Search Result

Results for "

HBV

" in MedChemExpress (MCE) Product Catalog:

By Targets:	HBV (173) Antibiotic (1) Apoptosis (7) Autophagy (3) Bacterial (4) Bcl-2 Family (1) Carbonic Anhydrase (1) Cytochrome P450 (1) DNA/RNA Synthesis (14) Endogenous Metabolite (5) Estrogen Receptor/ERR (1) Ferroptosis (1) Fungal (1) FXR (1) HCV (8) Histamine Receptor (1) HIV (27) HSV (1) IFNAR (1) IKK (2) Influenza Virus (3) Isotope-Labeled Compounds (4) JAK (1) Lipoxygenase (1) NADPH Oxidase (1) Nucleoside Antimetabolite/Analog (3) Organoid (1) Orthopoxvirus (2) Parasite (3) PROTACs (1) Pyroptosis (1) Reactive Oxygen Species (4) Reverse Transcriptase (12) RSV (1) SARS-CoV (1) Sirtuin (3) Small Interfering RNA (siRNA) (1) STAT (1) Tau Protein (1) Toll-like Receptor (TLR) (2)
By Research Areas:	Cancer (17) Cardiovascular Disease (1) Endocrinology (1) Infection (175) Inflammation/Immunology (20) Metabolic Disease (5) Neurological Disease (7)
Click Chemistry:	Azide (4) Alkynes (1)

192

Inhibitors & Agonists

Screening Libraries

Peptides

Inhibitory Antibodies

Natural
Products

Recombinant Proteins

Isotope-Labeled Compounds

Antibodies

Click Chemistry

Targets Recommended: HBV

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-149815

HBV-IN-33

HBV Infection Inflammation/Immunology

HBV-IN-33 (C-49), a HBV inhibitor, notably suppresses HBV replication in HepAD38, HepG2-HBV1.3 and HepG2-NTCP cells .

HBV-IN-33	HBV	Infection Inflammation/Immunology
HBV-IN-33 (C-49), a *HBV* inhibitor, notably suppresses HBV replication in HepAD38, HepG2-HBV1.3 and HepG2-NTCP cells .

HY-156703S

HBV-IN-39-d3	HBV	Infection
HBV-IN-39-d3 (Example 14) is a deuterated HBV-IN-39 (Example 13). HBV-IN-39 is an HBV inhibitor. HBV-IN-39-d3 has better oral bioavailability than HBV-IN-39 .

HY-155547

HBV-IN-34	HBV	Infection
HBV-IN-34 (compound 17i) is a potent HBsAg production inhibitor. HBV-IN-34 exhibits excellent in vitro anti-HBV potency, with an EC₅₀ of 0.018 μM and 0.044 μM for HBV DNA and HBsAg, respectively .

HY-145713

HBV-IN-19	HBV	Infection
HBV-IN-19 inhibits hepatitis B virus (HBV) infection. Inhibiting HBsAg secretion and/or production is a strategy for the treatment of HBV infection, including chronic HBV infection .

HY-155968

HBV-IN-40

HBV Infection

HBV-IN-40 (Compound 11826096) is a HBV inhibitor (IC₅₀: 0.7 μM). HBV-IN-40 is an antiviral agent .

HBV-IN-40	HBV	Infection
HBV-IN-40 (Compound 11826096) is a **HBV inhibitor (IC₅₀*: 0.7 μM). HBV-IN-40 is an antiviral agent .***

HY-146011

HBV-IN-21	HBV DNA/RNA Synthesis	Infection
HBV-IN-21 (Compound II-8b) is an HBV DNA replication inhibitor with an IC₅₀ of 2.2 µM. HBV-IN-21 can interact HBV 4 capsid protein with good affinity (K_D = 60.0 μM) .

HY-145713A

HBV-IN-19 TFA	HBV	Infection
HBV-IN-19 TFA inhibits hepatitis B virus (HBV) infection. Inhibiting HBsAg secretion and/or production is a strategy for the treatment of HBV infection, including chronic HBV infection .

HY-144322

HBV-IN-18

HBV Infection

HBV-IN-18 (Compound 3) is an HBV capsid assembly modulator (CpAM) with an EC₅₀ of 2790 nM .

HBV-IN-18	HBV	Infection
HBV-IN-18 (Compound 3) is an *HBV* capsid assembly modulator (CpAM) with an EC₅₀ of 2790 nM .

HY-161327

HBV-IN-44	HBV	Infection
HBV-IN-44 (Compound (S)-2a) is a *HBV* inhibitor with a IC₅₀ value of 23 nM for HbsAg. HBV-IN-44 is less toxic to the neurite growth of HT22 cells and DRG neurons in vitro .

HY-146394

HBV-IN-22	HBV DNA/RNA Synthesis	Infection
HBV-IN-22 (Compound LC5f) is an inhibitor of HBV DNA replication with IC₅₀ values of 0.71 μM and 0.84 μM against wild-type and agent resistant HBV strains, respectively .

HY-163124

HBV-IN-43

HBV Infection

HBV-IN-43 (compound 5832) is a potent inhibitor of HBV .

HBV-IN-43	HBV	Infection
HBV-IN-43 (compound 5832) is a potent inhibitor of *HBV* .

HY-145059

HBV-IN-12	HBV	Infection
HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC₅₀ ≤0.05 μM). HBV-IN-12 shows anti-HBV DNA activity (0.001 μM＜EC₅₀ ≤0.02 μM). From patent WO2021204252A1, compound 15 .

HY-144047

HBV-IN-16	HBV DNA/RNA Synthesis	Infection
HBV-IN-16 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-16 is a quinoline derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2019121357A1, compound 1) .

HY-144045

HBV-IN-14	HBV DNA/RNA Synthesis	Infection
HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5) .

HY-144046

HBV-IN-15	HBV DNA/RNA Synthesis	Infection
HBV-IN-15 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-15 is a flavone derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2020052774A1, compound 2) .

HY-145055

HBV-IN-11

HBV Infection

HBV-IN-11 is a potent HBsAg secretion inhibitor with an EC₅₀ of 0.46 µM (From patent WO2018085619A1, example 28) .

HBV-IN-11	HBV	Infection
HBV-IN-11 is a potent HBsAg secretion inhibitor with an EC₅₀ of 0.46 µM (From patent WO2018085619A1, example 28) .

HY-151134

HBV-IN-25	HBV	Infection
HBV-IN-25 is a good potency, orally active novel HBV cccDNA reducer. HBV-IN-25 has anti-HBeAg potency and anti-HBV activity with IC₅₀ values of 0.58 μM and 1.15 μM, respectively. HBV-IN-25 has good aqueous solubility (LYSA＞452 μg/mL) and good PK property with no cellular toxicity .

