1. Search Result
Search Result
Targets Recommended: DNA/RNA Synthesis
Results for "

RNA

" in MCE Product Catalog:

374

Inhibitors & Agonists

6

Screening Libraries

17

Dye Reagents

8

Biochemical Assay Reagents

6

Peptides

3

MCE Kits

67

Natural
Products

12

Recombinant Proteins

24

Isotope-Labeled Compounds

Cat. No. Product Name Target Research Areas
  • HY-147916
    RNA polymerase II-IN-1

    DNA/RNA Synthesis Cancer
    RNA polymerase II-IN-1 (compound 19iv) is a amatoxin, inhibiting RNA polymerase II (Pol II) with an IC50 value of 36.66 nM. RNA polymerase II-IN-1 has higher cytotoxicity against cancer cells and less toxic in normal cells than α-Amanitin.
  • HY-147917
    RNA polymerase II-IN-2

    DNA/RNA Synthesis Cancer
    RNA polymerase II-IN-2 (compound 20iii) is a potent RNA polymerase II (Pol II) inhibitor with Ki value of 9.5 nM. RNA polymerase II-IN-2 has cytotoxicity against cancer cells, and exhibits 2 and 5 fold toxicity than α-amanitin against CHO and HEK293.
  • HY-115755
    Thio-ITP

    6-Thioinosine 5′-triphosphate; 6-Mercaptopurine-riboside-5'-triphosphate; 6-Thio-ITP

    DNA/RNA Synthesis Cancer
    Thio-ITP (6-Thioinosine 5′-triphosphate) is an RNA polymerase activity competitive inhibitor. Thio-ITP has a high apparent affinity for the polymerases (RNA polymerase I Ki: 40.9 μM; RNA polymerase II Ki: 38.0 μM).
  • HY-113138
    3-Methyluridine

    N3-Methyluridine

    Endogenous Metabolite Others
    3-Methyluridine (N3-Methyluridine) is a modified RNA nucleoside. 3-Methyluridine is often presents as RNA modification which can be detected in 23S rRNA of archaea, 16S and 23S rRNA of eubacteria, and 18S, 25S, and 28S of eukaryotic ribosomal RNAs.
  • HY-W011834
    2'-O-Methylcytidine

    HCV Infection
    2'-O-Methylcytidine is a 2'-substituted nucleoside as a inhibitor of HCV replication. 2'-O-Methylcytidine inhibits RNA-dependent RNA polymerase (NS5B)-catalyzed RNA synthesis in vitro, in a manner that is competitive with substrate nucleoside triphosphate.
  • HY-139100B
    N7-Methyl-guanosine-5'-triphosphate-5'-adenosine diammonium

    m7GpppA diammonium

    DNA/RNA Synthesis Infection
    N7-Methyl-guanosine-5'-triphosphate-5'-adenosine (m7GpppA) diammonium is a dinucleotide cap analog that can be used for in vitro RNA transcription.
  • HY-W091784
    3'-O-Methylguanosine

    Endogenous Metabolite Orthopoxvirus Nucleoside Antimetabolite/Analog Infection
    3'-O-Methylguanosine is a methylated nucleoside analogs and a RNA chain terminator. 3'-O-methylguanosine can inhibit early virus-specific RNA synthesis.
  • HY-147217
    Bepirovirsen

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
  • HY-B0958
    Mupirocin

    BRL-4910A; Pseudomonic acid

    Bacterial Antibiotic Infection
    Mupirocin (BRL-4910A, Pseudomonic acid) is an orally active antibiotic isolated from Pseudomonas fluorescens. Mupirocin apparently exerts its antimicrobial activity by reversibly inhibiting isoleucyl-transfer RNA, thereby inhibiting bacterial protein and RNA synthesis.
  • HY-16200
    Ethynylcytidine

    ECyD; TAS-106; 3'-C-Ethynylcytidine

    DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Cancer
    Ethynylcytidine (ECyD), a nucleoside analog and a potent inhibitor of RNA synthesis, inhibits RNA polymerases I, II and II. Ethynylcytidine has robust antitumor activity in a wide range of models of cancer.
  • HY-122337
    Streptolydigin

    Portamycin

    DNA/RNA Synthesis Bacterial Infection
    Streptolydigin (Portamycin) is a 3-acetyltetramic acid antibiotic and a potent bacterial RNA polymerase inhibitor with a Ki of 18 μM and a Kd of 15 μM. Streptolydigin inhibits RNA synthesis by binding to RNA polymerase and does not inhibit eukaryotic RNA polymerases. Streptolydigin possess potent antibacterial activity, particularly against anaerobes and some Gram-positive aerobes.
  • HY-139442
    RdRP-IN-2

    SARS-CoV Infection
    RdRP-IN-2 is a RNA dependent RNA polymerase (RdRp) inhibitor. RdRP-IN-2 significantly inhibits SARS-CoV-2 RdRp with an IC50 of 41.2 µM.RdRP-IN-2 also inhibits Feline coronavirus (FIPV) replication.
  • HY-N7068
    Mupirocin calcium hydrate

    BRL-4910A calcium hydrate; Pseudomonic acid calcium hydrate

    Bacterial Antibiotic Infection Inflammation/Immunology
    Mupirocin (BRL-4910A, Pseudomonic acid) calcium hydrate is an orally active antibiotic isolated from Pseudomonas fluorescens. Mupirocin calcium hydrate apparently exerts its antimicrobial activity by reversibly inhibiting isoleucyl-transfer RNA, thereby inhibiting bacterial protein and RNA synthesis.
  • HY-B0958A
    Mupirocin calcium

    BRL-4910A calcium; Pseudomonic acid calcium

    Antibiotic Bacterial Infection
    Mupirocin (BRL-4910A, Pseudomonic acid) calcium is an orally active antibiotic isolated from Pseudomonas fluorescens. Mupirocin calcium apparently exerts its antimicrobial activity by reversibly inhibiting isoleucyl-transfer RNA, thereby inhibiting bacterial protein and RNA synthesis.
  • HY-147412
    Ultevursen

    QR-421a

    Others Others
    Ultevursen (QR-421a) is a single-stranded RNA based oligonucleotide that is designed to skip exon 13 in the RNA with the aim to stop vision loss in people that have retinitis pigmentosa due to a mutation in exon 13 of the USH2A gene (encoding usherin). Ultevursen sequence: (P-thio)[2′-O-(2-methoxyethyl)](A-G-m 5C-m 5U-m 5U-m 5C-G-G-A-G-A-A-A-m 5U-m 5U-m 5U-A-A-A-m 5U-m 5C) (ACI).
  • HY-146382
    WRNA10

    HIV Inflammation/Immunology
    WRNA10 is a potent HIV-1 TAR RNA binder with an IC50 of 10 µM and an CC50 of 40 µM.
  • HY-145442
    8-Azanebularine

    Others Others
    8-Azanebularine, a compound with hydrogen in place of the C6 amino group, inhibits the ADAR2 reaction at high concentrations (IC50=15 mM). 8-Azanebularine is incorporated into an RNA structure recognized by human ADAR2 results in high-affinity binding (KD=2 nM). 8-Azanebularine can be used for the research of ADAR-catalyzed RNA-editing reaction.
  • HY-132607
    MTL-CEBPA

    MicroRNA Cancer Inflammation/Immunology
    MTL-CEPBA is a small activating RNA targeting for upregulation of C/EBPα. MTL-CEPBA has anti-inflammatory and anti-cancer activity.
  • HY-135780
    3'-Deoxyuridine-5'-triphosphate

    3'-dUTP

    Nucleoside Antimetabolite/Analog DNA/RNA Synthesis Endogenous Metabolite Metabolic Disease
    3'-Deoxyuridine-5'-triphosphate (3'-dUTP) is a nucleotide analogue that inhibits DNA-dependent RNA polymerases I and II. 3'-Deoxyuridine-5'-triphosphate strongly and competitively inhibits the incorporations of UTP into RNA with a Ki value of 2.0 μM.
  • HY-B0158
    Cytidine

    Cytosine β-D-riboside; Cytosine-1-β-D-ribofuranoside

    Nucleoside Antimetabolite/Analog Endogenous Metabolite Neurological Disease
    Cytidine is a pyrimidine nucleoside and acts as a component of RNA. Cytidine is a precursor of uridine. Cytidine controls neuronal-glial glutamate cycling, affecting cerebral phospholipid metabolism, catecholamine synthesis, and mitochondrial function.
  • HY-145975
    m7Gpppm6AmpG

    DNA/RNA Synthesis Others
    m7Gpppm6AmpG is a trinucleotide mRNA 5’ cap analogs. m7Gpppm6AmpG can be used for RNA synthesis in vitro.
  • HY-147885
    HCV-IN-41

    HCV Infection
    HCV-IN-41 (compound 4) is a highly potent hepatitis C virus (HCV) inhibitor with an EC50 value of 0.006762 nM, 5.183 nM, 1.365 nM and 142.2 nM for HCV genotype 1b, 2a, 3a and 4a, respectively. HCV-IN-41 reduces HCV RNA replication.
  • HY-75800
    Lomibuvir

    VX-222

    DNA/RNA Synthesis HCV Infection
    Lomibuvir (VX-222), a selective, non-nucleoside polymerase inhibitor, targets thumb pocket 2 of the HCV NS5B polymerase (RdRp) with a Kd of 17 nM. Lomibuvir inhibits the 1b/Con1 HCV subgenomic replicon with an EC50 of 5.2 nM. Lomibuvir preferentially inhibits elongative RNA synthesis rather than de novo-initiated RNA synthesis.
  • HY-W008990
    Xanthosine 5'-monophosphate sodium salt

    5'-Xanthylic acid sodium salt

    Others Metabolic Disease
    Xanthosine 5'-monophosphate sodium salt (5'-Xanthylic acid sodium salt) is an intermediate in purine metabolism. Xanthosine 5'-monophosphate sodium salt can be used for genetic code, nucleic acid structure, and DNA, RNA and protein synthesis research.
  • HY-13998A
    Dasabuvir sodium

    ABT-333 sodium

    HCV DNA/RNA Synthesis Infection
    Dasabuvir (ABT-333) sodium is a nonnucleoside hepatitis C virus (HCV) polymerase inhibitor. Dasabuvir sodium inhibits RNA-dependent RNA polymerase encoded by the HCV NS5B gene. Dasabuvir sodium inhibits genotype 1a (strain H77) and 1b (strain Con1) replicons, with EC50 values of 7.7 and 1.8 nM, respectively.
  • HY-13998
    Dasabuvir

    ABT-333

    HCV DNA/RNA Synthesis Infection
    Dasabuvir (ABT-333) is a nonnucleoside hepatitis C virus (HCV) polymerase inhibitor. Dasabuvir inhibits RNA-dependent RNA polymerase encoded by the HCV NS5B gene. Dasabuvir inhibits genotype 1a (strain H77) and 1b (strain Con1) replicons, with EC50 values of 7.7 and 1.8 nM, respectively.
  • HY-130803
    5-Methyl-5,6-dihydrouridine

    Others Cancer
    5-Methyl-5,6-dihydrouridine is a minor constituent in the chromosomal RNA of the rat ascites tumor. 5-Methyl-5,6-dihydrouridine can be used for nucleic acid modification.
  • HY-139912
    Biotin-aniline

    Others Others
    Biotin-aniline is a probe with substantially high reactivity towards RNA and DNA. Biotin-aniline emerges as more efficient probe for capturing subcellular transcriptome in living cells with high spatial specificity.
  • HY-126327
    UNC4976

    Histone Methyltransferase Cancer
    UNC4976 is a positive allosteric modulator (PAM) peptidomimetic of CBX7 chromodomain binding to nucleic acids. UNC4976 simultaneously antagonizes H3K27me3-specific recruitment of CBX7 to target genes while increasing non-specific binding to DNA and RNA.
  • HY-145443
    Fludarabine-Cl

    Others Cancer
    Fludarabine-Cl has inhibition effect on RNA adenosine deaminase 1(ADAR1), and can be used for preventing and/or treating cancer or tumor-related diseases.
  • HY-143220
    SS(no Galnac)-Inclisiran

    Others Cardiovascular Disease
    SS(no Galnac)-Inclisiran is a single stran Inclisiran with no GalNAc. Inclisiran is a double-stranded small interfering RNA (siRNA) molecule that inhibits the transcription of PCSK-9.
  • HY-23789
    2′-O-(2-Methoxyethyl)guanosine

    2'-O-MOE-rG

    Nucleoside Antimetabolite/Analog Others
    2′-O-(2-Methoxyethyl)guanosine (2'-O-MOE-rG), a 2′-O-methoxyethyl-modified nucleoside, can be produced by enzymatic conversion (adenosine deaminase) from 2′-O-(2-methoxyethyl)-2,6-diaminopurine riboside. 2′-O-(2-Methoxyethyl)guanosine neither effectively phosphorylated by cytosolic nucleoside kinases, nor are they incorporated into cellular DNA or RNA.
  • HY-125930A
    T-2513 hydrochloride

    Topoisomerase DNA/RNA Synthesis Cancer
    T-2513 hydrochloride is a selective topoisomerase I inhibitor. T-2513 hydrochloride binds covalently to and stabilizes the topoisomerase I-DNA complex and inhibits DNA replication and RNA synthesis, ultimately leading to cell death.
  • HY-125930
    T-2513

    Topoisomerase DNA/RNA Synthesis Cancer
    T-2513 is a selective topoisomerase I inhibitor. T-2513 binds covalently to and stabilizes the topoisomerase I-DNA complex and inhibits DNA replication and RNA synthesis, ultimately leading to cell death.
  • HY-126113
    KIN101

    Influenza Virus HCV Infection
    KIN101 is a potent RNA viral inhibitor with IC50s of 2 μM, >5 μM for influenza virus and Dengue virus (DNV), respectively. KIN101, an isoflavone agonist of IRF-3 dependent signaling, induces IRF-3 nuclear translocation. KIN101 has broad-spectrum activity against RNA viruses.
  • HY-W008915
    Cytidine 5'-diphosphate trisodium salt

