Search Result

Results for "

GGT

" in MedChemExpress (MCE) Product Catalog:

By Targets:	AIM2 (1) Apoptosis (1) ASCT (1) CDK (1) Farnesyl Transferase (5) Fluorescent Dye (1) HBV (1) Parasite (2) PKC (1) Small Interfering RNA (siRNA) (4) Thrombin (1) Toll-like Receptor (TLR) (2)
By Research Areas:	Cancer (12) Cardiovascular Disease (1) Endocrinology (1) Infection (3) Inflammation/Immunology (5) Neurological Disease (1)

Inhibitors & Agonists

Natural
Products

Recombinant Proteins

Antibodies

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-RS05403

GGT1 Human Pre-designed siRNA Set A	Small Interfering RNA (siRNA)	Others
GGT1 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT1 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.

GGT1 Human Pre-designed siRNA Set A GGT1 Human Pre-designed siRNA Set A

HY-RS05404

GGT5 Human Pre-designed siRNA Set A	Small Interfering RNA (siRNA)	Others
GGT5 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT5 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.

GGT5 Human Pre-designed siRNA Set A GGT5 Human Pre-designed siRNA Set A

HY-RS05405

GGT6 Human Pre-designed siRNA Set A	Small Interfering RNA (siRNA)	Others
GGT6 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT6 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.

GGT6 Human Pre-designed siRNA Set A GGT6 Human Pre-designed siRNA Set A

HY-RS05406

GGT7 Human Pre-designed siRNA Set A	Small Interfering RNA (siRNA)	Others
GGT7 Human Pre-designed siRNA Set A contains three designed siRNAs for GGT7 gene (Human), as well as a negative control, a positive control, and a FAM-labeled negative control.

GGT7 Human Pre-designed siRNA Set A GGT7 Human Pre-designed siRNA Set A

HY-W016586

Acivicin AT-125; U-42126	Parasite	Infection Cancer
Acivicin (AT-125), a natural product produced by Streptomyces sviceus is a γ-glutamyl transpeptidase (GGT) inhibitor. Acivicin can across the blood-brain barrier and has anti-cancer, anti-parasitic properties .

HY-W016586A

Acivicin hydrochloride AT-125 hydrochloride; U-42126 hydrochloride	Parasite	Infection Cancer
Acivicin hydrochloride (AT-125 hydrochloride), a natural product produced by Streptomyces sviceus, is a γ-glutamyl transpeptidase (GGT) inhibitor. Acivicin hydrochloride can across the blood-brain barrier and has anti-cancer, anti-parasitic properties .

HY-W011391

GPNA hydrochloride 5 Publications Verification	Apoptosis ASCT	Cancer
GPNA hydrochloride is a well known substrate of the enzyme γ-glutamyltransferase (GGT). GPNA hydrochloride is a specific glutamine (Gln) transporter ASCT2 inhibitor. GPNA hydrochloride also inhibit Na ⁺-dependent carriers, such as SNAT family (SNAT1/2/4/5), and the Na ⁺-independent leucine transporters LAT1/2. GPNA reversibly induces apoptosis in A549 cells .

HY-128350

FGTI-2734	Farnesyl Transferase	Cancer
FGTI-2734 is a RAS C-terminal mimetic dual farnesyl transferase (FT) and geranylgeranyl transferase-1 (GGT-1) inhibitor with IC₅₀s of 250 nM and 520 nM for FT and GGT-1, respectively. FGTI-2734 can prevent membrane localization of KRAS, hence solving KRAS resistance problem and thwarting mutant KRAS patient-derived pancreatic tumors .

HY-108467

GGsTop 2 Publications Verification Nahlsgen	Others	Cardiovascular Disease
GGsTop (Nahlsgen) is a potent, non-toxic, highly selective and irreversible γ−glutamyl transpeptidase (GGT) inhibitor, with a K_i of 170 μM for Human GGT. GGsTop shows a pK_a of 9.71, also exhibits K_ons of 150±10 and 51±3 M ^-1 s ^-1 against E.coli GGT and human GGT, respectively . GGsTop protects hepatic ischemia-reperfusion injury in rat model .