HY-148781

HBV-IN-30	HBV	Infection
HBV-IN-30 (ex44), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-30 has the potential for the research of HBV infection .

HY-148780

HBV-IN-29	HBV	Infection
HBV-IN-29 (ex8), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-29 has the potential for the research of HBV infection .

HY-145060

HBV-IN-13

HBV Infection

HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor. From patent WO2021204252A1, compound 1_B .

HBV-IN-13	HBV	Infection
HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor. From patent WO2021204252A1, compound 1_B .

HY-145053

HBV-IN-10	HBV	Infection
HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC₅₀ ≤0.05 μM). From patent WO2021204258A1, compound 6 .

HY-146395

HBV-IN-23	HBV DNA/RNA Synthesis Apoptosis	Infection Cancer
HBV-IN-23 (Compound 5k) is an inhibitor of HBV DNA replication with an IC₅₀ of 0.58 μM. HBV-IN-23 inhibits HBV DNA replication in both agent sensitive and resistant HBV strains. HBV-IN-23 shows anti-hepatocellular carcinoma cell (HCC) activities. HBV-IN-23 induces HepG2 cells apoptosis .

HY-149392

HBV-IN-35

HBV Infection

HBV-IN-35 (Compound 88) is a HBV inhibitor. HBV-IN-35 has anti-HBV activities in mouse and human hepatocytes (EC₅₀: 100 nM and 400 nM respectively) .

HBV-IN-35	HBV	Infection
HBV-IN-35 (Compound 88) is a *HBV* inhibitor. HBV-IN-35 has anti-HBV activities in mouse and human hepatocytes (EC₅₀: 100 nM and 400 nM respectively) .

HY-131343

HBV-IN-4	HBV DNA/RNA Synthesis	Infection
HBV-IN-4, a phthalazinone derivative, is a potent and orally active HBV DNA replication inhibitor with an IC₅₀ of 14 nM. HBV-IN-4 induces the formation of genome-free capsids and has potent anti-HBV potencies .

HY-148782

HBV-IN-31	HBV	Infection
HBV-IN-31 is a potent cccDNA (covalently closed circular DNA) inhibitor. HBV-IN-31 shows anti-HBV activity with an IC₅₀ value of 0.13 µM for HBsAg. HBV-IN-31 inhibits cell growth .

HY-148783

HBV-IN-32	HBV	Infection
HBV-IN-32 is a potent cccDNA (covalently closed circular DNA) inhibitor. HBV-IN-32 shows anti-HBV activity with an IC₅₀ value of 0.14 µM for HBsAg. HBV-IN-32 inhibits cell growth .

HY-156702

HBV-IN-38

HBV Infection

HBV-IN-38 (Example 193) is an HBV DNA inhibitor (EC₅₀≤100nM). HBV-IN-38 can be used to study viral infections .
HY-149435

HBV-IN-36

HBV Infection

HBV-IN-36 (compound 42) is a HBV inhibior (IC₅₀=2 μM), showing anti-HBV activity with EC₅₀ of 0.58 μM .
HY-156665

HBV-IN-37

HBV Infection

HBV-IN-37 is an inhibitor of HBV with an EC₅₀ value of 10 μM .

HBV-IN-38	HBV	Infection
HBV-IN-38 (Example 193) is an *HBV* DNA inhibitor (EC₅₀≤100nM). HBV-IN-38 can be used to study viral infections .

HBV-IN-36	HBV	Infection
HBV-IN-36 (compound 42) is a HBV inhibior (IC₅₀=2 μM), showing anti-HBV activity with EC₅₀ of 0.58 μM .

HBV-IN-37	HBV	Infection
HBV-IN-37 is an inhibitor of *HBV* with an EC₅₀ value of 10 μM .

HY-147863

HBV-IN-24	HBV	Infection Neurological Disease
HBV-IN-24 (compound (2ʹS, 6S)-1a) is a potent *HBV* inhibitor. HBV-IN-24 exhibits potent inhibition activity against HBV DNA, HBsAg, and HBeAg, with EC₅₀ values of 0.6, 0.6, and 4.6 nM, respectively. HBV-IN-24 shows excellent antiviral activity, could have improved neurotoxicity .

HY-145872

HBV-IN-20

HBV Infection

HBV-IN-20 is a potent and oral active HBV inhibitor with an EC₅₀ of 0.46 µM. HBV-IN-20 is a typical type II CpAM (core protein assembly modulators) .
HY-144320

HBV-IN-17

HBV Infection

HBV-IN-17 (compound 8) is a potent HBV capsid assembly modulator with an EC₅₀ of 511 nM .
HY-145049

HBV-IN-6

HBV Infection

HBV-IN-6 is a potent HBV inhibitor with an EC₅₀ of 44 nM (WO2021213445A1, compound 3) .
HY-145050

HBV-IN-7

HBV Infection

HBV-IN-7 is a potent HBV inhibitor with an EC₅₀ of 7 nM (WO2021213445A1, compound 5) .
HY-145051

HBV-IN-8

HBV Infection

HBV-IN-8 is a potent HBV inhibitor with an EC₅₀ of 287.9 nM (WO2021213445A1, compound 13) .
HY-156272

HBV-IN-41

HBV Infection

HBV-IN-41 (compound 45) is a potent and orally active Hepatitis B Virus (HBV) inhibitor, with an EC₅₀ of 0.027μM .

HBV-IN-20	HBV	Infection
HBV-IN-20 is a potent and oral active *HBV* inhibitor with an EC₅₀ of 0.46 µM. HBV-IN-20 is a typical type II CpAM (core protein assembly modulators) .

HBV-IN-17	HBV	Infection
HBV-IN-17 (compound 8) is a potent *HBV* capsid assembly modulator with an EC₅₀ of 511 nM .

HBV-IN-6	HBV	Infection
HBV-IN-6 is a potent *HBV* inhibitor with an EC₅₀ of 44 nM (WO2021213445A1, compound 3) .

HBV-IN-7	HBV	Infection
HBV-IN-7 is a potent *HBV* inhibitor with an EC₅₀ of 7 nM (WO2021213445A1, compound 5) .

HBV-IN-8	HBV	Infection
HBV-IN-8 is a potent *HBV* inhibitor with an EC₅₀ of 287.9 nM (WO2021213445A1, compound 13) .