    CDP

    DNA/RNA Synthesis Metabolic Disease
    Cytidine 5'-diphosphate trisodium salt (CDP) is produced by the transfer of phosphoryl group from ATP to cytidine monophosphate (CMP) catalyzed by uridine monophosphate kinase (UMPK). Cytidine 5′-diphosphate can be used to produce Cytidine triphosphate (CTP) for synthesis of DNA and RNA.
  • HY-D0841
    Guanidine thiocyanate

    GTC

    Endogenous Metabolite Others
    Guanidine thiocyanate is a chaotropic agent. Guanidine thiocyanate can be used as a protein denaturant and a nucleic acid protector in the extraction of DNA and RNA from cells.
  • HY-19743
    Triazavirin

    Nucleoside Antimetabolite/Analog Influenza Virus DNA/RNA Synthesis Infection
    Triazavirin is a nucleoside analogue of nucleic acid and an antiviral agent. Triazavirin works by inhibiting the synthesis of viral RNA and DNA and replication of genomic fragments. Triazavirin is also an effective protective agent on the transmission stage of influenza.
  • HY-D1020
    7-Aminoactinomycin D

    7-AAD

    DNA/RNA Synthesis Bacterial Antibiotic Cancer Infection
    7-Aminoactinomycin D (7-AAD) a fluorescent DNA stain, is a potent RNA polymerase inhibitor. 7-Aminoactinomycin D selectively binds to GC regions of the DNA. 7-Aminoactinomycin D also has antibacterial effects.
  • HY-146361
    Influenza A virus-IN-7

    Influenza Virus Inflammation/Immunology
    Influenza A virus-IN-7 (compound 16r) is a potent and orally active influenza A virus inhibitor with an IC50 of 3.43 µM and CC50 of >100 µM. Influenza A virus-IN-7 shows anti-IAV activity with low cytotoxicity. Influenza A virus-IN-7 inhibits the transcription and replication of viral RNA.
  • HY-10241
    Simeprevir

    TMC435; TMC435350

    HCV HCV Protease SARS-CoV DNA/RNA Synthesis Infection
    Simeprevir (TMC435; TMC435350) is an oral, potent and highly specific hepatitis C virus (HCV) NS3/4A protease inhibitor with a Ki of 0.36 nM. Simeprevir inhibits HCV replication with an EC50 of 7.8 nM. Simeprevir also potently suppresses SARS-CoV-2 replication and synergizes with Remdesivir. Simeprevir inhibits the main protease (M pro) and the RNA-dependent RNA polymerase (RdRp) of SARS-CoV-2, and also modulates host immune responses.
  • HY-10241A
    Simeprevir sodium

    TMC435 sodium; TMC435350 sodium

    HCV HCV Protease SARS-CoV DNA/RNA Synthesis Infection
    Simeprevir (TMC435; TMC435350) sodium is an oral, potent and highly specific hepatitis C virus (HCV) NS3/4A protease inhibitor with a Ki of 0.36 nM. Simeprevir sodium inhibits HCV replication with an EC50 of 7.8 nM. Simeprevir sodium also potently suppresses SARS-CoV-2 replication and synergizes with Remdesivir. Simeprevir sodium inhibits the main protease (M pro) and the RNA-dependent RNA polymerase (RdRp) of SARS-CoV-2, and also modulates host immune responses.
  • HY-12484
    BMH-21

    DNA/RNA Synthesis Cancer
    BMH-21 is a first-in-class DNA intercalator which inhibits RNA polymerase I (Pol I) transcription. BMH-21 possesses anticancer activity.
  • HY-W004056
    4-Methoxyphenethyl alcohol

    DNA/RNA Synthesis Bacterial Infection
    4-Methoxyphenethyl alcohol, an aromatic alcohol, is the major component in the anise-like odour produced by A. albispathus Hett. 4-Methoxyphenethyl alcohol can inhibits the protein, RNA and DNA synthesis in Escherichia coli.
  • HY-16750
    Radalbuvir

    GS-9669

    HCV Infection
    Radalbuvir (GS-9669) is a non-nucleoside inhibitor of nonstructural protein 5B (NS5B) RNA-dependent RNA polymerase (RdRp). Radalbuvir shows strong anti-HCV potency (GT1a intrinsic EC50 = 2.9 nM, GT1b EC50 = 6 nM).
  • HY-132595
    Teprasiran

    QPI-1002

    MDM-2/p53 Cancer
    Teprasiran (QPI-1002) is a small interfering RNA that temporarily inhibits p53-mediated cell death that underlies acute kidney injury (AKI).
  • HY-12824
    RNPA1000

    Antibiotic Bacterial Infection
    RNPA1000, an antibiotic, is a potent RnpA inhibitor and inhibits RnpA-mediated cellular RNA degradation. RNPA1000 inhibits tRNA maturation with an IC50 of 175 μM. RNPA1000 displays broad-spectrum antimicrobial activities and inhibits staphylococcal and all Gram-positive bacterial pathogens activity.
  • HY-131800
    3'-Deoxy-3'-amino-ATP

    Others Metabolic Disease
    3'-Deoxy-3'-amino-ATP, an ATP analogue, is a potent and competitive inhibitor of ATP, with a Ki of 2.3 μM. 3'-Deoxy-3'-amino-ATP can be used to synthesis of 3′-Amino-3′-deoxy transfer RNA by incorporation into the 3' terminus of tRNA-C-C.
  • HY-D1411
    DMTr-4'-CF3-5-Me-U-CED phosphoramidite

    DMTr-4'-CF3-5-Methyluridine-CED phosphoramidite

    Others Others
    DMTr-4'-CF3-5-Me-U-CED phosphoramidite (DMTr-4'-CF3-5-Methyluridine-CED phosphoramidite), the modified oligodeoxynucleotide (ODN), is a dye reagent for oligonucleotide labeling, can be used for the research of applications in RNA therapeutics.
  • HY-N0157
    Orotic acid

    6-Carboxyuracil; Vitamin B13

    Nucleoside Antimetabolite/Analog Endogenous Metabolite Metabolic Disease
    Orotic acid (6-Carboxyuracil), a precursor in biosynthesis of pyrimidine nucleotides and RNA, is released from the mitochondrial dihydroorotate dehydrogenase (DHODH) for conversion to UMP by the cytoplasmic UMP synthase enzyme. Orotic acid is a marker for measurement in routine newborn screening for urea cycle disorders. Orotic acid can induce hepatic steatosis and hepatomegaly in rats.
  • HY-N0157A
    Orotic acid zinc

    Nucleoside Antimetabolite/Analog Endogenous Metabolite Metabolic Disease
    Orotic acid (zinc), a precursor in biosynthesis of pyrimidine nucleotides and RNA, is released from the mitochondrial dihydroorotate dehydrogenase (DHODH) for conversion to UMP by the cytoplasmic UMP synthase enzyme. Orotic acid (zinc) is a marker for measurement in routine newborn screening for urea cycle disorders. Orotic acid (zinc) can induce hepatic steatosis and hepatomegaly in rats.
  • HY-115929
    DENV-IN-4

    DNA/RNA Synthesis Infection
    DENV-IN-4 is a potent DENV inhibitor (DENV EC50=4.79 μM, Vero CC50>100 μM, SI>20.9). DENV-IN-4 can inhibit the expression level of DENV2 with concentration-dependence and reduce RNA-dependent RNA polymerase (RdRp) enzymatic activity. DENV-IN-4 has antiviral effect.
  • HY-131081
    γ-Amanitin

    DNA/RNA Synthesis ADC Cytotoxin Cancer
    γ-Amanitin an ADC cytotoxin and isolated from the mushroom. γ-Amanitin inhibits RNA polymerase II and disrupts synthesis of mRNA. γ-Amanitin shows similar effects to α-Amanitin and β-Amanitin.
  • HY-145732
    SN38 NHS ester

    Drug-Linker Conjugates for ADC Cancer
    SN38 NHS ester is the NHS ester derivative of SN38. SN-38 is an active metabolite of the Topoisomerase I inhibitor Irinotecan. SN-38 inhibits DNA and RNA synthesis. SN38 NHS ester can be used for the synthesis of antibody-drug conjugates (ADCs).
  • HY-125927
    8-Aminoadenosine

    8-NH2-Ado

    DNA/RNA Synthesis Akt mTOR Autophagy Apoptosis Cancer
    8-Aminoadenosine (8-NH2-Ado), a RNA-directed nucleoside analogue, reduces cellular ATP levels and inhibits mRNA synthesis. 8-Aminoadenosine blocks Akt/mTOR signaling and induces autophagy and apoptosis in a p53-independent manner. 8-Aminoadenosine has antitumor activity.
  • HY-143208
    HOE 33187-O-CONH-PEG4-phenol-thiophenone-NHPh-COOEt

    DNA/RNA Synthesis Cancer
    HOE 33187-O-CONH-PEG4-phenol-thiophenone-NHPh-COOEt has inhibitory activity against pre-miR-21 RNA. HOE 33187-O-CONH-PEG4-phenol-thiophenone-NHPh-COOEt has the potential for the research of neoplastic disease such as cancer and especially cancers expressing miR-21 (extracted from patent WO2021087084A1, compound 25).
  • HY-10241S
    Simeprevir-13C,d3

    TMC435-13C,d3; TMC435350-13C,d3

    HCV HCV Protease SARS-CoV DNA/RNA Synthesis Infection
    Simeprevir-13C,d3 (TMC435-13C,d3) is the 13C- and deuterium labeled Simeprevir. Simeprevir is an oral, potent and highly specific hepatitis C virus (HCV) NS3/4A protease inhibitor with a Ki of 0.36 nM. Simeprevir inhibits HCV replication with an EC50 of 7.8 nM. Simeprevir also potently suppresses SARS-CoV-2 replication and synergizes with Remdesivir. Simeprevir inhibits the main protease (M pro) and the RNA-dependent RNA polymerase (RdRp) of SARS-CoV-2, and also modulates host immune responses.
  • HY-115686
    8-Azaadenosine

    Adenosine Deaminase Cancer Inflammation/Immunology
    8-Azaadenosine is a potent ADAR1 inhibitor and an A-to-I editing inhibitor. 8-Azaadenosine blocks RNA editing and inhibits proliferation, 3D growth, invasion, and migration in thyroid cancer cells.
  • HY-N8188
    Dehydrojuncusol

    HCV HCV Protease Infection
    Dehydrojuncusol, a potent HCV inhibitor, targets HCV NS5A and is able to inhibit RNA replication of replicons harboring resistance mutations to anti-NS5A direct-acting antivirals. Dehydrojuncusol significantly inhibits HCV infection when added after virus inoculation of HCV genotype 2a (EC50=1.35 µM).
  • HY-N0540
    Cynaroside

    Luteolin 7-glucoside; Luteolin 7-O-β-D-glucoside

    Influenza Virus DNA/RNA Synthesis Apoptosis Parasite Bacterial Fungal Cancer Infection
    Cynaroside (Luteolin 7-glucoside) is a flavonoid compound that exhibits anti-oxidative capabilities. Cynaroside is also a potent influenza RNA-dependent RNA polymerase inhibitor with an IC50 of 32 nM. Cynaroside also is a promising inhibitor for H2O2-induced apoptosis, has cytoprotection against oxidative stress-induced cardiovascular diseases. Cynaroside also has antibacterial, antifungal and anticancer activities, antioxidant and anti-inflammatory activities.
  • HY-144065
    Cap-dependent endonuclease-IN-19

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-19 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-19 is a spirocyclic pyridone derivative. Cap-dependent endonuclease-IN-19 has strong inhibitory effect on RNA polymerase activity of A virus (extracted from patent CN111410661A, compound 1).
  • HY-B0421
    Mycophenolic acid

    Mycophenolate

    Apoptosis Bacterial Fungal Endogenous Metabolite Antibiotic Cancer Infection Inflammation/Immunology
    Mycophenolic acid is a potent uncompetitive inosine monophosphate dehydrogenase (IMPDH) inhibitor with an EC50 of 0.24 µM. Mycophenolic acid demonstrates antiviral effects against a wide range of RNA viruses including influenza. Mycophenolic acid is an immunosuppressive agent. Antiangiogenic and antitumor effects.
  • HY-B0421A
    Mycophenolic acid sodium

    Mycophenolate sodium

    Apoptosis Bacterial Fungal Antibiotic Endogenous Metabolite Cancer Infection Inflammation/Immunology
    Mycophenolic acid sodium is a potent uncompetitive inosine monophosphate dehydrogenase (IMPDH) inhibitor with an EC50 of 0.24 µM. Mycophenolic acid sodium demonstrates antiviral effects against a wide range of RNA viruses including influenza. Mycophenolic acid sodium is an immunosuppressive agent. Antiangiogenic and antitumor effects.
  • HY-137067
    IMT1B

    LDC203974

    Others Cancer
    IMT1B (LDC203974) is an orally active, noncompetitive and specific allosteric inhibitor of mitochondrial RNA polymerase (POLRMT) and inhibits mitochondrial DNA (mtDNA) expression. IMT1B has anti-tumour effects.
  • HY-109025A
    Baloxavir

    Baloxavir acid; S-033447

    Influenza Virus Infection
    Baloxavir (Baloxavir acid), derived from the prodrug Baloxavir marboxil, is a first-in-class, potent and selective cap-dependent endonuclease (CEN) inhibitor within the polymerase PA subunit of influenza A and B viruses. Baloxavir inhibits viral RNA transcription and replication and has potently antiviral activity.
  • HY-13247
    Setrobuvir

    ANA598

    DNA/RNA Synthesis HCV SARS-CoV Infection
    Setrobuvir (ANA598) is an orally active non-nucleosidic HCV NS5B polymerase inhibitor. ANA-598 inhibits both de novo RNA synthesis and primer extension, with IC50s between 4 and 5 nM. Setrobuvir also shows excellent binding affinity to SARS-CoV-2 RdRp and induces RdRp inhibition.
  • HY-144645
    SP-471P

    Virus Protease DNA/RNA Synthesis Infection
    SP-471P is a potent dengue virus (DENV) protease inhibitor with EC50s of 5.9 μM, 1.4 μM, 5.1 μM and 1.7 μM for DENV1, DENV2, DENV3 and DENV4, respectively and CC50 value over 100 μM. SP-471P can reduce DENV viral RNA synthesis.
  • HY-124806
    TTP-8307