HY-147081

AS 1411 AGRO-100	Others	Cancer
AS1411 is a nucleic acid aptamer that targets nucleolin. AS1411 can deliver nanoparticles, oligonucleotides, and small molecules to cancer cells, exerting antitumor effects .

HY-118916

FTI-2148	Farnesyl Transferase	Cancer
FTI-2148 is a RAS C-terminal mimetic dual farnesyl transferase (FT-1) and geranylgeranyl transferase-1 (GGT-1) inhibitor with IC₅₀s of 1.4 nM and 1.7 μM, respectively .

HY-118916A

FTI-2148 diTFA	Farnesyl Transferase	Cancer
FTI-2148 diTFA is a RAS C-terminal mimetic dual farnesyl transferase (FT-1) and geranylgeranyl transferase-1 (GGT-1) inhibitor with IC₅₀s of 1.4 nM and 1.7 μM, respectively .

HY-148826

Rovunaptabin ARC 183	Thrombin	Others
Rovunaptabin (ARC 183) is a DNA aptamer, which is a single-stranded DNA molecule consisting of 15 deoxynucleotides that forms well-defined three-dimensional configuration, allowing it to bind to thrombin with high affinity and specificity.

HY-150751

ODN TTAGGG ODN A151	Toll-like Receptor (TLR) AIM2	Inflammation/Immunology
ODN TTAGGG (A151), inhibitory oligonucleotide (ODN), is a TLR9, AIM2 and cGAS antagonist. ODN TTAGGG is immunosuppressive and inhibits AIM2 inflammasome activation, as well as cGAS activation, by competing with DNA. ODN TTAGGG can be used in the study of lupus erythematosus and other related autoimmune diseases. ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3' .

HY-128350A

FGTI-2734 mesylate	Farnesyl Transferase	Cancer
FGTI-2734 mesylate is a RAS C-terminal mimetic dual farnesyl transferase (FT) and geranylgeranyl transferase-1 (GGT) inhibitor with IC₅₀s of 250 nM and 520 nM for FT and GGT, respectively. FGTI-2734 mesylate can prevent membrane localization of KRAS, hence solving KRAS resistance problem and thwarting mutant KRAS patient-derived pancreatic tumors .

HY-126710

OU749

Others Cancer

OU749 is a potent γ-glutamyl transpeptidase (GGT) inhibitor with a K_i value of 17.6 µM. OU749 shows cytotoxicity .

OU749	Others	Cancer
OU749 is a potent γ-glutamyl transpeptidase (GGT) inhibitor with a K_i value of 17.6 µM. OU749 shows cytotoxicity .

HY-U00327

Prenyl-IN-1	Farnesyl Transferase	Neurological Disease
Prenyl-IN-1 is a protein prenylation inhibitor, especially a geranylgeranyltransferase (GGT) or a farnesyltransferase (FT) inhibitor, exhibiting potent activity against oxidative stress, and particularly in the treatment of Parkinson's Disease.

HY-146343

BMI-Glu	Fluorescent Dye	Inflammation/Immunology Cancer
BMI-Glu is a selective γ-glutamyl transpeptidase (GGT) fluorescent probe with a K_m of 69.63 µM. BMI-Glu has high sensitivity, good water solubility and biocompatibility .

HY-150729

ODN 1982	Others	Inflammation/Immunology
ODN 1982 is a unmethylated oligodeoxyribonucleotide (ODN) with no CpG motif, can be used to prepare DNA vaccines. ODN 1982 inhibits R-848 signaling. ODN 1982 sequence: 5’-tccaggacttctctcaggtt-3’ .

HY-148413

Aprinocarsen sodium ISIS 3521 sodium	PKC	Cancer
Aprinocarsen (ISIS 3521) sodium, a specific antisense oligonucleotide inhibitor of protein kinase C-alpha (PKC-α). Aprinocarsen sodium is a 20-mer oligonucleotide, it regulates cell differentiation and proliferation. Aprinocarsen sodium inhibits the growth of human tumor cell lines in nude mice. Aprinocarsen sodium shows the value as a chemotherapeutic compound of human cancers .