HBV-IN-41	HBV	Infection
HBV-IN-41 (compound 45) is a potent and orally active Hepatitis B Virus (HBV) inhibitor, with an EC₅₀ of 0.027μM .

HY-145052

HBV-IN-9	HBV	Infection
HBV-IN-9 is a potent HBsAg (HBV Surface antigen) inhibitor (IC₅₀=10 nM) and HBV DNA production inhibitor (IC₅₀=0.15 nM in HepG2.2.15 cells) . From patent WO2018001952A1, example 20.

HY-P4051

HBV Seq1 aa:141-151

HBV Infection Inflammation/Immunology

HBV Seq1 aa:141-151 is a peptide. HBV Seq1 aa:141-151 can be used for the research of chronic hepatitis B virus (HBV) .
HY-P4049

HBV Seq1 aa:63-71

HBV Infection

HBV Seq1 aa:63-71 is the fragment of hepatitis B virus (HBV) .
HY-P4050

HBV Seq1 aa:18-27

HBV Infection

HBV Seq1 aa:18-27 is a hepatitis B virus (HBV) core antigen 18-27 peptide fragment .
HY-P4048

HBV Seq1 aa:93-100

HBV Infection

HBV Seq1 aa:93-100 is a hepatitis B virus (HBV) core antigen 93-100 peptide fragment .

HBV Seq1 aa:141-151	HBV	Infection Inflammation/Immunology
HBV Seq1 aa:141-151 is a peptide. HBV Seq1 aa:141-151 can be used for the research of chronic hepatitis B virus (HBV) .

HBV Seq1 aa:63-71	HBV	Infection
HBV Seq1 aa:63-71 is the fragment of hepatitis B virus (HBV) .

HBV Seq1 aa:18-27	HBV	Infection
HBV Seq1 aa:18-27 is a hepatitis B virus (HBV) core antigen 18-27 peptide fragment .

HBV Seq1 aa:93-100	HBV	Infection
HBV Seq1 aa:93-100 is a hepatitis B virus (HBV) core antigen 93-100 peptide fragment .

HY-P4046

HBV Seq2 aa:179-186	HIV	Inflammation/Immunology
HBV Seq2 aa:179-186 serve as effective motifs for CTL response in H-2b system after in vitro restimulation of the primed T cells. HBV Seq2 aa:179-186 is a novel epitope identified on the surface antigen of hepatitis B virus .

HY-P4044

HBV Seq2 aa:28-39

HBV Infection

HBV Seq2 aa:28-39 is a HBsAg peptide, which binds to major histocompatibility complex (MHC) class I molecules .
HY-P4045

HBV Seq2 aa:208-216

HBV Infection

HBV Seq2 aa:208-216, a HBsAg derived CD8 epitope peptide, is studied as part of Large envelope protein from Hepatitis B virus .

HBV Seq2 aa:28-39	HBV	Infection
HBV Seq2 aa:28-39 is a HBsAg peptide, which binds to major histocompatibility complex (MHC) class I molecules .

HBV Seq2 aa:208-216	HBV	Infection
HBV Seq2 aa:208-216, a HBsAg derived CD8 epitope peptide, is studied as part of Large envelope protein from Hepatitis B virus .

HY-145053A

*(5S,8R)-HBV-IN-10*	HBV	Infection
(5S,8R)-HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC₅₀ ≤0.05 μM). From patent WO2021204258A1, compound 6 .

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all *HBV* messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium	HBV	Infection
Bepirovirsen sodium is an antisense oligonucleotide targeting all *HBV* messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-N8153

Glycosmisic acid

HBV Infection Inflammation/Immunology

Glycosmisic acid, a natural compound, possesses anti-HBV activity .

HY-149357

Yhhu6669	HBV	Infection
Yhhu6669 is an anti-HBV agent. Yhhu6669 inhibits HBV DNA. Yhhu6669 inhibits HBV replication by inducing the formation of DNA-free capsids. Yhhu6669 decreases HBV DNA and HBcAg in AAV/HBV-infected mice. Yhhu6669 has favorable PK properties .

HY-W676876

Oxynitidine	HBV	Infection
Oxynitidine is an *HBV* inhibitor (ID₅₀=30.8 µg/mL), which can effectively inhibit the DNA replication activity of HBV. Oxynitidine can be used in the study of viral infections .

Cat. No.	Product Name	Target	Research Area

HY-P4051

HBV Seq1 aa:141-151

HBV Infection Inflammation/Immunology

HBV Seq1 aa:141-151 is a peptide. HBV Seq1 aa:141-151 can be used for the research of chronic hepatitis B virus (HBV) .
HY-P4049

HBV Seq1 aa:63-71

HBV Infection

HBV Seq1 aa:63-71 is the fragment of hepatitis B virus (HBV) .
HY-P4050

HBV Seq1 aa:18-27

HBV Infection

HBV Seq1 aa:18-27 is a hepatitis B virus (HBV) core antigen 18-27 peptide fragment .
HY-P4048

HBV Seq1 aa:93-100

HBV Infection

HBV Seq1 aa:93-100 is a hepatitis B virus (HBV) core antigen 93-100 peptide fragment .

HY-P4046

HBV Seq2 aa:179-186	HIV	Inflammation/Immunology
HBV Seq2 aa:179-186 serve as effective motifs for CTL response in H-2b system after in vitro restimulation of the primed T cells. HBV Seq2 aa:179-186 is a novel epitope identified on the surface antigen of hepatitis B virus .

HY-P4044

HBV Seq2 aa:28-39

HBV Infection

HBV Seq2 aa:28-39 is a HBsAg peptide, which binds to major histocompatibility complex (MHC) class I molecules .
HY-P4045

HBV Seq2 aa:208-216

HBV Infection

HBV Seq2 aa:208-216, a HBsAg derived CD8 epitope peptide, is studied as part of Large envelope protein from Hepatitis B virus .

HY-P3465

Bulevirtide Myrcludex B	HBV	Infection
Bulevirtide (Myrcludex B) is a NTCP inhibitor, a linear lipopeptide of 47 amino acids. Bulevirtide inhibits HBV and HDV entry into liver cells, blocks HBV infection in hepatocytes, and participates in HBV transcriptional suppression. Bulevirtide can be used in HDV infection and compensated cirrhosis research .

HY-P3601

Brain Derived Basic Fibroblast Growth Factor (1-24) FGF basic (1-24)	Bacterial HBV	Infection Inflammation/Immunology
Brain Derived Basic Fibroblast Growth Factor (1-24) (FGF basic 1-24) is a synthetic peptide, shows anti-bacterial and anti-HBV activities. Brain Derived Basic Fibroblast Growth Factor (1-24) can be used in infection disease and immune disease research .