    Enterovirus DNA/RNA Synthesis HCV Infection
    TTP-8307 is a potent inhibitor of the replication of several rhino- and enteroviruses. TTP-8307 inhibits coxsackievirus B3 (CVB3; EC50=1.2 μM) and poliovirus by interfering with the synthesis of viral RNA. TTP-8307 exerts antiviral activity through oxysterol-binding protein (OSBP).
  • HY-21997
    Dmt-2'fluoro-da(bz) amidite

    DNA/RNA Synthesis Others
    Dmt-2'fluoro-da(bz) amidite, an uniformly modified 2'-deoxy-2'-fluoro phosphorothioate oligonucleotide, is a nuclease-resistant antisense compound with high affinity and specificity for RNA targets. Dmt-2'fluoro-da(bz) amidite is also an intermediate for 5’-DMT-3’-phosphoramidite synthesis.
  • HY-145072
    BSJ-01-175

    CDK Cancer
    BSJ-01-175 is a potent and selective CDK12/13 covalent inhibitor. BSJ-01-175 demonstrates exquisite selectivity, potent inhibition of RNA polymerase II phosphorylation, and downregulation of CDK12-targeted genes in cancer cells.
  • HY-113061
    Pseudouridine

    Endogenous Metabolite Nucleoside Antimetabolite/Analog DNA/RNA Synthesis Others
    Pseudouridine, the most abundant modified nucleoside in non-coding RNAs, enhances the function of transfer RNA and ribosomal RNA by stabilizing RNA structure.
  • HY-129589
    Thailanstatin A

    ADC Cytotoxin Cancer
    Thailanstatin A is an ultra-potent inhibitor of eukaryotic RNA splicing (IC50=650 nM). Thailanstatin A exerts effects via non-covalent binding to the SF3b subunit of the U2 snRNA subcomplex of the spliceosome and shows low-nM to sub-nM IC50s against multiple cancer cell lines. Thailanstatin A, a payload for ADCs, is conjugated to the lysines on trastuzumab yielding “linker-less” ADC.
  • HY-P1923
    L-Asparaginase

    L-​ASNase

    Apoptosis DNA/RNA Synthesis Cancer
    L-Asparaginase (L-ASNase) is a deamidating enzyme that catalyses the hydrolysis of L-asparagine and L-glutamine, and can be used for the research of acute lymphoblastic leukemia. L-Asparaginase (L-ASNase) depletes L-asparagine from plasma resulting in inhibition of RNA and DNA synthesis with the subsequent blastic cell apoptosis.
  • HY-144047
    HBV-IN-16

    HBV DNA/RNA Synthesis Infection
    HBV-IN-16 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-16 is a quinoline derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2019121357A1, compound 1).
  • HY-144046
    HBV-IN-15

    HBV DNA/RNA Synthesis Infection
    HBV-IN-15 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-15 is a flavone derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2020052774A1, compound 2).
  • HY-144045
    HBV-IN-14

    HBV DNA/RNA Synthesis Infection
    HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5).
  • HY-143219
    SS-Inclisiran

    Others Others
    SS-Inclisiran is a small interfering RNA.
  • HY-124828
    CMLD-2

    Apoptosis Cancer
    CMLD-2, an inhibitor of HuR-ARE interaction, competitively binds HuR protein disrupting its interaction with adenine-uridine rich elements (ARE)-containing mRNAs (Ki=350 nM). CMLD-2 induces apoptosis exhibits antitumor activity in different cancer cells as colon, pancreatic, thyroid and lung cancer cell lines. Hu antigen R (HuR) is an RNA binding protein, can regulate target mRNAs stability and translation.
  • HY-17580
    Fidaxomicin

    OPT-80; PAR-101

    DNA/RNA Synthesis Bacterial Apoptosis Antibiotic Infection
    Fidaxomicin (OPT-80), a macrocyclic antibiotic, is an orally active and potent RNA polymerase inhibitor. Fidaxomicin has a narrow spectrum of antibacterial activity and a good anti-Clostridium difficile activity (MIC90=0.12 μg/mL). Fidaxomicin can be used for Clostridium difficile infection (CDI) research.
  • HY-122903
    TK216

    DNA/RNA Synthesis Cancer
    TK216 is an orally active and potent E26 transformation specific (ETS) inhibitor. TK216 directly binds EWS-FLI1 and inhibits EWS-FLI1 protein interactions. TK216 blocks the binding between EWS-FLI1 and RNA helicase A. TK216 has anticancer activity.
  • HY-134581A
    Enpatoran hydrochloride

    M5049 hydrochloride

    Toll-like Receptor (TLR) Inflammation/Immunology
    Enpatoran (M5049) hydrochloride is a potent, orally active and dual TLR7/8 inhibitor with IC50s of 11.1 nM and 24.1 nM in HEK293 cells, respectively. Enpatoran hydrochloride is inactive against TLR3, TLR4 and TLR9. Enpatoran hydrochloride can block molecule synthetic ligands and natural endogenous RNA ligands. Enpatoran hydrochloride exhibits excellent pharmacokinetic properties in vivo. Enpatoran hydrochloride can be used for both innate and adaptive autoimmunity blocking research.
  • HY-15843
    MIR96-IN-1

    MicroRNA Apoptosis Cancer
    MIR96-IN-1 targets the Drosha site in the miR-96 (miRNA-96, microRNA-96) hairpin precursor, inhibiting its biogenesis, derepressing downstream targets, and triggering apoptosis in breast cancer cells. MIR96-IN-1 binds to RNAs with Kds of 1.3, 9.4, 3.4, 1.3 and 7.4 μM for RNA1, RNA2, RNA3, RNA4 and RNA5, respectively.
  • HY-143755
    Cap-dependent endonuclease-IN-9

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-9 is a potent inhibitor of cap-dependent endonuclease (CEN). Not only can Cap-dependent endonuclease-IN-9 inhibit influenza virus well, but also has lower cytotoxicity, better in vivo agent kinetic properties and in vivo pharmacodynamic properties. Cap-dependent endonuclease-IN-9 has strong inhibitory effect on RNA polymerase activity of A virus (extracted from patent CN112521386A, compound VI-1).
  • HY-143743
    Cap-dependent endonuclease-IN-2

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-2 is a potent inhibitor of cap-dependent endonuclease (CEN). Not only can Cap-dependent endonuclease-IN-2 inhibit influenza virus well, but also has lower cytotoxicity, better in vivo agent kinetic properties and in vivo pharmacodynamic properties. Cap-dependent endonuclease-IN-2 has strong inhibitory effect on RNA polymerase activity of A virus (extracted from patent WO2019052565A1, compound 28).
  • HY-112626
    CDK12-IN-2

    CDK Cancer
    CDK12-IN-2 is a potent, selective and nanomolar CDK12 inhibitor (IC50=52 nM) with good physicochemical properties. CDK12-IN-2 is also a strong CDK13 inhibitor due to CDK13 is the closest homologue of CDK12. CDK12-IN-2 shows excellent kinase selectivity for CDK12 over CDK2, 9, 8, and 7. CDK12-IN-2 inhibits the phosphorylation of Ser2 in the C-terminal domain of RNA polymerase II. CDK12-IN-2 can be used an excellent chemical probe for functional studies of CDK12.
  • HY-W042357
    Ac-rC Phosphoramidite

    DNA/RNA Synthesis Others
    Ac-rC Phosphoramidite is used for the oligoribonucleotide phosphorodithioate modification (PS2-RNA).
  • HY-135748
    Polyinosinic-polycytidylic acid sodium

    Poly(I:C) sodium

    Toll-like Receptor (TLR) Apoptosis Cancer Inflammation/Immunology
    Polyinosinic-polycytidylic acid sodium (Poly(I:C) sodium) is a synthetic analog of double-stranded RNA and an agonist of toll-like receptor 3 (TLR3) and retinoic acid inducible gene I (RIG-I)-like receptors (RIG-I and MDA5). Polyinosinic-polycytidylic acid sodium can be used as a vaccine adjuvant to enhance innate and adaptive immune responses, and to alter the tumor microenvironment. Polyinosinic-polycytidylic acid sodium can directly trigger cancer cells to undergo apoptosis.
  • HY-115730
    RdRP-IN-3

    Others Infection
    RdRP-IN-3 is a promising anti-influenza drug candidate by inhibiting the activity of RNA-dependent RNA polymerase (RdRp).
  • HY-103006
    NAI-N3

    Others Others
    NAI-N3 is a RNA acylation reagent that enables RNA purification. NAI-N3 is a dual-function SHAPE (selective 2-hydroxyl acylation and profiling experiment) probe (RNA structure probe and enrichment).
  • HY-139850
    GPS491

    HIV Infection
    GPS491 (EC50 = 0.47 μM) suppresses expression of the HIV-1 structural protein Gag and alters HIV-1 RNA accumulation, decreasing the abundance of RNAs encoding the structural proteins while increasing levels of viral RNAs encoding the regulatory proteins.
  • HY-14768
    Favipiravir

    T-705

    DNA/RNA Synthesis Influenza Virus SARS-CoV Infection
    Favipiravir (T-705) is a potent viral RNA polymerase inhibitor, it is phosphoribosylated by cellular enzymes to its active form, Favipiravir-ribofuranosyl-5′-triphosphate (RTP). Favipiravir-RTP inhibits the influenza viral RNA-dependent RNA polymerase (RdRP) activity with an IC50 of 341 nM.
  • HY-13585S
    Carmustine-d8

    DNA Alkylator/Crosslinker Cancer
    Carmustine-d8 is the deuterium labeled Carmustine. Carmustine is an antitumor chemotherapeutic agent, which works by akylating DNA and RNA.
  • HY-18649
    Galidesivir hydrochloride

    BCX4430 hydrochloride; Immucillin-A hydrochloride

    DNA/RNA Synthesis SARS-CoV Filovirus Infection
    Galidesivir (BCX4430) hydrochloride, an adenosine analog and a direct-acting antiviral agent, disrupts viral RNA-dependent RNA polymerase (RdRp) activity. Galidesivir hydrochloride is active in vitro against many RNA viral pathogens, including the filoviruses and emerging infectious agents such as MERS-CoV, SARS-CoV, and SARS-CoV-2. Galidesivir hydrochloride inhibits some negative-sense RNA viruses with EC50s ranging from ~3 to ~68 μM.
  • HY-10118
    Filibuvir

    HCV DNA/RNA Synthesis Infection
    Filibuvir is an orally active, selective non-nucleoside inhibitor of the HCV nonstructural 5B protein (NS5B) RNA-dependent RNA polymerase (RdRp). Filibuvir binds noncovalently in the thumb II allosteric pocket of NS5B. Filibuvir inhibits genotype 1a and 1b replicons with EC50s of 59 nM for both isoforms, respectively. Filibuvir preferentially inhibits elongative RNA synthesis and potently decreases viral RNA accumulation.
  • HY-18649A
    Galidesivir

    BCX4430; Immucillin-A

    DNA/RNA Synthesis SARS-CoV Filovirus Infection
    Galidesivir (BCX4430), an adenosine analog and a direct-acting antiviral agent, disrupts viral RNA-dependent RNA polymerase (RdRp) activity. Galidesivir is active in vitro against many RNA viral pathogens, including the filoviruses and emerging infectious agents such as MERS-CoV, SARS-CoV, and SARS-CoV-2. Galidesivir inhibits some negative-sense RNA viruses with EC50s ranging from ~3 to ~68 μM.
  • HY-122122
    ML-60218

    DNA/RNA Synthesis Cancer Infection
    ML-60218 is a broad-spectrum RNA pol III inhibitor, with IC50s of 32 and 27 μM for Saccharomyces cerevisiae and human. ML-60218 disrupts already assembled viroplasms and to hamper the formation of new ones without the need for de novo transcription of cellular RNAs.
  • HY-134909
    AS-136A

    DNA/RNA Synthesis Infection
    AS-136A is an orally active non-nucleoside inhibitor of the measles virus RNA-dependent RNA polymerase (RdRp) with an IC50 of 2 µM for measles virus.
  • HY-113081
    1-Methyladenosine

    Endogenous Metabolite Others
    1-Methyladenosine is an RNA modification originating essentially from two different reaction types, one catalyzed by enzymes and the other the result of the reaction of RNA with certain alkylating agents.
  • HY-10240
    Mericitabine

    RG 7128; R-7128; PSI 6130 diisobutyrate

    HCV Infection
    Mericitabine (RG 7128; R-7128) is a nucleoside inhibitor of the HCV NS5B polymerase that acts as an RNA chain terminator and prevents elongation of RNA transcripts during replication.
  • HY-150014
    AMT-NHS

    Others Others
    AMT-NHS is an RNA-protein crosslinker. AMT-NHS is composed of a psoralen derivative and an N-hydroxysuccinimide ester group which react with RNA bases and primary amines of protein, respectively. AMT-NHS can penetrate into living yeast cells and crosslink Cbf5 to H/ACA snoRNAs with high specificity. AMT-NHS induces different crosslinking patterns and targets both single- and double-stranded regions of RNA. AMT-NHS can be used for capturing diverse RNA-protein interactions in cells.
  • HY-N2199
    Sotetsuflavone

    Others Cancer
    Sotetsuflavone is a potent inhibitor of DENV-NS5 RdRp (Dengue virus NS5 RNA-dependent RNA polymerase) with an IC50 of 0.16 uM, is the most active compound of this series .
  • HY-W002272
    Isocytosine

    Nucleoside Antimetabolite/Analog Others
    Isocytosine is a non-natural nucleobase and an isomer of cytosine. It is used in combination with Isoguanine in studies of unnatural nucleic acid analogues of the normal base pairs in DNA and used as a nucleobase of hachimoji RNA.
  • HY-123611
    Supinoxin

    RX-5902

    DNA/RNA Synthesis Apoptosis Cancer
    Supinoxin (RX-5902) is an orally active inhibitor of phosphorylated-p68 RNA helicase (P-p68) and a potent first-in-class anti-cancer agent. Supinoxin interacts with Y593 phosphorylated-p68 and attenuates the nuclear shuttling of β-catenin. Supinoxin induces cell apoptosis and inhibits growth of TNBC cancer cell lines with IC50s ranging from 10 nM to 20 nM.
  • HY-18408
    5S rRNA modificator