HY-150748

ODN D-SL01	Toll-like Receptor (TLR)	Inflammation/Immunology Cancer
ODN D-SL01, a class B CpG ODN (oligodeoxynucleotide), is a TLR9 agonist. ODN D-SL01 has strong immunostimulatory activity in a variety of vertebrate species and has anticancer activity. ODN D-SL01 sequence: 5'- T-C-G-C-G-A-C-G-T-T-C-G-C-C-C-G-A-C-G-T-T-C-G-G-T-A-3' .

HY-150213

ODN BW001

CDK Inflammation/Immunology

ODN BW001 is an oligodeoxynucleotide (ODN). ODN BW001 plays a regulatory role in the proliferation and activation of osteoblast .

ODN BW001	CDK	Inflammation/Immunology
ODN BW001 is an oligodeoxynucleotide (ODN). ODN BW001 plays a regulatory role in the proliferation and activation of osteoblast .

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-147267

Evazarsen

ISIS-757456
Others Endocrinology

Evazarsen is an angiotensinogen synthesis inhibitor and possesses antihypertensive properties .

Evazarsen ISIS-757456	Others	Endocrinology
Evazarsen is an angiotensinogen synthesis inhibitor and possesses antihypertensive properties .

Acivicin hydrochloride AT-125 hydrochloride; U-42126 hydrochloride	Infection Microorganisms Classification of Application Fields Ketones, Aldehydes, Acids Source classification Disease Research Fields	Parasite
Acivicin hydrochloride (AT-125 hydrochloride), a natural product produced by Streptomyces sviceus, is a γ-glutamyl transpeptidase (GGT) inhibitor. Acivicin hydrochloride can across the blood-brain barrier and has anti-cancer, anti-parasitic properties .

Acivicin AT-125; U-42126	Infection Microorganisms Classification of Application Fields Ketones, Aldehydes, Acids Source classification Disease Research Fields	Parasite
Acivicin (AT-125), a natural product produced by Streptomyces sviceus is a γ-glutamyl transpeptidase (GGT) inhibitor. Acivicin can across the blood-brain barrier and has anti-cancer, anti-parasitic properties .

Species:	Human (2)
Tag:	His (2)
Source:	HEK293 (2)

Cat. No.	Compare	Product Name	Species	Source

HY-P76361

	GGT5 Protein, Human (HEK293, His) Glutathione hydrolase 5 proenzyme; GGT-rel; GGT 5; GGTLA1	Human	HEK293
	The GGT5 protein is an important glycosaminoglycan lyase that selectively cleaves heparin and heparan sulfate using a β-elimination mechanism. It targets specific linkages, such as alpha-D-GlcNp2S6S(1->4) alpha-L-IdoAp2S in heparin and alpha-D-GlcNp2Ac(or 2S)6OH(1->4)beta- in heparan sulfate D-GlcAp. GGT5 Protein, Human (HEK293, His) is the recombinant human-derived GGT5 protein, expressed by HEK293 , with N-His labeled tag. The total length of GGT5 Protein, Human (HEK293, His) is 557 a.a., with molecular weight of ~23-27 & 48-61.8 KDa.

HY-P700729

	GGT1 Protein, Human (HEK293, His) Gamma-glutamyltransferase 1; GGT 1; CD224; GGT; GGT-1; GGTD; D22S672; D22S73; D22S732	Human	HEK293
	GGT1 Protein cleaves the gamma-glutamyl bond of extracellular glutathione, glutathione conjugates, and other gamma-glutamyl compounds. Its metabolism releases free glutamate and cysteinyl-glycine, hydrolyzed to cysteine and glycine. In the presence of high dipeptide concentrations, it catalyzes transpeptidation, forming new gamma-glutamyl compounds. GGT1 contributes to cysteine and glutathione homeostasis and converts leukotriene LTC4 to LTD4. Note: GGT1 seems to be inactive. GGT1 Protein, Human (HEK293, His) is the recombinant human-derived GGT1 protein, expressed by HEK293, with N-His labeled tag. The total length of GGT1 Protein, Human (HEK293, His) is 543 a.a., with molecular weight of 55-65 kDa (heavy chain) & 25-30 kDa (light chain), respectively.


Products	In-stock - + Add to Cart
Cat. No.
Species
Source
Tag
Accession
Gene ID
Molecular Weight
Purity
Endotoxin Level
Biological Activity
Appearance
Formulation
Storage & Stability
Shipping
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks