA-high affinity. Basacv is structurally analogous to the antibiotic anti-tumour drug Triostin A and act as a bis-intercalator .
|
-
- HY-163849
-
|
|
Others
|
Inflammation/Immunology
|
|
Mizoribine prodrug-1 (compound 18) is a oral active ester-based mizoribine (HY-17470) prodrug. Mizoribine prodrug-1 displays a inhibition of IL-2 production .
|
-
- HY-120710
-
-
- HY-P10620
-
|
|
Bacterial
|
Others
|
|
GGGYK-Biotin is a substrate peptide designed to study the substrate specificity of Sortase A. GGGYK-Biotin can be used to develop Sortase A variants with different substrate specificities .
|
-
- HY-N0035R
-
-
- HY-105264
-
-
- HY-12054
-
|
|
Aurora Kinase
Autophagy
Influenza Virus
Parasite
|
Cancer
|
|
Hesperadin is an ATP competitive indolinone inhibitor of Aurora A and B. Hesperadin inhibits Aurora B with an IC50 of 250 nM. Hesperadin inhibits the growth of Trypanosoma brucei by blocking nuclear division and cytokinesis. Hesperadin also is a broad-spectrum influenza antiviral .
|
-
- HY-N0505
-
|
|
Monoamine Oxidase
|
Neurological Disease
|
|
Rosiridin inhibits MAO A and MAO B with potential beneficial effect in depression and senile dementia. Rosiridin shows an inhibition of 83.8% against MAO B at 10 μM (pIC50=5.38) .
|
-
- HY-136194
-
-
- HY-12054A
-
-
- HY-P1290
-
|
PKI-(6-22)-amide
|
PKA
|
Neurological Disease
|
|
PKA Inhibitor Fragment (6-22) amide is an inhibitor of cAMP-dependent protein kinase A (PKA), with a Ki of 2.8 nM. PKA Inhibitor Fragment (6-22) amide can significantly reverse low-level morphine antinociceptive tolerance in mice .
|
-
- HY-P1290A
-
|
PKI-(6-22)-amide TFA
|
PKA
|
Neurological Disease
|
|
PKA Inhibitor Fragment (6-22) amide TFA is an inhibitor of cAMP-dependent protein kinase A (PKA), with a Ki of 2.8 nM. PKA Inhibitor Fragment (6-22) amide TFA can significantly reverse antinociceptive tolerance in mice .
|
-
- HY-129180
-
|
|
PROTACs
CDK
|
Cancer
|
|
XY028-133 (example 14) is a PROTAC-based CDK4/6 degrader with anti-tumor activity, which consists of ligands for von Hippel-Lindau and CDK .
|
-
- HY-143766
-
|
|
Influenza Virus
|
Infection
|
|
Cap-dependent endonuclease-IN-13 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-13 has the potential for the research of influenza virus infection (only influenza A) (extracted from patent WO2021180147A1, compound I-1) .
|
-
- HY-144066
-
|
|
Influenza Virus
|
Infection
|
|
Cap-dependent endonuclease-IN-21 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-21 inhibits the replication of influenza virus. ap-dependent endonuclease-IN-21 has the potential for the research of influenza virus infection (influenza A) (extracted from patent WO2021233302A1, compound 8B or 8A) .
|
-
- HY-144067
-
|
|
Influenza Virus
|
Infection
|
|
Cap-dependent endonuclease-IN-23 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-23 inhibits the replication of influenza virus. ap-dependent endonuclease-IN-23 has the potential for the research of influenza virus infection (influenza A) (extracted from patent WO2021233302A1, compound 8A or 8B) .
|
-
- HY-151461
-
|
|
Others
|
Cancer
|
|
CHNQD-01255 is an orally active Arf-GEFs inhibitor with potent anti-hepatocellular carcinoma (HCC) efficacy .
|
-
- HY-P3868A
-
|
|
Apoptosis
|
Cardiovascular Disease
|
|
QEQLERALNSS TFA is a helix B surface peptide (HBSP) derived from erythropoietin with tissue protective activities. QEQLERALNSS TFA protects cardiomyocytes from apoptosis .
|
-
- HY-129496
-
|
|
Thrombin
|
Cardiovascular Disease
|
|
NP-313 is a potent antithrombotic agent that inhibits platelet aggregation and activation. NP-313 has dual inhibition of thromboxane A 2 synthesis and selective inhibition of SOCC-mediated Ca 2+ inward flow .
|
-
- HY-N3421
-
|
|
Interleukin Related
TNF Receptor
Influenza Virus
|
Infection
Inflammation/Immunology
Cancer
|
|
Koaburaside is a cytoprotective and anti-inflammatory natural compound. Koaburaside shows antioxidant activity with an IC50 of 9.0 μM for DPPH-free radical scavenging assay. Koaburaside inhibits histamine release and expressions of IL-6 and TNF-α in human mast cells. Koaburaside also effectively inhibits influenza A neuraminidase .