    FAI

    Others Others
    5S rRNA modificator is a suitable electrophile for 2’-hydroxyl acylation on structured RNA molecules, yielding accurate structural information comparable to that obtained with existing probes; 5S rRNA RNA modification.
  • HY-N0637
    Eriodictyol

    Huazhongilexone

    Keap1-Nrf2 Influenza Virus DNA/RNA Synthesis Endogenous Metabolite Infection Inflammation/Immunology
    Eriodictyol is a flavonoid isolated from the Chinese herb, with antioxidant and anti-inflammatory activity. Eriodictyol induces Nrf2 signaling pathway. Eriodictyol is also a potent influenza RNA-dependent RNA polymerase inhibitor with an IC50 of 18 nM.
  • HY-W010737
    Guanosine-5'-triphosphate disodium salt

    5'-GTP disodium salt

    Endogenous Metabolite Metabolic Disease
    Guanosine-5'-triphosphate disodium salt (5'-GTP trisodium salt) is an activator of the signal transducing G proteins and also serves as an energy-rich precursor of mononucleotide units in the enzymatic biosynthesis of DNA and RNA.
  • HY-132587
    Fitusiran

    ALN-AT3SC; SAR439774

    Factor Xa Others
    Fitusiran (ALN-AT3SC), an small interfering RNA, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia.
  • HY-134539
    IMT1

    Mitochondrial Metabolism DNA/RNA Synthesis Cancer Metabolic Disease
    IMT1 is a first-in-class specific and noncompetitive human mitochondrial RNA polymerase (POLRMT) inhibitor. IMT1 causes a conformational change of POLRMT, which blocks substrate binding and transcription in a dose-dependent way in vitro. IMT1 reduces deoxynucleoside triphosphate levels and citric acid cycle intermediates, resulting in a marked depletion of cellular amino acid levels. IMT1 has the potential for mitochondrial transcription disorders related diseases.
  • HY-128917
    DNA31

    DNA/RNA Synthesis Infection
    DNA31 is a potent RNA polymerase inhibitor.
  • HY-111374
    NMDI14

    Others Cancer
    NMDI14 is a nonsense mediated RNA decay (NMD) inhibitor.
  • HY-112060
    Saccharin 1-methylimidazole

    DNA/RNA Synthesis Cancer
    Saccharin 1-methylimidazole is an activator for DNA/RNA Synthesis.
  • HY-B1906
    Streptomycin

    Agrept; Agrimycin; Streptomycin A

    Antibiotic Bacterial Infection Neurological Disease
    Streptomycin (STR), a aminoglycoside group molecular, is an effective antibiotic against M. tuberculosis, is used for the research of tuberculosis (TB). Streptomycin (STR) also is a bacteriocidal agent that can be used for the research of a number of bacterial infections. Streptomycin (STR), as a basic molecule, can bind strongly to nucleic acids, interferes and blocks protein synthesis while permitting continued RNA and DNA synthesis. Streptomycin, as a common antibiotic used in culture media, also is a blocker of stretch-activated and mechanosensitive ion channels in neurons and cardiac myocytes .
  • HY-N0086
    N6-Methyladenosine

    6-Methyladenosine; N-Methyladenosine

    Endogenous Metabolite Influenza Virus Infection
    N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
  • HY-18407
    N-Methylisatoic anhydride

    NMIA

    Others Others
    N-Methylisatoic anhydride (NMIA) is a 2'-OH selective acylation agent of RNAs, and is widely used for resolving secondary RNA structures using the SHAPE (Selective 2'-Hydroxyl Acylation Analyzed by Primer Extension) technology.
  • HY-10443A
    Balapiravir hydrochloride

    Ro 4588161 hydrochloride; R1626 hydrochloride

    HCV DNA/RNA Synthesis Infection
    Balapiravir hydrochloride (Ro 4588161 hydrochloride; R1626 hydrochloride) is an orally active prodrug of a nucleoside analogue inhibitor of the RNA-dependent RNA polymerase (RdRp) of HCV (R1479; 4'-Azidocytidine). Balapiravir hydrochloride has anti-HCV activity.
  • HY-10443
    Balapiravir

    Ro 4588161; R1626

    HCV DNA/RNA Synthesis Infection
    Balapiravir (Ro 4588161; R1626) is an orally active prodrug of a nucleoside analogue inhibitor of the RNA-dependent RNA polymerase (RdRp) of HCV (R1479; 4'-Azidocytidine). Balapiravir has anti-HCV activity.
  • HY-W013175
    Uridine 5'-monophosphate disodium salt

    Others Others
    Uridine 5'-monophosphate disodium salt is component used for RNA synthesis.
  • HY-13585
    Carmustine

    DNA Alkylator/Crosslinker Cancer
    Carmustine is an antitumor chemotherapeutic agent, which works by akylating DNA and RNA.
  • HY-142654
    ATX-002

    Others Others
    ATX-002 is a property-tunable lipid for RNA drug delivery.
  • HY-128718
    Carbodine

    Influenza Virus Infection
    Carbodine (Carbocyclic cytidine) is a broad-spectrum antiviral agent active against DNA viruses, (+)RNA viruses, (-)RNA viruses, paramyxo, rhabdo and (+/-)RNA viruses, targets CTP synthetase that converts UTP to CTP. Carbodine (Carbocyclic cytidine) possesses significant antiviral activity against influenza virus types A0/PR-8/34 and A2/Aichi/2/68 in vitro.
  • HY-132609
    Patisiran sodium

    Transthyretin (TTR) Neurological Disease
    Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis.
  • HY-12429
    Beclabuvir

    BMS-791325

    HCV Infection
    Beclabuvir is an allosteric inhibitor that binds to thumb site 1 of the hepatitis C virus (HCV) NS5B RNA-dependent RNA polymerase, and inhibits recombinant NS5B proteins from HCV genotypes 1, 3, 4, and 5 with IC50 of < 28 nM. 
  • HY-138581
    DMT-dA(PAc) Phosphoramidite

    Cancer Infection
    DMT-dA(PAc) Phosphoramidite is a dIPhosphoramidite and can be used for DNA or RNA synthesis.
  • HY-113081S
    1-Methyladenosine-d3

    Endogenous Metabolite Others
    1-Methyl Adenosine-d3 is the deuterium labeled 1-Methyladenosine. 1-Methyladenosine is an RNA modification originating essentially from two different reaction types, one catalyzed by enzymes and the other the result of the reaction of RNA with certain alkylating agents.
  • HY-139059
    ERD03

    Others Neurological Disease
    ERD03 is a potent disruptor of the EXOSC3-RNA interaction, with a Kd of 17±7 μM . ERD03 induces PCH1B-like phenotype in zebrafish embryo and can be used for neurological disorder disease research.
  • HY-100575
    Acriflavine

    Acriflavinium chloride 3,6-Acridinediamine mix

    HIF/HIF Prolyl-Hydroxylase Cancer Infection
    Acriflavine is a fluorescent dye for labeling high molecular weight RNA. It is also a topical antiseptic.
  • HY-138609
    5'-O-DMT-rU

    Nucleoside Antimetabolite/Analog DNA/RNA Synthesis Cancer Infection
    5'-O-DMT-rU is a modified nucleoside and can be used to synthesize RNA.
  • HY-I0960
    Uracil

    Endogenous Metabolite Cancer
    Uracil is a common and naturally occurring pyrimidine derivative and one of the four nucleobases in the nucleic acid of RNA.
  • HY-100496
    Nucleocidin

    4'-Fluoro-5'-O-sulfamoyladenosine; NSC 521007

    Bacterial Infection
    Nucleocidin is an antitrypanosomal antibiotic, inhibiting the transfer of labeled amino acid from S-RNA to protein.
  • HY-10444
    R-1479

    4'-Azidocytidine

    HCV DNA/RNA Synthesis Infection
    R-1479 (4'-Azidocytidine), a nucleoside analogue, is a specific inhibitor of RNA-dependent RNA polymerase (RdRp) of HCV. R-1479 inhibits HCV replication in the HCV subgenomic replicon system (IC50=1.28 μM).
  • HY-N0112
    Dihydromyricetin

    Ampelopsin; Ampeloptin

    mTOR Influenza Virus DNA/RNA Synthesis Autophagy Cancer Infection
    Dihydromyricetin is a potent inhibitor with an IC50 of 48 μM on dihydropyrimidinase. Dihydromyricetin can activate autophagy through inhibiting mTOR signaling. Dihydromyricetin suppresses the formation of mTOR complexes (mTORC1/2). Dihydromyricetin is also a potent influenza RNA-dependent RNA polymerase inhibitor with an IC50 of 22 μM.
  • HY-135867
    NHC-triphosphate

    Endogenous Metabolite Enterovirus HCV Topoisomerase SARS-CoV Infection
    NHC-triphosphate is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a triphosphate form. NHC-triphosphate is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA.
  • HY-113262
    8-Hydroxyguanosine

    Endogenous Metabolite Metabolic Disease Neurological Disease
    8-Hydroxyguanosine is a systematic marker of oxidative stress and a marker of hydroxyl radical damage to RNA.
  • HY-138599
    5'-O-TBDMS-dA

    DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Cancer Infection
    5'-O-TBDMS-dA is a modified nucleoside and can be used to synthesize DNA or RNA.
  • HY-145974
    m7GpppAmpG

    DNA/RNA Synthesis Others
    m7GpppAmpG is a trinucleotide cap analog with the capping efficiencies for the obtained RNAs of 90%.
  • HY-133523
    HBC514

    Cancer
    HBC514 is a nonfluorescent HBC-analog but emits strong green fluorescence upon forming a tight complex with Pepper RNA aptamer. HBC514-Pepper complex enables visualization of RNAs and the fluorescences can be altered flexibly by simple washing and staining in living Pepper-tagged cells.
  • HY-126303
    GS-443902

    GS-441524 triphosphate; Remdesivir metabolite

    DNA/RNA Synthesis SARS-CoV RSV HCV Drug Metabolite Infection
    GS-443902 (GS-441524 triphosphate) is a potent viral RNA-dependent RNA-polymerases (RdRp) inhibitor with IC50s of 1.1 µM, 5 µM for RSV RdRp and HCV RdRp, respectively. GS-443902 is the active triphosphate metabolite of Remdesivir.
  • HY-135867F
    NHC-diphosphate triammonium

    Endogenous Metabolite Enterovirus HCV Topoisomerase SARS-CoV Infection
    NHC-triphosphate triammonium is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a triphosphate form. NHC-triphosphate triammonium is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA.
  • HY-146179
    IMP2-IN-2

    Others Cancer
    IMP2-IN-2 (compound 6) is a potent and selective IMP2 inhibitor, with IC50s of 120.9 μM and 236.7 μM for IMP2 interaction with RNA_A and RNA_B, respectively. IMP2-IN-2 can be used for the research of cancer.
  • HY-135867E
    NHC-triphosphate tetraammonium

    Endogenous Metabolite Enterovirus HCV Topoisomerase SARS-CoV Infection
    NHC-triphosphate tetraammonium is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a triphosphate form. NHC-triphosphate tetraammonium is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA.
  • HY-135867A
    NHC-triphosphate tetrasodium

    Endogenous Metabolite Enterovirus HCV Topoisomerase Infection
    NHC-triphosphate tetrasodium is an active phosphorylated intracellular metabolite of β-d-N4-Hydroxycytidine (NHC) (HY-125033) as a triphosphate form. NHC-triphosphate tetrasodium is a weak alternative substrate for the viral polymerase and can be incorporated into HCV replicon RNA.
  • HY-15005
    Sofosbuvir

    GS-7977; PSI-7977

    HCV Infection
    Sofosbuvir (GS-7977) is an HCV RNA replication inhibitor with an EC50 of 92 nM.
  • HY-139682
    Dovitinib-RIBOTAC

    PROTACs Cancer
    Dovitinib RIBOTAC is a targeted RNA degrader that cleaves pre-miR-21 with enhanced potency and selectivity.
  • HY-138610
    5'-O-DMT-Bz-rC

    DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Cancer Infection
    5'-O-DMT-Bz-Rc is a modified nucleoside and can be used to synthesize DNA or RNA.
  • HY-100749
    HeE1-2Tyr

    SARS-CoV Infection
    HeE1-2Tyr, a pyridobenzothiazole compound, is a flavivirus RNA dependent RNA polymerases (RdRp) inhibitor. HeE1-2Tyr significantly inhibits West Nile, Dengue and SARS-CoV-2 RdRps (IC50 of 27.6 µM) activity in vitro.
  • HY-13234
    Rifaximin

    Bacterial Antibiotic DNA/RNA Synthesis Infection
    Rifaximin, a gastrointestinal-selective antibiotic, binds the β-subunit of bacterial DNA-dependent RNA polymerase, resulting in inhibition of bacterial RNA synthesis. Rifaximin susceptibility is higher against Gram-positive strains (MIC: 0.03-5 mg/ml) compared to Gram-negative bacteria (MIC: 8-50 mg/mL).
  • HY-135780A
    3'-Deoxyuridine-5'-triphosphate trisodium

    3'-dUTP trisodium

    Nucleoside Antimetabolite/Analog DNA/RNA Synthesis Endogenous Metabolite Metabolic Disease
    3'-Deoxyuridine-5'-triphosphate trisodium (3'-dUTP trisodium) is a nucleotide analogue that inhibits DNA-dependent RNA polymerases I and II. 3'-Deoxyuridine-5'-triphosphate trisodium strongly and competitively inhibits the incorporations of UTP into RNA with a Ki value of 2.0 μM.
  • HY-132610
    Givosiran

    ALN-AS1

    Others Neurological Disease
    Givosiran (ALN-AS1) is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid and porphobilinogen levels. Givosiran can be used for the research of acute intermittent porphyria.
  • HY-17025
    Rifabutin

    Ansamycin; LM-427

    Bacterial Antibiotic Infection
    Rifabutin (Ansamycin) is a semisynthetic ansamycin antibiotic with potent antimycobacterial properties. Rifabutin inhibits DNA-dependent RNA polymerase.
  • HY-138652
    L-Histidine benzyl ester bistosylate

    Others Others
    L-Histidine benzyl ester bistosylate could play a role in the activation of HutP (an RNA-binding protein).
  • HY-112680A
    Carboxy pyridostatin trifluoroacetate salt