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-N8153

Glycosmisic acid	Monophenols Classification of Application Fields Source classification Lignans Rubiaceae Phenols Phenylpropanoids Plants Gardenia jasminoides Ellis Disease Research Fields Inflammation/Immunology	HBV
Glycosmisic acid, a natural compound, possesses *anti-HBV* activity .

HY-W676876

Oxynitidine	Structural Classification Alkaloids Other Alkaloids Source classification Rutaceae Zanthoxylum nitidum (Roxb.) DC. Plants	HBV
Oxynitidine is an *HBV* inhibitor (ID₅₀=30.8 µg/mL), which can effectively inhibit the DNA replication activity of HBV. Oxynitidine can be used in the study of viral infections .

HY-N10404

Junceellolide C	Classification of Application Fields Animals Terpenoids Source classification Diterpenoids Inflammation/Immunology Disease Research Fields	HBV
Junceellolide C is a transcription inhibitor of cccDNA. Junceellolide C inhibits *HBV* DNA replication and significantly decreases the level of supernatant *HBV* RNA with EC₅₀ values of 5.19, 3.52 μM respectively in HepAD38 cells. Junceellolide C is a potent anti-HBV agent .

HY-N4168A

Neochlorogenic acid methyl ester 5-O-Caffeoylquinic acid methyl ester	Structural Classification Caprifoliaceae Lonicera japonica Thunb. Source classification Phenols Polyphenols Plants	HBV
Neochlorogenic acid methyl ester (5-O-Caffeoylquinic acid methyl ester) is an *HBV* inhibitor. Neochlorogenic acid methyl ester can be isolated from L. japonica flower buds with potent HBV inhibitory activity .

HY-N3609

Coclauril	Structural Classification Natural Products Cinnamomum subavenium Miq. Source classification Rhizophoraceae Bruguiera gymnorhiza (Linnaeus) Savigny Plants Lauraceae	HBV
Coclauril is an inhibitor of *HBV. Coclauril inhibits HBV* replication in the human hepatoblastoma cell line with an EC₅₀ of 7.6 μg/mL .

HY-N8168

LPRP-Et-97543	Infection Structural Classification Flavonoids Liliaceae Classification of Application Fields Source classification Phenols Polyphenols Plants Disease Research Fields Disporopsis aspera (Hua) Engl. Isoflavones	HBV
LPRP-Et-97543 is a potent *anti-HBV* agent. LPRP-Et-97543 reduces Core, S, and preS but not X promoter activities. LPRP-Et-97543 can be used for acute and chronic HBV infections research .

HY-N2882

Apigenin-4'-α-L-rhamnoside	Ranunculus sieboldii Miq. Structural Classification Flavonoids Flavones Source classification Ranunculaceae Plants	HBV
Apigenin-4'-α-L-rhamnoside is a potent inhibitor of *HBV. Apigenin-4'-α-L-rhamnoside inhibits the secretory level of HBV* surface antigen (HBsAg) in HepG2.2.15 cells .

HY-N0854

Alisol F	Infection Triterpenes Classification of Application Fields Terpenoids Source classification Alisma orinentale (Samuel.) Juz. Plants Alismataceae Disease Research Fields	HBV
Alisol F is a triterpene isolated from Alisma orinentale, has immunosuppressive and anti-virus functions. Alisol F exhibits inhibitory activity in vitro on hepatitis B virus (HBV) surface antigen (HBsAg) secretion of the HepG2.2.15 cell line with an IC₅₀ of 0.6 μM .

HY-126033

Sophoranol	Infection Alkaloids Piperidine Alkaloids Classification of Application Fields Leguminosae Source classification Plants Sophora flavescens Aiton Disease Research Fields	HBV RSV
Sophoranol is an alkaloid that can be isolated from S. flavescens, with antiviral activity. Sophoranol has anti-HBV (hepatitis B virus) activity. Sophoranol shows potent antiviral activities against respiratory syncytial virus (RSV) with an IC₅₀ of 10.4 μg/mL .

HY-133721

Chamaechromone	Flavonoids Classification of Application Fields Thymelaeaceae Source classification Phenols Polyphenols Plants Biflavones Disease Research Fields Inflammation/Immunology Stellera chamaejasme L.	HBV
Chamaechromone is a biflavonoid ingredient isolated from the roots of Stellera chamaejasme L. (Thymelaeaceae). Chamaechromone possesses anti-hepatitis B virus (HBV) effects against the surface antigen of HBV (HBsAg) secretion and has insecticidal activities .

HY-N12105

Dihydrodehydrodiconiferyl alcohol 9-O-β-D-xylopyranoside	Structural Classification Source classification Lignans Phenylpropanoids Plants Schisandraceae Illicium henryi Diels.	HBV
Dihydrodehydrodiconiferyl alcohol 9-O-β-D-xylopyranoside is an anti-hepatitis B virus (anti-HBV) agent. Dihydrodehydrodiconiferyl alcohol 9-O-β-D-xylopyranoside inhibits HBV surface antigen (HBsAg) and HBV e antigen (HBeAg) secretion on Hep G2.2.15 cell line, with IC₅₀ values of 1.67 and >2.15 mM, respectively .

HY-N2988

Schisanwilsonin C Arisanschinin K	Classification of Application Fields Source classification Lignans Phenylpropanoids Plants Schisandraceae Disease Research Fields Inflammation/Immunology Schisandra wilsoniana A. C. Smith	HBV
Schisanwilsonin C (Arisanschinin K) shows anti-HBV activity .

HY-N3861

Erythrocentaurin	Structural Classification Natural Products Gentiana macrophylla Pall. Source classification Gentianaceae Plants	HBV
Erythrocentaurin, a natural compound, is a new class of hepatitis B virus inhibitor .

HY-N12483

Catenulopyrizomicin A	Structural Classification Alkaloids Microorganisms Source classification Pyridine Alkaloids	HBV
Catenulopyrizomicin A has a thiazolyl pyridine moiety. Catenulopyrizomicin A can be isolated from the fermentation broth of rare actinomycete Catenuloplanes sp. Catenulopyrizomicin A has anti-Hepatitis B virus activity .

HY-N1323

Sanggenol P	Structural Classification Flavonoids Flavonones Source classification Plants Moraceae Morus alba Linn.	HBV
Sanggenol P, a flavonoid, shows *anti-HBV* activity on HepG2.2.15 cell line in vitro .