|
-
- HY-P5309
-
|
|
Biochemical Assay Reagents
|
Inflammation/Immunology
|
|
(Thr(GalNAc)4,7,15,Ser(GalNAc)9,11)-IgA1 Hinge Region Peptide is a synthetic glycopeptide and can be used for detection of gender difference and epitope specificity of IgG antibody activity against IgA1 hinge portion in IgA nephropathy patients .
|
-
- HY-N3745
-
|
|
Others
|
Others
|
|
(-)-(7R, 8S)-dihydrodehydrodiconiferyl alcohol (compound 10) is a lignan isolated from Hedyotis uncinella .
|
-
- HY-W717329
-
|
|
Aminopeptidase
|
Cardiovascular Disease
|
|
EC33 is a selective aminopeptidase A (APA) inhibitor. EC33 blocks the pressor response of exogenous Ang II. EC33 does not cross the blood-brain barrier. EC33 has the potential for salt-dependent model of hypertension research .
|
-
- HY-158312
-
-
- HY-19590
-
|
Ro 15-1570
|
Drug Derivative
|
Cancer
|
|
Etarotene (Ro 15-1570) is a derivative of Arotinoid (HY-106735). Etarotene is an orally active antitumor agent against DMBA (HY-W011845)-induced mammary tumor and causes toxic symptoms of hypervitaminosis A in rat model .
|
-
- HY-124894
-
|
|
Fungal
|
Infection
|
(+)-Benalaxyl is a broad-spectrum benzamide fungicide. (+)-Benalaxyl inhibits the growth of the freshwater algae S. obliquus, with an EC50 value of 8.441 mg/L. (+)-Benalaxyl can induce the production of chlorophyll a and b, as well as increase the activity of superoxide dismutase (SOD) and the generation of malondialdehyde (MDA). (+)-Benalaxyl has inhibitory effects on catalase (CAT). (+)-Benalaxyl is effective against diseases caused by oomycetes .
|
-
- HY-161983
-
|
|
Influenza Virus
|
Infection
|
|
Neuraminidase-IN-22 (compound 3e) is a potent, selective and orally active neuraminidase inhibitor with an IC50 value of 0.03 µM. Neuraminidase shows cytotoxicity and anti-influenza A virus activity .
|
-
- HY-19155A
-
|
ZD-8731
|
Angiotensin Receptor
|
Cardiovascular Disease
|
|
ICI-D 8731 (compound 5g) is a angiotensin II receptor antagonist with the IC50 of 0.031 μM. ICI-D 8731 shows a rapid and sustained lowering of blood pressure in a renal hypertensive rat model .
|
-
- HY-167880
-
|
|
Macrophage migration inhibitory factor (MIF)
|
Cancer
|
|
BMY-25551 is a Mitomycin A (HY-130332) analogue that is 8 to 20 times more potent than Mitomycin C (HY-13316) in cytotoxicity to murine and human tumor cell lines. BMY-25551 can be utilized in cancer and hematologic depression research .
|
-
- HY-N0505R
-
|
|
Monoamine Oxidase
|
Neurological Disease
|
|
Rosiridin (Standard) is the analytical standard of Rosiridin. This product is intended for research and analytical applications. Rosiridin inhibits MAO A and MAO B with potential beneficial effect in depression and senile dementia. Rosiridin shows an inhibition of 83.8% against MAO B at 10 μM (pIC50=5.38) .
|
-
- HY-W399940
-
|
|
Antibiotic
Influenza Virus
Drug Intermediate
|
Infection
|
|
Actiphenol is an antibiotic against coxsackievirus B3 and influenza A virus (IC50s = 14.37 and 34.4 µg/mL, respectively). Actiphenol is also an aromatic ketone that exhibits weak eukaryotic translation inhibiton activity, which is found in Streptomyces species. Actiphenol can be used as a key intermediate to synthesize Cycloheximide (HY-12320) .
|
-
- HY-D0910
-
|
|
Biochemical Assay Reagents
|
Others
|
|
5-Bromo-6-chloro-1H-indol-3-yl acetate, a member of the indole family, is a derivative of the aromatic heterocyclic compound indole. It has been used in a variety of research settings, including studies of enzyme kinetics and protein-ligand interactions. 5-Bromo-6-chloro-1H-indol-3-yl acetate is a biomaterial or organic compound that can be used as a biomaterial or organic compound related to life science research .
|
-
- HY-134922
-
|
|
Influenza Virus
|
Infection
|
|
NS1-IN-1 (compound 3) is a potent NS1 inhibitor. NS1 is a major influenza A virus virulence factor that inhibits host gene expression. NS1-IN-1 decreases viral protein levels, contributing to the reduction of virus replication. NS1-IN-1 shows antiviral activity by repressing the activity of mTORC1 in a TSC1-TSC2-dependent manner .
|
-
- HY-136071
-
-
- HY-136070
-
-
- HY-136195
-
-
- HY-B1856
-