    Others Cancer
    Carboxy pyridostatin trifluoroacetate salt has the peculiarity to exhibit high molecular specificity for RNA over DNA G4s.
  • HY-126406
    Tirandamycin A

    Bacterial DNA/RNA Synthesis Parasite Antibiotic Infection
    Tirandamycin A, an antibiotic, is a bacterial RNA polymerase inhibitor. Tirandamycin A has antiamoebic and antibacterial properties.
  • HY-126303C
    GS-443902 trisodium

    GS-441524 triphosphate trisodium; Remdesivir metabolite trisodium

    DNA/RNA Synthesis SARS-CoV RSV HCV Drug Metabolite Infection
    GS-443902 trisodium (GS-441524 triphosphate trisodium) is a potent viral RNA-dependent RNA-polymerases (RdRp) inhibitor with IC50s of 1.1 µM, 5 µM for RSV RdRp and HCV RdRp, respectively. GS-443902 trisodium is the active triphosphate metabolite of Remdesivir (GS-5734).
  • HY-145913
    m7GpppApG

    DNA/RNA Synthesis Others
    m7GpppApG is a trinucleotide mRNA 5' cap analog that can be used for RNA synthesis in vitro.
  • HY-14507
    YK-4-279

    DNA/RNA Synthesis Apoptosis Cancer
    YK 4-279 is an inhibitor of RNA Helicase A (RHA) binding to the oncogenic transciption factor EWS-FLI1.
  • HY-134320
    8-Azido-ATP

    8-Azidoadenosine 5'-triphosphate; 8-N3-ATP

    Potassium Channel Metabolic Disease
    8-Azido-ATP, a photoreactable nucleotide analog, is useful for the identification of proteins, such as DNA-dependent RNA polymerase.
  • HY-113136
    1-Methylguanosine

    Endogenous Metabolite Cancer
    1-Methylguanosine is a methylated nucleoside originating from RNA degradation. 1-Methylguanosine is a tumour marker.
  • HY-19610
    α-Amanitin

    α-Amatoxin

    DNA/RNA Synthesis ADC Cytotoxin Cancer
    α-Amanitin is the principal toxin of several deadly poisonous mushrooms, exerting its toxic function by inhibiting RNA-polymerase II.
  • HY-107004A
    Amotosalen hydrochloride

    S-59

    Others Inflammation/Immunology
    Amotosalen hydrochloride (S-59) is a light-activated, DNA-, RNA-crosslinking psoralen compound, which is used to neutralise pathogens.
  • HY-113226
    Orotidine

    Endogenous Metabolite Others
    Orotidine, a nucleotide, is an intermediate in pyrimidine nucleotide biosynthesis in RNA and DNA. Orotidine is mainly found in bacteria, fungi and plants.
  • HY-17381
    Idarubicin hydrochloride

    4-Demethoxydaunorubicin hydrochloride

    Topoisomerase Bacterial Fungal Autophagy Antibiotic DNA/RNA Synthesis c-Myc Cancer Infection
    Idarubicin hydrochloride is an anthracycline antileukemic drug. It inhibits the topoisomerase II interfering with the replication of DNA and RNA transcription. Idarubicin hydrochloride inhibits the growth of bacteria and yeasts.
  • HY-145799
    5A2-SC8

    Others Others
    5A2-SC8 is a degradable lipid-like compound (ester-based dendrimer) for small RNAs delivery.
  • HY-145998
    2′-O-Methyl-8-methyl guanosine

    m8Gm

    Others Others
    2′-O-Methyl-8-methyl guanosine (m8Gm) is a Z-form RNA stabilizer. 2′-O-Methyl-8-methyl guanosine can markedly stabilize the Z-RNA at low salt conditions. m8Gm-contained oligonucleotides stabilize the Z-DNA under low salt conditions.
  • HY-W015764
    T-1105

    Influenza Virus Infection
    T-1105, a structural analogue of T-705, is a novel broad-spectrum viral polymerase inhibitor. T-1105 inhibits the polymerases of RNA viruses after being converted to ribonucleoside triphosphate (RTP) metabolite. T-1105 has antiviral activity against various RNA viruses. T-1105 can be formed by nicotinamide mononucleotide adenylyltransferase.
  • HY-138614
    5'-O-DMT-2'-O-TBDMS-Ac-rC

    DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Cancer Infection
    5'-O-DMT-2'-O-TBDMS-Ac-rC is a modified nucleoside and can be used to synthesize DNA or RNA.
  • HY-138611
    5'-O-DMT-2'-O-TBDMS-Bz-rC

    DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Cancer Infection
    5'-O-DMT-2'-O-TBDMS-Bz-rC is a modified nucleoside and can be used to synthesize DNA or RNA.
  • HY-108666
    ATPγS tetralithium salt

    Adenosine-5'-O-3-thiotriphosphate (tetralithium salt); Adenosine 5'-[γ-thio]triphosphate tetralithium salt

    Eukaryotic Initiation Factor (eIF) Inflammation/Immunology
    ATPγS (tetralithium salt) is a substrate for the nucleotide hydrolysis and RNA unwinding activities of eukaryotic translation initiation factor eIF4A.
  • HY-138612
    5'-O-DMT-3'-O-TBDMS-Ac-rC

    DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Cancer Infection
    5'-O-DMT-3'-O-TBDMS-Ac-rC is a modified nucleoside and can be used to synthesize DNA or RNA.
  • HY-13998S
    Dasabuvir-d6

    ABT-333-d6

    HCV Infection
    Dasabuvir-d6 (ABT-333-d6) is the deuterium labeled Dasabuvir. Dasabuvir (ABT-333) is a nonnucleoside inhibitor of the RNA-dependent RNA polymerase encoded by the HCV NS5B gene, inhibits recombinant NS5B polymerases derived from HCV genotype 1a and 1b clinical isolates, with IC50 between 2.2 and 10.7 nM.
  • HY-15349
    Trovirdine

    LY300046

    HIV Infection
    Trovirdine inhibits HIV-1 RT with an IC50 of 7 nM when employing heteropolymeric primer/template (oligo-DNA/ribosomal RNA)and dGTP as substrate.
  • HY-128916
    dmDNA31

    Bacterial Infection
    dmDNA31 is a rifamycin-class antibiotic that inhibits bacterial DNA-dependent RNA polymerase with potent bactericidal activity against S. aureus.
  • HY-100126
    Tubercidin

    7-Deazaadenosine

    Bacterial DNA/RNA Synthesis Influenza Virus Antibiotic Infection
    Tubercidin (7-Deazaadenosine) is an antibiotic obtained from Streptomyces tubercidicus. Tubercidin inhibits the growth of Streptococcus faecalis (8043) with an IC50 of 0.02 μM. Tubercidin inhibits polymerases by incorporating DNA or RNA, thereby inhibiting DNA replication, RNA and protein synthesis. Tubercidin is a weak inhibitor of adenosine phosphorylase, and interferes with the phosphorylation of adenosine and AMP. Tubercidin has antiviral activity.
  • HY-12695B
    Guanosine 5'-triphosphate trisodium salt hydrate

    5'-GTP trisodium salt hydrate

    Endogenous Metabolite Others
    5'-GTP trisodium salt hydrate is an activator of the signal transducing G proteins and also serves as an energy-rich precursor of mononucleotide units in the enzymatic biosynthesis of DNA and RNA.
  • HY-Y1055
    Guanine

    DNA/RNA Synthesis Endogenous Metabolite Cancer
    Guanine is one of the fundamental components of nucleic acids (DNA and RNA). Guanine is a purine derivative, consisting of a fused pyrimidine-imidazole ring system with conjugated double bonds.
  • HY-131083
    ε-Amanitin

    DNA/RNA Synthesis ADC Cytotoxin Cancer
    ε-Amanitin, a cyclic peptide isolated from a variety of mushroom species, potently binds to and inhibits the activity of RNA polymerase II.
  • HY-I0626
    Cytosine

    Endogenous Metabolite Others
    Cytosine is one of the four main bases found in DNA and RNA. Cytosine modifications exhibit circadian oscillations that are involved in epigenetic diversity and aging.
  • HY-147410
    Ulefnersen

    Others Neurological Disease
    Ulefnersen is a RNA-binding protein fused-in sarcoma (FUS) synthesis reducer. Ulefnersen can be used in Amyotrophic Lateral Sclerosis (ALS) research.
  • HY-129057
    2',5-Difluoro-2'-deoxycytidine

    HCV Infection
    2',5-Difluoro-2'-deoxycytidine, compound 13, has potent anti-HCV activity and toxicity to ribosomal RNA (rRNA).
  • HY-W004924
    5-Hydroxymethyluracil

    Endogenous Metabolite Others
    5-Hydroxymethyluracil is a product of oxidative DNA damage. 5-Hydroxymethyluracil can be used as a potential epigenetic mark enhancing or inhibiting transcription with bacterial RNA polymerase.
  • HY-138602
    5'-O-DMT-N4-Ac-2'-F-dC

    DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Cancer Infection
    5'-O-DMT-N4-Ac-2'-F-dC is a modified nucleoside and can be used to synthesize DNA or RNA.
  • HY-108462
    ML-SA1

    TRP Channel Infection
    ML-SA1, as a selective TRPML agonist, inhibits Dengue virus 2 (DENV2) and Zika virus (ZIKV) by promoting lysosomal acidification and protease activity. The IC50 value of ML-SA1 against DENV2 RNA and ZIKV RNA is 8.3 μM and 52.99 μM, respectively. ML-SA1 induces autophagy. ML-SA1 can be used for the research of broad-spectrum antiviral.
  • HY-122123
    S-6123

    Bacterial Infection
    S-6123 is a potent antimicrobial compound of the oxazolidinone series. S-6123 inhibits ribosomal protein synthesis without inhibiting DNA or RNA synthesis.
  • HY-15005B
    Sofosbuvir impurity C

    Others Others
    Sofosbuvir impurity C is an impurity of Sofosbuvir, Sofosbuvir is an active inhibitor of HCV RNA replication in the HCV replicon assay, demonstrates potent anti-hepatitis C virus (HCV) activity.
  • HY-I0727
    Sofosbuvir impurity E

    Others Others
    Sofosbuvir impurity E is an impurity of Sofosbuvir, Sofosbuvir is an active inhibitor of HCV RNA replication in the HCV replicon assay, demonstrates potent anti-hepatitis C virus (HCV) activity.
  • HY-I0719
    Sofosbuvir impurity B

    Others Others
    Sofosbuvir impurity B is an impurity of Sofosbuvir, Sofosbuvir is an active inhibitor of HCV RNA replication in the HCV replicon assay, demonstrates potent anti-hepatitis C virus (HCV) activity.
  • HY-W006429
    L-Uridine

    Endogenous Metabolite Metabolic Disease
    L-Uridine, isolated from the Polyporaceae fungus Poria cocos (Schw.), is an enantiomer of the normal RNA constituent D-uridine. L-uridine acts as a phosphate acceptor for nucleoside phosphotransferases.
  • HY-I0723
    Sofosbuvir impurity D

    Others Others
    Sofosbuvir impurity D is an impurity of Sofosbuvir, Sofosbuvir is an active inhibitor of HCV RNA replication in the HCV replicon assay, demonstrates potent anti-hepatitis C virus (HCV) activity.
  • HY-112980
    Nusinersen

    DNA/RNA Synthesis Inflammation/Immunology
    Nusinersen is an antisense oligonucleotide drug that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein.
  • HY-134665
    NITD-2

    DNA/RNA Synthesis Infection
    NITD-2, a dengue virus (DENV) polymerase inhibitor, inhibits the DENV RdRp-mediated RNA elongation. NITD-2 penetrates cell membrane poorly.
  • HY-D1373
    HBC

    Others Others
    HBC is a green fluorescent protein (GFP) fluorophore-like synthetic dye, with a structurally rigid electron acceptor and a strong electron donor. HBC is used to detect RNA localization.
  • HY-145794
    ZA3-Ep10

    Others Others
    ZA3-Ep10 is a zwitterionic lipid used in lipid nanoparticles formulation for in vivo RNA delivery and non-viral CRISPR/Cas gene editing.
  • HY-I1196
    Sofosbuvir impurity L

    HCV Infection
    Sofosbuvir impurity L, an diastereoisomer of Sofosbuvir, is the impurity of Sofosbuvir. Sofosbuvir (PSI-7977) is an inhibitor of HCV RNA replication, demonstrates potent anti-hepatitis C virus activity.
  • HY-125650
    Pseudouridimycin

    PUM

    DNA/RNA Synthesis Bacterial Infection
    Pseudouridimycin (PUM), an antibiotic, is a selective bacterial RNA polymerase (RNAP) inhibitor. Pseudouridimycin is a C-nucleoside analogue that is effective against both Gram-negative and Gram-positive bacteria.
  • HY-15005C
    Sofosbuvir impurity A

    HCV Infection
    Sofosbuvir impurity A, an diastereoisomer of Sofosbuvir, is the impurity of Sofosbuvir. Sofosbuvir (PSI-7977) is an inhibitor of HCV RNA replication, demonstrates potent anti-hepatitis C virus activity.
  • HY-109561
    Pegaptanib sodium

    EYE001; NX1838

    VEGFR Metabolic Disease Inflammation/Immunology
    Pegaptanib sodium is an RNA aptamer directed against vascular endothelial growth factor (VEGF)-165. Pegaptanib could be used for the study of neovascular age-related macular degeneration (AMD) .
  • HY-114571
    cis-Lomibuvir

    cis-VX-222

    DNA/RNA Synthesis HCV Infection
    cis-Lomibuvir (cis-VX-222) is the cis-isomer of Lomibuvir. Lomibuvir (VX-222), a selective, non-nucleoside polymerase inhibitor, targets thumb pocket 2 of the HCV NS5B polymerase (RdRp) with a Kd of 17 nM. Lomibuvir inhibits the 1b/Con1 HCV subgenomic replicon with an EC50 of 5.2 nM. Lomibuvir preferentially inhibits elongative RNA synthesis rather than de novo-initiated RNA synthesis.
  • HY-I0515
    Sofosbuvir impurity K

    HCV Infection
    Sofosbuvir impurity K, an diastereoisomer of Sofosbuvir, is the impurity of Sofosbuvir. Sofosbuvir (PSI-7977) is an inhibitor of HCV RNA replication, demonstrates potent anti-hepatitis C virus activity.
  • HY-I0512
    Sofosbuvir impurity I