HY-N11792

Pedunculosumoside F	Structural Classification Flavonoids Source classification Ophioglossaceae Plants Other Flavonoids Ophioglossum reticulatum L.	Others
Pedunculosumoside F is a homoflavonoid glucoside. Pedunculosumoside F can be isolated from Ophioglossum pedunculosum. Pedunculosumoside F has cytotoxicity against HepG2 22.15 cells with CC₅₀ value of 56.7 μM without anti-HBV activity. While its analogs block HBsAg secretion in HBV-infected HepG2 2.2.15 cells .

HY-123336

Schisantherin C	Infection Classification of Application Fields Source classification Lignans Phenylpropanoids Plants Schisandraceae Disease Research Fields Schisandra chinensis (Turcz.) Baill.	HBV
Schisantherin C exhibits anti-HBV activity with potency against HBsAg and HBeAg secretion by 59.7% and 34.7% at 50μg/mL .

HY-N0054

Osthole 10+ Cited Publications Osthol; NSC 31868	Cardiovascular Disease Structural Classification Classification of Application Fields Source classification Coumarins Plants Biological Pesticide Research Agricultural Research Infection other families Phenylpropanoids Inflammation/Immunology Disease Research Fields Endocrinology	Histamine Receptor Apoptosis Parasite HBV
Osthole (Osthol) is a natural antihistamine alternative. Osthole may be a potential inhibitor of histamine H₁ receptor activity. Osthole also suppresses the secretion of *HBV* in cells.

HY-N0056

Isochlorogenic acid A 5+ Cited Publications 3,5-Dicaffeoylquinic acid; 3,5-CQA	Structural Classification Caprifoliaceae Classification of Application Fields Lonicera japonica Thunb. Ketones, Aldehydes, Acids Source classification Phenols Polyphenols Plants Endogenous metabolite Inflammation/Immunology Disease Research Fields	Reactive Oxygen Species HBV Endogenous Metabolite HIV Bacterial
Isochlorogenic acid A (3,5-Dicaffeoylquinic acid) is a natural phenolic acid with anti-mutagenicity, anti-HBV, anti-HIV, anti-oxidant, anti-bacterial, and anti-inflammatoryy activities .

HY-N0820

Catalpol 5+ Cited Publications Catalpinoside	Structural Classification Neurological Disease Classification of Application Fields Anti-aging Source classification Plants Rehmannia glutinosa (Gaert.) Libosch. ex Fisch. et Mey Infection Iridoids Terpenoids Scrophulariaceae Inflammation/Immunology Disease Research Fields Cancer	HBV
Catalpol (Catalpinoside), an iridoid glycoside found in Rehmannia glutinosa. Catalpol has neuroprotective, hypoglycemic, anti-inflammatory, anti-cancer, anti-spasmodic, anti-oxidant effects and anti-HBV effects .

HY-149048

Adenosylhomocysteinase SAHH; AHCY	Infection Structural Classification Natural Products Classification of Application Fields Source classification Metabolic Disease Endogenous metabolite Disease Research Fields	Endogenous Metabolite HBV
Adenosylhomocysteinase (SAHH; AHCY) is a highly conserved enzyme. Adenosylhomocysteinase reversible catalyzes S-adenosylhomocysteine (SAH) to adenosine and L-homocysteine. The serum exosomal Adenosylhomocysteinase level can be used as a prognostic biomarker in HBV-LC patients .

HY-B0255

Adefovir dipivoxil 1 Publications Verification GS 0840	Infection Structural Classification Natural Products Classification of Application Fields Source classification Endogenous metabolite Disease Research Fields Cancer	HBV Reverse Transcriptase Orthopoxvirus Endogenous Metabolite
Adefovir dipivoxil, an adenosine analogue, is an oral proagent of the nucleoside reverse transcriptase inhibitor Adefovir. Adefovir dipivoxil inhibits both the wild type and *HBV* Lamivudine-resistant strains . Adefovir dipivoxil shows anti-orthopoxvirus activity.

HY-N5086

Picroside IV	Structural Classification Neurological Disease Classification of Application Fields Source classification Metabolic Disease Plants Monophenols Iridoids Terpenoids Phenols Scrophulariaceae Picrorhiza scrophulariiflora Pennell Inflammation/Immunology Disease Research Fields	HBV
Picroside IV is an iridoid glycoside found in the underground parts of Picrorhiza scrophulariiflora. Picroside IV is a derivative of Catalpol (HY-N0820) . Catalpol has neuroprotective, hypoglycemic, anti-inflammatory, anti-cancer, anti-spasmodic, anti-oxidant effects and anti-HBV effects .

HY-N3093

Periglaucine B (+)-Periglaucine B	Structural Classification Alkaloids Pyrrole Alkaloids Source classification Pericampylus glaucus (Lam.) Merr. Plants Menispermaceae	HBV
Periglaucine B ((+)-Periglaucine B) is an alkaloid and an HBsAg inhibitor. Periglaucine B can be isolated from Pericampylus glaucus. Periglaucine B inhibits the secretion of hepatitis B virus (HBV) surface antigen (HBsAg) in Hep G2.2.15 cells with an IC₅₀ of 0.47 mM .

HY-N3239

Mulberrofuran G	Structural Classification Source classification Phenols Polyphenols Plants Moraceae Morus alba Linn.	NADPH Oxidase HBV
Mulberrofuran G protects ischemic injury-induced cell death via inhibition of NOX4-mediated ROS generation and ER stress . Mulberrofuran G shows moderate inhibiting activity of *hepatitis B virus (HBV)* DNA replication with IC₅₀ of 3.99 μM .

HY-N3094

Periglaucine A	Structural Classification Alkaloids Pyrrole Alkaloids Labiatae Source classification Plants Erigeron breviscapus (Vant.) Hand.-Mazz.	HBV HIV
Periglaucine A, a hasubanane-type alkaloid, can be isolated from Pericampylus glaucus. Periglaucine A can inhibits *HBV* surface antigen (HBsAg) secretion in Hep G2.2.15 cells. Periglaucine A also shows anti-HIV-1 activity in C8166 cells (EC₅₀: 204 μM) .

HY-B1192

Estradiol benzoate 10+ Cited Publications β-Estradiol 3-benzoate; 17β-Estradiol 3-benzoate	Classification of Application Fields Disease Research Fields Cancer	Estrogen Receptor/ERR HBV Bcl-2 Family
Estradiol benzoate (β-Estradiol 3-benzoate) is a HBx protein inhibitor and inhibits androgen and hepatitis B virus (HBV) transcription, replication. Estradiol benzoate shows antifertility effects, anti- Toxoplasma gondii activity and can improve memory behavior of Ovariectomy (Ovx) female mice .