    HCV Infection
    Sofosbuvir impurity I, an diastereoisomer of Sofosbuvir, is the impurity of Sofosbuvir. Sofosbuvir (PSI-7977) is an inhibitor of HCV RNA replication, demonstrates potent anti-hepatitis C virus activity.
  • HY-I0513
    Sofosbuvir impurity N

    HCV Others
    Sofosbuvir impurity N, an diastereoisomer of Sofosbuvir, is the impurity of Sofosbuvir. Sofosbuvir (PSI-7977) is an inhibitor of HCV RNA replication, demonstrates potent anti-hepatitis C virus activity.
  • HY-I0938
    Sofosbuvir impurity H

    HCV Infection
    Sofosbuvir impurity H, an diastereoisomer of Sofosbuvir, is the impurity of Sofosbuvir. Sofosbuvir (PSI-7977) is an inhibitor of HCV RNA replication, demonstrates potent anti-hepatitis C virus activity.
  • HY-I0975
    Sofosbuvir impurity J

    HCV Infection
    Sofosbuvir impurity J, an diastereoisomer of Sofosbuvir, is the impurity of Sofosbuvir. Sofosbuvir (PSI-7977) is an inhibitor of HCV RNA replication, demonstrates potent anti-hepatitis C virus activity.
  • HY-I0735
    Sofosbuvir impurity M

    HCV Infection
    Sofosbuvir impurity M, an diastereoisomer of Sofosbuvir, is the impurity of Sofosbuvir. Sofosbuvir (PSI-7977) is an inhibitor of HCV RNA replication, demonstrates potent anti-hepatitis C virus activity.
  • HY-145840
    Pol I-IN-1

    DNA/RNA Synthesis Cancer
    Pol I-IN-1 is a potent RNA polymerase I (Pol I) inhibitor with IC50 0.21 µM for the Pol I large catalytic subunit RPA194.
  • HY-I0406
    Sofosbuvir impurity F

    HCV Infection
    Sofosbuvir impurity F, an diastereoisomer of Sofosbuvir, is the impurity of Sofosbuvir. Sofosbuvir (PSI-7977) is an inhibitor of HCV RNA replication, demonstrates potent anti-hepatitis C virus activity.
  • HY-I0408
    Sofosbuvir impurity G

    Others Others
    Sofosbuvir impurity G, an diastereoisomer of Sofosbuvir, is the impurity of Sofosbuvir. Sofosbuvir (PSI-7977) is an inhibitor of HCV RNA replication, demonstrates potent anti-hepatitis C virus activity.
  • HY-104072
    BRD4-IN-3

    Epigenetic Reader Domain Infection Inflammation/Immunology
    BRD4-IN-3 (compound 141) is a potent BRD4 inhibitor with an IC50 of <0.5 µM. BRD4-IN-3 shows cytoxicity for MYC-Raji with an IC50 value of >1 µM.
  • HY-46760
    (9Z,12Z)-3-((4,4-Bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate

    Others Others
    (9Z,12Z)-3-((4,4-Bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate is a cationic lipid useful in the delivery of biologically active agents to cells and tissues (extracted from patent WO2015095340 A1).
  • HY-W009162
    Cytidine 5'-monophosphate

    5'-Cytidylic acid; 5'-CMP

    Endogenous Metabolite Metabolic Disease
    Cytidine 5'-monophosphate (5'-Cytidylic acid) is a nucleotide which is used as a monomer in RNA. Cytidine 5'-monophosphate consists of the nucleobase cytosine, the pentose sugar ribose, and the phosphate group.
  • HY-14855
    Tedizolid

    TR 700; Torezolid; DA-7157

    Bacterial Antibiotic Infection
    Tedizolid (TR 700; Torezolid; DA-7157) is a novel oxazolidinone, acting through inhibition of bacterial protein synthesis by binding to 23S ribosomal RNA (rRNA) of the 50S subunit of the ribosome.
  • HY-17025S
    Rifabutin-d7

    Ansamycin-d7; LM-427-d7

    Bacterial Antibiotic Infection
    Rifabutin-d7 (Ansamycin-d7) is the deuterium labeled Rifabutin. Rifabutin (Ansamycin) is a semisynthetic ansamycin antibiotic with potent antimycobacterial properties. Rifabutin inhibits DNA-dependent RNA polymerase.
  • HY-132591
    Inclisiran

    ALN-PCSsc

    Ser/Thr Protease Cardiovascular Disease
    Inclisiran (ALN-PCSsc) is a double-stranded small interfering RNA (siRNA) molecule that inhibits the transcription of PCSK-9. Inclisiran can be used for hyperlipidemia and cardiovascular disease (CVD) research.
  • HY-16637S
    Folic acid-d2

    Vitamin B9-d2; Vitamin M-d2

    DNA/RNA Synthesis Endogenous Metabolite Cancer
    Folic Acid-d2 is the deuterium labeled Folic acid. Folic acid (Vitamin M; Vitamin B9) is a B vitamin; is necessary for the production and maintenance of new cells, for DNA synthesis and RNA synthesis.
  • HY-132590
    Revusiran

    ALN-TTRSC

    Transthyretin (TTR) Neurological Disease
    Revusiran (ALN-TTRSC) is a 1st-generation short interfering RNA, which directed against transthyretin (TTR) mRNA. Revusiran can be used for transthyretin (TTR)-mediated amyloidosis research.
  • HY-128897
    MC-VC-PABC-DNA31

    Drug-Linker Conjugates for ADC Cancer
    MC-VC-PABC-DNA31 is a drug-linker conjugate for ADC with potent antitumor activity by using DNA31 (a potent RNA polymerase inhibitor), linked via the ADC linker MC-VC-PABC.
  • HY-139100
    N7-Methyl-guanosine-5'-triphosphate-5'-adenosine

    m7GpppA

    DNA/RNA Synthesis Infection
    N7-Methyl-guanosine-5'-triphosphate-5'-adenosine (m7GpppA) is a dinucleotide cap analog that can be used for in vitro RNA transcription.
  • HY-128909
    MC-Val-Cit-PAB-rifabutin

    Drug-Linker Conjugates for ADC Cancer
    MC-Val-Cit-PAB-rifabutin is a drug-linker conjugate for ADC with potent antitumor activity by using rifabutin (an DNA-dependent RNA polymerase inhibitor), linked via the ADC linker MC-Val-Cit-PAB.
  • HY-136453
    CR-1-31-B

    Eukaryotic Initiation Factor (eIF) Apoptosis Cancer
    CR-1-31-B is a synthetic rocaglate and a potent eIF4A inhibitor. CR-1-31-B exhibits powerful inhibitory effects over eIF4A by perturbing the interaction between eIF4A and RNA, sequentially impeding initiation during protein synthesis. CR-1-31-B perturbs association of Plasmodium falciparum eIF4A (PfeIF4A) with RNA. CR-1-31-B induces apoptosis of neuroblastoma and gallbladder cancer cells.
  • HY-N8533
    Sodium Camptothecin

    DNA/RNA Synthesis Cancer Infection
    Sodium Camptothecin is a plant alkaloid, with antitumor activity. Sodium Camptothecin is a reversible inhibitor of RNA synthesis. Sodium Camptothecin is an effective inhibitor of adenovirus replication. Sodium Camptothecin inhibits DNA synthesis and causes breaks in intracellular preformed viral DNA.
  • HY-122482
    β-Rubromycin

    HIV Reverse Transcriptase Antibiotic Inflammation/Immunology
    β-Rubromycin is a potent and selective inhibitor of human immunodeficiency virus-1 (HIV-1) RNA-directed DNA polymeras (reverse transcriptase). β-Rubromycin is a class of quinone antibacterials.
  • HY-145980
    m7GpppUpG

    Nucleoside Antimetabolite/Analog Others
    m7GpppUpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppUpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures.
  • HY-145982
    m7GpppCmpG

    Nucleoside Antimetabolite/Analog Others
    m7GpppCmpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppCmpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures.
  • HY-143221
    AS-Inclisiran

    Others Cardiovascular Disease
    AS-Inclisiran is the antisense of Inclisiran. Inclisiran (ALN-PCSsc) is a double-stranded small interfering RNA (siRNA) molecule that inhibits the transcription of PCSK-9. Inclisiran can be used for hyperlipidemia and cardiovascular disease (CVD) research.
  • HY-145977
    m7GpppGmpG

    Nucleoside Antimetabolite/Analog Others
    m7GpppGmpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppGmpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures.
  • HY-145979
    m7GpppUmpG

    Nucleoside Antimetabolite/Analog Others
    m7GpppUmpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppUmpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures.
  • HY-145981
    m7GpppCpG

    Nucleoside Antimetabolite/Analog Others
    m7GpppCpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppCpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures.
  • HY-43913
    (R)-eIF4A3-IN-2

    Eukaryotic Initiation Factor (eIF) Others
    (R)-eIF4A3-IN-2 is a less active enantiomer of eIF4A3-IN-2. eIF4A3-IN-2 is a highly selective and noncompetitive eukaryotic initiation factor 4A-3 (eIF4A3) inhibitor with an IC50 of 110 nM.
  • HY-N1549
    Prunin

    Naringenin 7-0-glucoside

    Enterovirus Phosphatase Infection Metabolic Disease
    Prunin is a potent inhibitor of human enterovirus A71 (HEVA71). Prunin shows strong inhibitory activity against protein tyrosine phosphatase 1B (PTP1B), with an IC50 of 5.5 µM.
  • HY-107202
    Polyinosinic-polycytidylic acid

    Poly(I:C)

    Toll-like Receptor (TLR) Infection Inflammation/Immunology
    Polyinosinic-polycytidylic acid (Poly(I:C)) is a synthetic double-stranded RNA (dsRNA), which is a Toll-like receptor 3 (TLR3) agonist. Polyinosinic-polycytidylic acid presents in some viruses, and is therefore commonly used to model the actions of extracellular dsRNA.
  • HY-B0843A
    Metalaxyl-M

    (R)-Metalaxyl

    Fungal Infection
    Metalaxyl-M ((R)-Metalaxyl) is the active (R)-enantiomer of Metalaxyl. Metalaxyl-M is a broad-spectrum fungicide that inhibits protein and ribosomal RNA synthesis in fungi. Metalaxyl is used for research of plant diseases caused by pathogens of the Oomycota division.
  • HY-126683
    Mal-C6-α-Amanitin

    Drug-Linker Conjugates for ADC Cancer
    Mal-C6-α-Amanitin is a drug-linker conjugate for ADC with potent antitumor activity by using α-Amanitin (an RNA polymerase II inhibitor), linked via the ADC linker Mal-C6.
  • HY-134781
    CKK-E12

    Others Others
    CKK-E12 is a ionizable lipid in combination with other lipids make up the lipid nanoparticles which are used to deliver RNA-based therapeutics. cKK-E12 was highly selective toward liver parenchymal cell in vivo,
  • HY-13744
    Rubitecan

    RFS 2000; 9-Nitrocamptothecin

    Topoisomerase Cancer
    Rubitecan (RFS 2000), a Camptothecin derivative, is an orally active topoisomerase I inhibitor with broad antitumor activity, and induces protein-linked DNA single-strand breaks, thereby blocking DNA and RNA synthesis in dividing cells.
  • HY-132613
    Lumasiran sodium

    Others Metabolic Disease
    Lumasiran sodium, an investigational RNA interference (RNAi) therapeutic agent, reduces hepatic oxalate production by targeting glycolate oxidase. Lumasiran sodium reduces urinary oxalate excretion, the cause of progressive kidney failure in primary hyperoxaluria type 1 (PH1) .
  • HY-30234A
    Clemizole hydrochloride

    Histamine Receptor TRP Channel HCV Protease HCV Cancer Inflammation/Immunology Endocrinology
    Clemizole hydrochloride is an H1 histamine receptor antagonist, is found to substantially inhibit HCV replication. Clemizole hydrochloride is an inhibitor of TRPC5 channel. The IC50 of Clemizole hydrochloride for RNA binding by NS4B is 24 nM, whereas its EC50 for viral replication is 8 µM.
  • HY-80003
    QL47

    Btk Cancer Infection
    QL47, a broad-spectrum antiviral agent, inhibits dengue virus and other RNA viruses. QL47 selectively inhibits eukaryotic translation. QL47 is a potent covalent inhibitor of BTK with an IC50 of 7 nM.
  • HY-129768
    CMLD012072

    Eukaryotic Initiation Factor (eIF) Cancer
    CMLD012072 is an amidino-rocaglates and is a potent eukaryotic initiation factor 4A (eIF4A) inhibitor. CMLD012072 can induce RNA clamping of eIF4A1 and eIF4A2 and possess potent anti-neoplastic activity.
  • HY-143467
    SARS-CoV-IN-4

    SARS-CoV Infection
    SARS-CoV-IN-4 (compound 13) is a potent and specific inhibitor of SARS-CoV nsp14 N7-methyltransferase, with an IC50 of 0.6 μM (SARS-CoV nsp14).
  • HY-15005A
    PSI-7976

    HCV Infection
    PSI-7976 is the isomer of PSI-7977. PSI-7977 is an active inhibitor of HCV RNA replication in the HCV replicon assay, demonstrates potent anti-hepatitis C virus (HCV) activity.
  • HY-147080
    Avacincaptad pegol sodium

    ARC1905

    Complement System Others
    Avacincaptad pegol (ARC1905) is is an anti-C5 RNA aptamer that inhibits the cleavage of complement factor 5 (C5) into C5a and C5b. Avacincaptad pegol is being used for the study of age-related macular degeneration (AMD).
  • HY-146359
    Influenza A virus-IN-5

    Influenza Virus DNA/RNA Synthesis Infection
    Influenza A virus-IN-5 (Compound 16e) is a potent, orally active anti-influenza A virus (IAV) agent with an IC50 of 1.29 μM. Influenza A virus-IN-5 inhibits the transcription and replication of viral RNA with acceptable cytotoxicity.
  • HY-30234
    Clemizole

    Histamine Receptor TRP Channel HCV Protease HCV Cancer Endocrinology Inflammation/Immunology
    Clemizole is an H1 histamine receptor antagonist, is found to substantially inhibit HCV replication. Clemizole is an inhibitor of TRPC5 channel. The IC50 of Clemizole for RNA binding by NS4B is 24±1 nM, whereas its EC50 for viral replication is 8 µM.
  • HY-N0698
    Crocin II

    NO Synthase COX Cancer Inflammation/Immunology Neurological Disease
    Crocin II is isolated from the fruit of Gardenia jasminoides with antioxidant, anticancer, and antidepressant activity. Crocin II inhibits NO production with an IC50 value of 31.1 μM. Crocin II suppresses the expressions of protein and m-RNA of iNOS and COX-2.
  • HY-139099
    Diguanosine 5′-triphosphate

    Gp3G

    Others Infection
    Diguanosine 5′-triphosphate (Gp3G) is a kind of homodinucleotide from by GTP:GTP guanylyltransferase. Diguanosine 5′-triphosphate is a virus-specific oligonucleotide, can be used to prime reovirus transcription and inhibit RNA methylation.
  • HY-I0960S
    Uracil-13C2,15N2

    Endogenous Metabolite Cancer
    Uracil-13C2,15N2 is the 13C-labeled and 15N-labeled Uracil. Uracil is a common and naturally occurring pyrimidine derivative and one of the four nucleobases in the nucleic acid of RNA.
  • HY-16637S1
    Folic acid-d4

    Vitamin B9-d4; Vitamin M-d4

    DNA/RNA Synthesis Endogenous Metabolite Cancer
    Folic acid-d4 (Vitamin B9-d4) is the deuterium labeled Folic acid. Folic acid (Vitamin M; Vitamin B9) is a B vitamin; is necessary for the production and maintenance of new cells, for DNA synthesis and RNA synthesis.
  • HY-143223
    AS(3n-2)-Inclisiran

    Ser/Thr Protease Others
    AS(3n-2)-Inclisiran is the antisense of Inclisiran with 3 N random site after the 2 bp spacer. Inclisiran is a double-stranded small interfering RNA (siRNA) molecule that inhibits the transcription of PCSK-9.
  • HY-13704
    SN-38

    NK012

    Topoisomerase ADC Cytotoxin Autophagy Cancer
    SN-38 (NK012) is an active metabolite of the Topoisomerase I inhibitor Irinotecan. SN-38 (NK012) inhibits DNA and RNA synthesis with IC50s of 0.077 and 1.3 μM, respectively.
  • HY-13323
    CX-5461

    DNA/RNA Synthesis Cancer
    CX-5461 is a potent and oral rRNA synthesis inhibitor. It inhibits RNA polymerase I-driven transcription of rRNA with IC50s of 142, 113, and 54 nM in HCT-116, A375, and MIA PaCa-2 cells, respectively.
  • HY-101082
    N6,2′-O-Dimethyladenosine

    Others Metabolic Disease
    N6,2′-O-Dimethyladenosine, a substrate of fat mass and obesity-associated gene (FTO), is a reversible modification widely occurred on varied RNA molecules. N6,2′-O-Dimethyladenosine can regulate obesity.
  • HY-114208
    BI-9321

    Histone Methyltransferase Cancer
    BI-9321 is a potent, selective and cellular active nuclear receptor-binding SET domain 3 (NSD3)-PWWP1 domain antagonist with a Kd value of 166 nM. BI-9321 is inactive against NSD2-PWWP1 and NSD3-PWWP2. BI-9321 specifically disrupts histone interactions of the NSD3-PWWP1 domain with an IC50 of 1.2 μM in U2OS cells.
  • HY-114208A
    BI-9321 trihydrochloride

    Histone Methyltransferase Cancer
    BI-9321 trihydrochloride is a potent, selective and cellular active nuclear receptor-binding SET domain 3 (NSD3)-PWWP1 domain antagonist with a Kd value of 166 nM. BI-9321 trihydrochloride is inactive against NSD2-PWWP1 and NSD3-PWWP2. BI-9321 trihydrochloride specifically disrupts histone interactions of the NSD3-PWWP1 domain with an IC50 of 1.2 μM in U2OS cells.
  • HY-144646
    SP-471

    Virus Protease Infection
    SP-471 is a potent dengue virus (DENV) protease inhibitor with IC50 value of 18 μM. SP-471 inhibits both intermolecular and intramolecular protease processes of DENV.
  • HY-145560
    Claficapavir

    A1752

    HIV Infection
    Claficapavir (A1752) is a specific nucleocapsid protein (NC) inhibitor with an IC50 around 1 μM. Claficapavir strongly binds the HIV-1 NC (Kd=20 nM) thereby inhibiting the chaperone properties of NC and leading to good antiviral activity against the HIV-1.
  • HY-100028
    AT-130

    HBV DNA/RNA Synthesis Cancer Infection
    AT-130, a phenylpropenamide derivative, is a potent hepatitis B virus (HBV) replication non-nucleoside inhibitor. AT-130 inhibits the viral DNA synthesis with an EC50 of 0.13 μM. AT-130 inhibits both wt and mutant HBVs. AT-130 has anti-HBV activity in hepatoma cells.
  • HY-137658
    Purine riboside triphosphate

    PTP

    Nucleoside Antimetabolite/Analog Others
    Purine riboside triphosphate is a triphosphate derivative of purine riboside. Purine riboside is a naturally occurring base analog which closely resembles adenosine. Purine riboside inhibits carcinogenic growth. Purine riboside strongly inhibits RNA and DNA synthesis in different cancer ascites cells.
  • HY-16398
    Pipobroman

    DNA Alkylator/Crosslinker Cancer
    Pipobroman is a bromide derivative of piperazine and acts as an alkylating agent. Pipobroman plays its role by inhibiting DNA and RNA polymerase or by reducing pyrimidine nucleotide incorporation into DNA. Pipobroman can be used for the cancer research, including polycythemia vera, myeloproliferative neoplasm, and AML et.al.
  • HY-B0438
    Spectinomycin dihydrochloride

    Bacterial Antibiotic Infection
    Spectinomycin dihydrochloride is a broad-spectrum antibiotic and inhibits the growth of a variety of gram-positive and gram-negative organisms. Spectinomycin dihydrochloride acts by selectively targeting to the bacterial ribosome and interrupting protein synthesis. Spectinomycin dihydrochloride is also a noncompetitive inhibitor of td intron RNA with an Ki value of 7.2 mM -.
  • HY-112062
    POL1-IN-1

    DNA/RNA Synthesis Cancer
    POL1-IN-1 is a RNA polymerase 1 (POL1, also known as Pol I) inhibitor with an IC50 of less than 0.5 uM. POL1-IN-1 inhibits ribosome biogenesis by inhibiting POL1 transcription.
  • HY-P1933A
    [pSer2, pSer5, pSer7]-CTD TFA

    CDK Cancer
    [pSer2, pSer5, pSer7]-CTD (TFA), a substrate for CDK7 (cyclin dependent protein kinase), is a phosphorylated polypeptide at ser2, ser5 and ser7 sites of RNA polymerase II carboxy-terminal domain (CTD).
  • HY-15005S1
    Sofosbuvir-d6

    PSI-7977-d6; GS-7977-d6

    HCV Infection
    Sofosbuvir D6 (PSI-7977 D6) is the deuterium labeled Sofosbuvir. Sofosbuvir (PSI-7977) is an active inhibitor of HCV RNA replication in the HCV replicon assay, demonstrates potent anti-hepatitis C virus (HCV) activity.
  • HY-B0879A
    Suramin sodium salt

    Suramin hexasodium salt

    Phosphatase Sirtuin Reverse Transcriptase Topoisomerase SARS-CoV Parasite Apoptosis Cancer Infection Cardiovascular Disease
    Suramin sodium salt (Suramin hexasodium salt) is a reversible and competitive protein-tyrosine phosphatases (PTPases) inhibitor. Suramin sodium salt is a potent inhibitor of sirtuins: SirT1 (IC50=297 nM), SirT2 (IC50=1.15 μM), and SirT5 (IC50=22 μM). Suramin sodium salt is a competitive inhibitor of reverse transcriptase (DNA topoisomerase II: IC50=5 μM). Suramin sodium salt is a potent SARS-CoV-2 RNA-dependent RNA polymerase (RdRp) inhibitor. Suramin sodium salt efficiently inhibits IP5K and is an antiparasitic, anti-neoplastic and anti-angiogenic agent.
  • HY-B0879
    Suramin

    Phosphatase Sirtuin Reverse Transcriptase Topoisomerase SARS-CoV Parasite Apoptosis Cancer Infection Cardiovascular Disease
    Suramin is a reversible and competitive protein-tyrosine phosphatases (PTPases) inhibitor. Suramin is a potent inhibitor of sirtuins: SirT1 (IC50=297 nM), SirT2 (IC50=1.15 μM), and SirT5 (IC50=22 μM). Suramin is a competitive inhibitor of reverse transcriptase (DNA topoisomerase II: IC50=5 μM). Suramin is a potent SARS-CoV-2 RNA-dependent RNA polymerase (RdRp) inhibitor.Suramin efficiently inhibits IP5K and is an antiparasitic, anti-neoplastic and anti-angiogenic agent.
  • HY-105099
    Rifalazil

    KRM-1648; ABI-1648

    DNA/RNA Synthesis Bacterial Infection Inflammation/Immunology
    Rifalazil (KRM-1648; ABI-1648), a rifamycin derivative, inhibits the bacterial DNA-dependent RNA polymerase and kills bacterial cells by blocking off the β-subunit in RNA polymerase. Rifalazil (KRM-1648; ABI-1648) is an antibiotic, exhibits high potency against mycobacteria, gram-positive bacteria, Helicobacter pyloriC. pneumoniae and C. trachomatis with MIC values from 0.00025 to 0.0025 μg/ml. Rifalazil (KRM-1648; ABI-1648) has the potential for the treatment of Chlamydia infection, Clostridium difficile associated diarrhea (CDAD), and tuberculosis (TB).
  • HY-118131
    PKR-IN-C51

    Ser/Thr Protease Infection
    PKR-IN-C51(compound 51) is an ATP-competitive double-stranded RNA-activated protein kinase (PKR) inhibitor with an IC50 of 9 μM. PKR-IN-C51 inhibits intracellular PKR activation in a dose-dependent manner in primary mouse macrophages.
  • HY-U00279
    Nitracrine

    DNA/RNA Synthesis Cancer
    Nitracrine inhibits RNA synthesis and covalently, reversibly binds to DNA but also forms covalent adducts with DNA in vivo. Nitracrine, a 1-nitroacridine derivative, is a potent hypoxia-selective agent in vitro and antitumor drug. Nitracrine has cytotoxicity towards most cells.
  • HY-W008091
    5-Methylcytosine

    DNA/RNA Synthesis Endogenous Metabolite Others
    5-Methylcytosine is a well-characterized DNA modification, and is also predominantly in abundant non-coding RNAs in both prokaryotes and eukaryotes. 5-Methylcytosine in mRNA is a new epitranscriptome marker inArabidopsis, and that regulation of this modification is an integral part of gene regulatory networks underlying plant development.
  • HY-132603
    AB-729

    HBV Infection
    AB-729, a nucleoside analogue, is a RNA interference (RNAi). AB-729 conjugates to a trimer of N-acetylgalactosamine (GalNAc) ligand that promotes uptake into hepatocytes via the asialoglycoprotein receptor (ASGR). AB-729 inhibits viral replication and reduces HBV antigens.
  • HY-B1002
    Oxolinic acid

    Bacterial Antibiotic DNA/RNA Synthesis Infection
    Oxolinic acid is an antibiotic against both Gram-negative and Gram-positive bacteria. Oxolinic acid can be used for the research of acute and chronic urinary tract infections. Oxolinic acid is a DNA/RNA synthesis inhibitor. Oxolinic acid acts a dopamine uptake inhibitor and stimulants locomotor effect in mice.
  • HY-14776
    Quarfloxin

    CX-3543

    DNA/RNA Synthesis Cancer
    Quarfloxin (CX-3543), a fluoroquinolone derivative with antineoplastic activity, targets and inhibits RNA pol I activity, with IC50 values in the nanomolar range in neuroblastoma cells. Quarfloxin disrupts the interaction between the nucleolin protein and a G-quadruplex DNA structure in the ribosomal DNA (rDNA) template.
  • HY-141567
    Pseudouridine 5'-triphosphate

    Pseudo-UTP

    DNA/RNA Synthesis Others
    pseudouridine-5’-triphosphate (Pseudo-UTP) is one of the most commonly used modified nucleoside for the polymerase-mediated synthesis of RNA molecules. Compared with uridine-containing unmodified mRNAs, the application of pseudouridine-containing modified mRNAs exhibits better nuclease stability, immunogenicity, and translational properties.
    .
  • HY-N10404
    Junceellolide C

    HBV Inflammation/Immunology
    Junceellolide C is a transcription inhibitor of cccDNA. Junceellolide C inhibits HBV DNA replication and significantly decreases the level of supernatant HBV RNA with EC50 values of 5.19, 3.52 μM respectively in HepAD38 cells. Junceellolide C is a potent anti-HBV agent.
  • HY-13624A
    Epirubicin hydrochloride

    4'-Epidoxorubicin hydrochloride

    DNA/RNA Synthesis Topoisomerase Apoptosis Cancer
    Epirubicin hydrochloride (4'-Epidoxorubicin hydrochloride), a semisynthetic L-arabino derivative of doxorubicin, has an antineoplastic agent by inhibiting Topoisomerase. Epirubicin hydrochloride inhibits DNA and RNA synthesis. Epirubicin hydrochloride is a Forkhead box protein p3 (Foxp3) inhibitor and inhibits regulatory T cell activity.
  • HY-132608
    Inotersen sodium

    ISIS-420915 sodium

    Transthyretin (TTR) Neurological Disease
    Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy.
  • HY-119674
    Xanthopterin

    DNA/RNA Synthesis Infection
    Xanthopterin, an unconjugated pteridine compound, is the main component of the yellow granule in the Oriental hornet bear wings, produces a characteristic excitation/emission maximum at 386/456 nm. Xanthopterin (XPT) causes renal growth and hypertrophy in rat. Xanthopterin inhibits RNA synthesis.
  • HY-B0152
    Adenine