HY-B0150

Nicotinamide Maximum Cited Publications 36 Publications Verification Niacinamide; Nicotinic acid amide	Alkaloids Structural Classification Human Gut Microbiota Metabolites Microorganisms Neurological Disease Classification of Application Fields Source classification Pyridine Alkaloids Endogenous metabolite Disease Research Fields Cancer	Organoid Endogenous Metabolite Sirtuin HBV
Nicotinamide is a form of vitamin B3 or niacin. Nicotinamide Hydrochloride inhibits SIRT2 activity (IC₅₀: 2 μM). Nicotinamide also inhibits SIRT1. Nicotinamide increases cellular NAD₊, ATP, ROS levels. Nicotinamide inhibits tumor growth and improves survival. Nicotinamide also has anti-HBV activity .

HY-N6939

Pseudolaric Acid B 1 Publications Verification	Infection Structural Classification Classification of Application Fields Pinaceae Terpenoids Diterpenoids Plants Inflammation/Immunology Disease Research Fields Cancer	HBV Fungal Apoptosis Autophagy Ferroptosis
Pseudolaric Acid B is a diterpene isolated from the root of Pseudolarix kaempferi (pinaceae), has anti-cancer, antifungal, and antifertile activities, and shows immunosuppressive activity on T lymphocytes . Pseudolaric Acid B inhibits hepatitis B virus *(HBV)* secretion through apoptosis and cell cycle arrest. Pseudolaric Acid B induces autophagy .

HY-107315

Alisol F 24-acetate	Triterpenes Structural Classification Alisma plantago-aquatica Linn. Terpenoids Source classification Plants Alismataceae	HBV Apoptosis
Alisol F 24-acetate is a triterpene compound that can be isolated from the rhizomes of Alisma orientalis. Alisol F 24-acetate inhibits the secretion of *HBV* surface antigen HBsAg and HBeAg with IC₅₀ values of 7.7 µM and 5.1 µM. Alisol F 24-acetate has proapoptotic activity and can be used for cancer research .

HY-N0639

Punicalin	Structural Classification Punica granatum L. Classification of Application Fields Source classification Phenols Polyphenols Punicaceae Plants Inflammation/Immunology Disease Research Fields	HBV Pyroptosis Carbonic Anhydrase
Punicalin is a species that can be isolated from the leaves of Punica granatum. Punicalin is an active molecule against hepatitis b virus (HBV). Punicalin can induce pyroptosis. Punicalin is a Carbonic anhydrase inhibitor. Punicalin blocks the binding of S-glycoprotein and ACE2 receptors. Pnuicalin has anti-inflammatory, antioxidant and antiviral activity .

HY-N12102

Dihydrodehydrodiconiferyl alcohol 9-O-α-L-rhamnopyranoside	Structural Classification Source classification Lignans Phenylpropanoids Plants Schisandraceae Illicium henryi Diels.	HBV
Dihydrodehydrodiconiferyl alcohol 9-O-α-L-rhamnopyranoside (compound 1) is a lignan with anti-HBC activity. Dihydrodehydrodiconiferyl alcohol 9-O-α-L-rhamnopyranoside targets HBV surface antigen with IC₅₀s of 0.58 mM (HBsAg) and >2.4 mM (HBeAg). Dihydrodehydrodiconiferyl alcohol 9-O-α-L-rhamnopyranoside can be isolated from star anise .

HY-N0063

Punicalagin 5 Publications Verification	Infection Structural Classification Punica granatum L. Classification of Application Fields Source classification Phenols Polyphenols Metabolic Disease Punicaceae Plants Disease Research Fields	SARS-CoV HBV
Punicalagin is a polyphenol ingredient isolated from Pomegranate (Punica granatum L.) or the leaves of Terminalia catappa L.. Punicalagin is a reversible and non-competitive 3CL ^pro inhibitor and inhibits SARS-CoV-2 replication in vitro. Punicalagin is an anti-hepatitis B virus (HBV) agent and has antioxidant, anti-inflammatory, and anticancer effects. Punicalagin has the potential for the research of COVID-19 .

HY-B0150R

Nicotinamide (Standard) Maximum Cited Publications 36 Publications Verification Niacinamide(Standard); Nicotinic acid amide (Standard)	Structural Classification Alkaloids Neurological Disease Classification of Application Fields Source classification Endogenous metabolite Disease Research Fields Cancer	Endogenous Metabolite Sirtuin
Nicotinamide (Standard) is the analytical standard of Nicotinamide. This product is intended for research and analytical applications. Nicotinamide is a form of vitamin B3 or niacin. Nicotinamide Hydrochloride inhibits SIRT2 activity (IC₅₀: 2 μM). Nicotinamide also inhibits SIRT1. Nicotinamide increases cellular NAD₊, ATP, ROS levels. Nicotinamide inhibits tumor growth and improves survival. Nicotinamide also has anti-HBV activity .

HY-N1365

Isoscopoletin 6-Hydroxy-7-methoxycoumarin	Structural Classification Classification of Application Fields Source classification Coumarins Plants Compositae Infection Monophenols other families Phenols Phenylpropanoids Disease Research Fields Sindora sumatrana Miq. Cancer	HBV
Isoscopoletin (6-Hydroxy-7-methoxycoumarin) is an active constituent in Artemisia argyi leaves. Isoscopoletin shows substantial inhibition against cell proliferation, with IC₅₀s of 4.0 μM and 1.6 μM for human CCRF-CEM leukaemia cells and multidrug resistant subline CEM/ADR5000, respectively . Isoscopoletin (6-Hydroxy-7-methoxycoumarin) possesses inhibitory activity against HBV replication .

Species:	Human (5) Virus (4)
Tag:	His (8) Tag Free (1) Avi (3)
Source:	HEK293 (3) E. coli Cell-free (3) P. pastoris (1) E. coli (2)

Cat. No.	Compare	Product Name	Species	Source

HY-P702076

	RBCK1 Protein, Human RBCK1; RanBP-type and C3HC4-type zinc finger-containing protein 1; HBV-associated factor 4; Heme-oxidized IRP2 ubiquitin ligase 1; HOIL-1; Hepatitis B virus X-associated protein 4; RING finger protein 54; RING-type E3 ubiquitin transferase HOIL-1; Ubiquitin-conjugating enzyme 7-interacting protein 3	Human	E. coli
	RBCK1 is an E3 ubiquitin protein ligase that cooperates with specific E2 enzymes such as UBE2L3/UBCM4 to transfer ubiquitin to substrates. It acts as an E3 ligase that oxidizes IREB2, relying on heme and oxygen for IREB2 ubiquitination. RBCK1 Protein, Human is the recombinant human-derived RBCK1 protein, expressed by E. coli , with tag free. The total length of RBCK1 Protein, Human is 509 a.a., .

HY-P702077

	RBCK1 Protein, Human (His) RBCK1; RanBP-type and C3HC4-type zinc finger-containing protein 1; HBV-associated factor 4; Heme-oxidized IRP2 ubiquitin ligase 1; HOIL-1; Hepatitis B virus X-associated protein 4; RING finger protein 54; RING-type E3 ubiquitin transferase HOIL-1; Ubiquitin-conjugating enzyme 7-interacting protein 3	Human	E. coli
	RBCK1 is an E3 ubiquitin protein ligase that cooperates with specific E2 enzymes such as UBE2L3/UBCM4 to transfer ubiquitin to substrates. It acts as an E3 ligase that oxidizes IREB2, relying on heme and oxygen for IREB2 ubiquitination. RBCK1 Protein, Human (His) is the recombinant human-derived RBCK1 protein, expressed by E. coli , with N-6*His labeled tag. The total length of RBCK1 Protein, Human (His) is 509 a.a., .

HY-P700912

	*HLA-A0201 HBV Complex Protein, Human (FLLTRILTI, HEK293, His-Avi)** hepatitis B virus	Human	HEK293
	HLA-A0201 MAGE-A4 Complex Protein, a member of the major histocompatibility complex (MHC) class I family, is highlighted. Additionally, the Chimeric HLA-A0201 WT-1 Complex Tetramer is recognized within the MHC class I family. HLA-A0201 HBV Complex Protein, Human (FLLTRILTI, HEK293, His-Avi) is a recombinant protein dimer complex containing human-derived HLA-A0201 HBV Complex protein, expressed by HEK293, with C-Avi, C-His labeled tag. HLA-A*0201 HBV Complex Protein, Human (FLLTRILTI, HEK293, His-Avi), has molecular weight of 52-62 kDa.

HY-P700911

	*HLA-A0201 HBV Complex Protein, Human (Biotinylated, FLLTRILTI, HEK293, His-Avi)** hepatitis B virus	Human	HEK293
	HLA-A0201 MAGE-A4 Complex Protein, a member of the major histocompatibility complex (MHC) class I family, is highlighted. Additionally, the Chimeric HLA-A0201 WT-1 Complex Tetramer is recognized within the MHC class I family. HLA-A0201 HBV Complex Protein, Human (Biotinylated, FLLTRILTI, HEK293, His-Avi) is a recombinant protein dimer complex containing human-derived HLA-A0201 HBV Complex protein, expressed by HEK293, with C-Avi, C-His labeled tag. HLA-A*0201 HBV Complex Protein, Human (Biotinylated, FLLTRILTI, HEK293, His-Avi), has molecular weight of 52-62 kDa.

HY-P700913

	*HLA-A0201 HBV Complex Tetramer Protein, Human (FLLTRILTI, HEK293, His-Avi)** hepatitis B virus	Human	HEK293
	HLA-A0201 MAGE-A4 Complex Protein, a member of the major histocompatibility complex (MHC) class I family, is highlighted. Additionally, the Chimeric HLA-A0201 WT-1 Complex Tetramer is recognized within the MHC class I family. HLA-A0201 HBV Complex Tetramer Protein, Human (FLLTRILTI, HEK293, His-Avi) is a recombinant protein dimer complex containing human-derived HLA-A0201 HBV Complex Tetramer protein, expressed by HEK293, with C-Avi, C-His labeled tag. HLA-A*0201 HBV Complex Tetramer Protein, Human (FLLTRILTI, HEK293, His-Avi), has molecular weight of 260-265 kDa.

HY-P702356

	*Large envelope Protein, HBV-D (Cell-Free, His)* Large envelope protein; L glycoprotein; L-HBsAg; LHB; Large S protein; Large surface protein; Major surface antigen	Virus	E. coli Cell-free
	The large envelope protein has two conformations: “external” (Le-HBsAg) and “internal” (Li-HBsAg). In its external state, it mediates viral attachment, initiates infection, determines species specificity, and promotes viral particle internalization via caveolin-mediated endocytosis. Large envelope Protein, HBV-D (Cell-Free, His) is the recombinant Virus-derived Large envelope protein, expressed by E. coli Cell-free , with N-10*His labeled tag. The total length of Large envelope Protein, HBV-D (Cell-Free, His) is 388 a.a., with molecular weight of Monomer:40 kDa Dimer:80 kDa.

HY-P702354

	*Large envelope Protein, HBV-A (Cell-Free, P03141, His)* Large envelope protein; L glycoprotein; L-HBsAg; LHB; Large S protein; Large surface protein; Major surface antigen	Virus	E. coli Cell-free
	The large envelope protein exhibits two topological conformations: “external” (Le-HBsAg) and “internal” (Li-HBsAg). In the external state, it attaches the virus to cellular receptors, initiating infection and determining liver tropism. Large envelope Protein, HBV-A (Cell-Free, P03141, His) is the recombinant Virus-derived Large envelope protein, expressed by E. coli Cell-free , with N-10*His labeled tag. The total length of Large envelope Protein, HBV-A (Cell-Free, P03141, His) is 399 a.a., with molecular weight of 45.1 kDa.

HY-P702355

	*Large envelope Protein, HBV-A (Cell-Free, P17101, His)* Large envelope protein; L glycoprotein; L-HBsAg; LHB; Large S protein; Large surface protein; Major surface antigen	Virus	E. coli Cell-free
	Large envelope proteins exist in two topological conformations: “external” (Le-HBsAg) and “internal” (Li-HBsAg). In its external state, it mediates viral attachment to cellular receptors, initiates infection, determines species specificity, and promotes viral particle internalization via caveolin-mediated endocytosis. Large envelope Protein, HBV-A (Cell-Free, P17101, His) is the recombinant Virus-derived Large envelope protein, expressed by E. coli Cell-free , with N-10*His labeled tag. The total length of Large envelope Protein, HBV-A (Cell-Free, P17101, His) is 399 a.a., with molecular weight of 45.1 kDa.

HY-P702559

	*Large envelope Protein, HBV-C (P.pastoris, 180a.a, His)* S; Large envelope protein; L glycoprotein; L-HBsAg; LHB; Large S protein; Large surface protein; Major surface antigen	Virus	P. pastoris
	The large envelope protein is crucial in its two conformations, "outside" (Le-HBsAg) and "inside" (Li-HBsAg). Externally, it binds the virus to cellular receptors, initiates infection, determines species specificity, and promotes viral particle internalization via caveolin-mediated endocytosis. Large envelope Protein, HBV-C (P.pastoris, 180a.a, His) is the recombinant Virus-derived Large envelope protein, expressed by P. pastoris , with N-6*His labeled tag. The total length of Large envelope Protein, HBV-C (P.pastoris, 180a.a, His) is 180 a.a., with molecular weight of 20.9 kDa.

Cat. No.	Product Name	Chemical Structure

HY-113904S

(Rac)-Tenofovir-d6

(Rac)-Tenofovir-d₆ is a labelled racemic Tenofovir. Tenofovir (GS 1278) is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B (HBV)[1].

HY-B1826S2

Adefovir-d4
Adefovir-d₄ is the deuterium labeled Adefovir. Adefovir (GS-0393) is an adenosine monophosphate analog antiviral agent that after intracellular conversion to Adefovir diphosphate inhibits HBV DNA polymerase. Adefovir has an IC50 of 0.7 μM against HBV in the HepG2.2.15 cell line. Adefovir has good antiviral activity against several viruses, including HBV and herpesviruses[1][2][3].

HY-156703S

HBV-IN-39-d3

HBV-IN-39-d3 (Example 14) is a deuterated HBV-IN-39 (Example 13). HBV-IN-39 is an HBV inhibitor. HBV-IN-39-d3 has better oral bioavailability than HBV-IN-39 .
HY-13623S

Entecavir-d2

Entecavir-d₂ is the deuterium labeled Entecavir. Entecavir (SQ 34676; BMS 200475) is a potent and selective inhibitor of HBV, with an EC50 of 3.75 nM in HepG2 cell.

HY-B0017S

Telbivudine-d4
Telbivudine-d₄ is deuterium labeled Telbivudine. Telbivudine (Epavudine), an orally active thymidine nucleoside analog, is a potent antiviral inhibitor of hepatitis B virus (HBV) replication[1].

HY-13623S1

Entecavir-13C2,15N
Entecavir- ¹³C₂, ¹⁵N (BMS200475- ¹³C₂, ¹⁵N; SQ34676- ¹³C₂, ¹⁵N) is a ¹³C- and ¹⁵N-labeled Entecavir (HY-13623). Entecavir (SQ 34676; BMS 200475) is a potent and selective inhibitor of *HBV, with an EC₅₀* of 3.75 nM in HepG2 cell.

HY-135330

Lamivudine-13C,15N2
Lamivudine- ¹³C, ¹⁵N₂ is a labelled impurity of Lamivudine (BCH-189). Lamivudine is a nucleoside reverse transcriptase inhibitors (NRTIs), and can inhibit HIV reverse transcriptase 1/2 and the reverse transcriptase of hepatitis B virus .

HY-B0250S1

Lamivudine-13C,15N2,d2
Lamivudine-13C,15N2,d2 (BCH-189-13C,15N2,d2) is a 13C, 15N, and deuterium labeled Lamivudine (HY-B0250). Lamivudine is an orally active and blood-brain barrier permeable nucleoside reverse transcriptase inhibitor (NRTI). Lamivudine inhibits HIV reverse transcriptase 1 and 2 and hepatitis B virus (HBV) reverse transcriptase .

Cat. No.	Product Name		Classification

HY-19314A

Azvudine hydrochloride RO-0622 hydrochloride; FNC hydrochloride		Azide
Azvudine (RO-0622) hydrochloride is a potent nucleoside reverse transcriptase inhibitor (NRTI), with antiviral activity on HIV, *HBV* and HCV. Azvudine hydrochloride exerts highly potent inhibition on HIV-1 (EC₅₀s ranging from 0.03 to 6.92 nM) and HIV-2 (EC₅₀s ranging from 0.018 to 0.025 nM). Azvudine hydrochloride inhibits NRTI-resistant viral strains . Azvudine (hydrochloride) is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. Strain-promoted alkyne-azide cycloaddition (SPAAC) can also occur with molecules containing DBCO or BCN groups.

HY-19314

Azvudine RO-0622; FNC		Azide
Azvudine (RO-0622) is a potent nucleoside reverse transcriptase inhibitor (NRTI), with antiviral activity on HIV, *HBV* and HCV. Azvudine exerts highly potent inhibition on HIV-1 (EC₅₀s ranging from 0.03 to 6.92 nM) and HIV-2 (EC₅₀s ranging from 0.018 to 0.025 nM). Azvudine inhibits NRTI-resistant viral strains . Azvudine is a click chemistry reagent, itcontains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. Strain-promoted alkyne-azide cycloaddition (SPAAC) can also occur with molecules containing DBCO or BCN groups.

HY-124614

GLP-26 1 Publications Verification		Alkynes
GLP-26 is a *HBV* capsid assembly modulators (CAM), inhibits HBV DNA replication in Hep AD38 system (IC₅₀=3 nM), and reduces cccDNA by >90% at 1 μM. GLP-26 disrupts the encapsidation of pre-genomic RNA, causes nucleocapsid disassembly and reduces cccDNA pools . GLP-26 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

HY-139262

FNC-TP		Azide
FNC-TP is the intracellular active form of FNC. FNC is a potent nucleoside reverse transcriptase inhibitor (NRTI), with antiviral activity on HIV, *HBV* and HCV . FNC-TP is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. Strain-promoted alkyne-azide cycloaddition (SPAAC) can also occur with molecules containing DBCO or BCN groups.

HY-139262A

FNC-TP trisodium		Azide
FNC-TP trisodium is the intracellular active form of FNC. FNC is a potent nucleoside reverse transcriptase inhibitor (NRTI), with antiviral activity on HIV, *HBV* and HCV . FNC-TP (trisodium) is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. Strain-promoted alkyne-azide cycloaddition (SPAAC) can also occur with molecules containing DBCO or BCN groups.

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:


Products	In-stock - + Add to Cart
Cat. No.
Species
Source
Tag
Accession
Gene ID
Molecular Weight
Purity
Endotoxin Level
Biological Activity
Appearance
Formulation
Storage & Stability
Shipping
Free Sample	Yes No
Size	* This product has been "discontinued". Optimized version of product available: / In-stock - + Add to Cart Get quote

HBV

Inhibitors & Agonists

Screening Libraries

Peptides

Inhibitory Antibodies

NaturalProducts

Recombinant Proteins

Isotope-Labeled Compounds

Antibodies

Click Chemistry

Natural
Products