    6-Aminopurine; Vitamin B4

    DNA/RNA Synthesis Endogenous Metabolite Cancer
    Adenine (6-Aminopurine), a purine, is one of the four nucleobases in the nucleic acid of DNA. Adenine acts as a chemical component of DNA and RNA. Adenine also plays an important role in biochemistry involved in cellular respiration, the form of both ATP and the cofactors (NAD and FAD), and protein synthesis.
  • HY-B0152A
    Adenine hydrochloride

    6-Aminopurine hydrochloride; Vitamin B4 hydrochloride

    DNA/RNA Synthesis Endogenous Metabolite Cancer
    Adenine hydrochloride (6-Aminopurine hydrochloride), a purine, is one of the four nucleobases in the nucleic acid of DNA. Adenine hydrochloride acts as a chemical component of DNA and RNA. Adenine hydrochloride also plays an important role in biochemistry involved in cellular respiration, the form of both ATP and the cofactors (NAD and FAD), and protein synthesis.
  • HY-141567A
    Pseudouridine 5'-triphosphate trisodium

    Pseudo-UTP trisodium

    DNA/RNA Synthesis Others
    Pseudouridine-5’-triphosphate (Pseudo-UTP) is one of the most commonly used modified nucleoside for the polymerase-mediated synthesis of RNA molecules. Compared with uridine-containing unmodified mRNAs, the application of pseudouridine-containing modified mRNAs exhibits better nuclease stability, immunogenicity, and translational properties.
    .
  • HY-15005S
    Sofosbuvir 13CD3

    PSI-7977 13CD3; GS-7977 13CD3

    HCV Infection
    Sofosbuvir 13CD3 (PSI-7977 13CD3) is the deuterium labeled Sofosbuvir. Sofosbuvir (PSI-7977) is an active inhibitor of HCV RNA replication in the HCV replicon assay, demonstrates potent anti-hepatitis C virus (HCV) activity.
  • HY-16637S2
    (Rac)-Folic acid-13C5,15N

    (Rac)-Vitamin B9-13C5,15N; (Rac)-Vitamin M-13C5,15N

    DNA/RNA Synthesis Endogenous Metabolite Cancer
    Folic acid-13C5,15N is the 13C-labeled and 15N-labeled Folic acid. Folic acid (Vitamin M; Vitamin B9) is a B vitamin; is necessary for the production and maintenance of new cells, for DNA synthesis and RNA synthesis.
  • HY-13624
    Epirubicin

    4'-Epidoxorubicin

    DNA/RNA Synthesis Topoisomerase Apoptosis Cancer
    Epirubicin (4'-Epidoxorubicin), a semisynthetic L-arabino derivative of doxorubicin, has an antineoplastic agent by inhibiting Topoisomerase. Epirubicin inhibits DNA and RNA synthesis. Epirubicin is a Forkhead box protein p3 (Foxp3) inhibitor and inhibits regulatory T cell activity.
  • HY-128974
    N-Dodecyl-β-D-maltoside

    Lauryl Maltoside

    Others Others
    N-Dodecyl-β-D-maltoside (Lauryl Maltoside) is a derivatives of pyrene (Py), and it is a alkyl maltopyranoside detergent, especially in transporters and respiratory complexes. N-Dodecyl-β-D-maltoside has also been employed in applications such as in the purification and stabilization of RNA polymerase and detection of protein-lipid interactions.
  • HY-B0275
    Oxytetracycline

    Bacterial HSV Endogenous Metabolite Antibiotic Infection
    Oxytetracycline is an antibiotic belonging to the tetracycline class. Oxytetracycline potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline also possesses anti-HSV-1 activity.
  • HY-119674A
    Xanthopterin (hydrate)

    DNA/RNA Synthesis Inflammation/Immunology Cancer
    Xanthopterin hydrate, an unconjugated pteridine compound, is the main component of the yellow granule in the Oriental hornet bear wings, produces a characteristic excitation/emission maximum at 386/456 nm. Xanthopterin hydrate(XPT) causes renal growth and hypertrophy in rat. Xanthopterin hydrate inhibits RNA synthesis.
  • HY-139306
    BAMEA-O16B

    Others Inflammation/Immunology
    BAMEAO16B is a lipid nanoparticle. BAMEAO16B integrated with disulfide bonds, can efficiently deliver Cas9 mRNA and sgRNA into cells while releasing RNA in response to the reductive intracellular environment for genome editing. BAMEAO16B can be used for the research of gene editing.
  • HY-B1828A
    Spectinomycin dihydrochloride pentahydrate

    Spectinomycin hydrochloride hydrate

    Bacterial Antibiotic Infection
    Spectinomycin dihydrochloride pentahydrate is a broad-spectrum antibiotic and inhibits the growth of a variety of gram-positive and gram-negative organisms. Spectinomycin dihydrochloride pentahydrate acts by selectively targeting to the bacterial ribosome and interrupting protein synthesis. Spectinomycin dihydrochloride pentahydrate is also a noncompetitive inhibitor of td intron RNA with an Ki value of 7.2 mM -.
  • HY-N0462
    Corilagin

    Reverse Transcriptase Bacterial Cancer Infection Inflammation/Immunology
    Corilagin, a gallotannin, inhibits activity of reverse transcriptase of RNA tumor viruses. Corilagin inhibits the growth of Staphylococcus aureus with a MIC of 25 μg/mL. Corilagin shows good anti-tumor activity on hepatocellular carcinoma and ovarian cancer. Corilagin shows a low level of toxicity toward normal cells and tissues.
  • HY-B0275A
    Oxytetracycline hydrochloride

    Bacterial HSV Antibiotic Endogenous Metabolite Infection
    Oxytetracycline hydrochloride is an antibiotic belonging to the tetracycline class. Oxytetracycline hydrochloride potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline hydrochloride is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline hydrochloride also possesses anti-HSV-1 activity.
  • HY-14855S
    Tedizolid-13C,d3

    TR 700-13C,d3; Torezolid-13C,d3; DA-7157-13C,d3

    Bacterial Antibiotic Infection
    Tedizolid-13C,d3 is the 13C- and deuterium labeled Tedizolid. Tedizolid (TR 700; Torezolid; DA-7157) is a novel oxazolidinone, acting through inhibition of bacterial protein synthesis by binding to 23S ribosomal RNA (rRNA) of the 50S subunit of the ribosome.
  • HY-17381A
    Idarubicin

    4-Demethoxydaunorubicin

    Topoisomerase Bacterial Fungal Autophagy c-Myc DNA/RNA Synthesis Antibiotic Cancer Infection
    Idarubicin is an orally active and potent anthracycline antileukemic agent. Idarubicin inhibits the topoisomerase II interfering with the replication of DNA and RNA transcription. Idarubicin shows induction of DNA damage. Idarubicin inhibits DNA synthesis and of c-myc expression. Idarubicin inhibits the growth of bacteria and yeasts.
  • HY-124614
    GLP-26

    HBV Infection
    GLP-26 is a HBV capsid assembly modulators (CAM), inhibits HBV DNA replication in Hep AD38 system (IC50=3 nM), and reduces cccDNA by >90% at 1 μM. GLP-26 disrupts the encapsidation of pre-genomic RNA, causes nucleocapsid disassembly and reduces cccDNA pools.
  • HY-B0152B
    Adenine hemisulfate

    6-Aminopurine hemisulfate; Vitamin B4 hemisulfate

    DNA/RNA Synthesis Endogenous Metabolite Cancer
    Adenine hemisulfate (6-Aminopurine hemisulfate), a purine, is one of the four nucleobases in the nucleic acid of DNA. Adenine hemisulfate acts as a chemical component of DNA and RNA. Adenine hemisulfate also plays an important role in biochemistry involved in cellular respiration, the form of both ATP and the cofactors (NAD and FAD), and protein synthesis.
  • HY-15353
    Emivirine

    MKC-442

    HIV Infection Inflammation/Immunology
    Emivirine (MKC-442) is a non-nucleoside reverse transcriptase inhibitors (NNRTIs) with Ki values of 0.20 and 0.01 μM for dTTP- and dGTP-dependent DNA or RNA polymerase activity, respectively. Emivirine displays potent and selective anti-human immunodeficiency virus type 1 (HIV-1) activity.
  • HY-125586
    β-Amanitin

    DNA/RNA Synthesis ADC Cytotoxin Cancer
    β-Amanitin is a cyclic peptide toxin in the poisonous Amanita phalloides mushroom. β-Amanitin inhibits inhibits eukaryotic RNA polymerase II and III. β-Amanitin inhibits protein synthesis. β-Amanitin can be used as a cytotoxic component of antibody-drug conjugates (ADCs).
  • HY-105846
    Nogalamycin

    DNA/RNA Synthesis Bacterial Antibiotic Cancer
    Nogalamycin is an anthracyclinone antibiotic. Nogalamycin is a potent antibiotic against Gram-positive bacteria, also has cytotoxicity against certain tumor cells. Nogalamycin is produced by Streptomyces nogalater var. Nogalater. Nogalamycin selectively inhibits RNA synthesis after binding to DNA template. Nogalamycin can be used for researching anticancer.
  • HY-129769
    CMLD012073

    Eukaryotic Initiation Factor (eIF) Cancer
    CMLD012073 is an amidino-rocaglates and is a potent eukaryotic initiation factor 4A (eIF4A) inhibitor. CMLD012073 inhibits the growth of NIH/3T3 cells with an IC50 of 10 nM. CMLD012073 inhibits eukaryotic translation initiation by modifying the behavior of the RNA helicase (eIF4A).
  • HY-W011209
    N6-Isopentenyladenosine

    Riboprine

    Autophagy Endogenous Metabolite Cancer
    N6-Isopentenyladenosine (Riboprine), an RNA modification found in cytokinins, which regulate plant growth/differentiation, and a subset of tRNAs, where it improves the efficiency and accuracy of translation. N6-Isopentenyladenosine, an end product of the mevalonate pathway, is an autophagy inhibitor with an interesting anti-melanoma activity.
  • HY-B1099
    Hycanthone

    DNA/RNA Synthesis Topoisomerase Parasite Infection
    Hycanthone is a thioxanthenone DNA intercalator and inhibits RNA synthesis as well as the DNA topoisomerases I and II. Hycanthone inhibits nucleic acid biosynthesis and inhibits apurinic endonuclease-1 (APE1) by direct protein binding with a KD of 10 nM. Hycanthone is a bioactive metabolite of Lucanthone (HY-B2098) and has anti-schistosomal agent.
  • HY-112760
    PEG2000-DSPE

    Others Cancer
    PEG2000-DSPE can be used for the preparation of stabilized nucleic acid-lipid particllipid particles (SNALPs). SNALPs represent some of the earliest and best functional siRNA-ABC nanoparticles described.
  • HY-121295
    Roseoflavin

    Bacterial Infection
    Roseoflavin, a natural pigment originally isolated from Streptomyces davawensis, is an antimetabolite analog of Riboflavin and flavin mononucleotide that has antimicrobial properties.
  • HY-W088075
    Acriflavine hydrochloride

    Acriflavinium chloride hydrochloride

    HIF/HIF Prolyl-Hydroxylase Bacterial SARS-CoV Cancer Infection
    Acriflavine hydrochloride (Acriflavinium chloride hydrochloride) is a fluorescent acridine dye that can be used to label nucleic acid. Acriflavine hydrochloride is an antiseptic. Acriflavine hydrochloride is a potent HIF-1 inhibitor, with antitumor activity. Acriflavine hydrochloride has antimicrobial and antiviral activities. Acriflavine hydrochloride is a potent papain-like protease (PL pro) inhibitor, which inhibits SARS-CoV-2
  • HY-144668
    RdRP-IN-4

    Influenza Virus Infection
    RdRP-IN-4 (compound 11q), an aryl benzoyl hydrazide analog, is an orally active influenza A virus RNA-dependent RNA polymerase (RdRp) inhibitor by interacting with the PB1 subunit. RdRP-IN-4 exhibits potent inhibitory activity against the avian H5N1 flu strain with an EC50 of 18 nM in MDCK cells. RdRP-IN-4 displays excellent potency against the the H1N1 (A/PR/8/34) Flu A strain and Flu B strain (B/Lee/1940) with EC50 values of 53 nM and 20 nM, respectively. RdRP-IN-4 significantly inhibits the expression level of viral nucleoprotein (NP) in a dose-dependent manner. RdRP-IN-4 exhibits significant antiviral activity in infected mice.
  • HY-B0275C
    Oxytetracycline calcium

    Bacterial HSV Antibiotic Endogenous Metabolite Infection
    Oxytetracycline calcium is an antibiotic belonging to the tetracycline class. Oxytetracycline calcium potently inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline calcium is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline calcium also possesses anti-HSV-1 activity.
  • HY-W010970
    5'-Guanylic acid disodium salt

    5'-GMP disodium salt; 5'-guanosine monophosphate disodium salt

    Endogenous Metabolite Others
    5'-Guanylic acid disodium salt (5'-GMP disodium salt) is composed of guanine, ribose, and phosphate moieties and it is a nucleotide monomer in messenger RNA. Guanosine derivatives are involved in intracellular signal transduction and have been identified in repetitive genomic sequences in telomeres, in ribosomal DNA, immunoglobulin heavy‐chain switch regions, and in the control regions of proto-oncogenes.
  • HY-122970
    1,2-Dihydrotanshinone

    1,2-Dihydrotanshinquinone

    Others Inflammation/Immunology
    1,2-Dihydrotanshinone (1,2-Dihydrotanshinquinone) is an abietane diterpene. 1,2-Dihydrotanshinone inhibits the formation of the pathogenic complex formed between (CUG)n-RNA and the splicing-factor muscleblind-like 1 (MBNL1). 1,2-Dihydrotanshinone can be used for the research of myotonic dystrophy type 1.
  • HY-120118
    Metarrestin

    ML246

    DNA/RNA Synthesis Cancer
    Metarrestin (ML246) is an orally active, first-in-class and specific perinucleolar compartment inhibitor. Metarrestin disrupts the nucleolar structure and inhibits RNA polymerase (Pol) I transcription, at least in part by interacting with the translation elongation factor eEF1A2. Metarrestin blocks metastatic development and extends survival in mouse cancer models.
  • HY-B0158S
    Cytidine-d2

    Cytosine β-D-riboside-d2; Cytosine-1-β-D-ribofuranoside-d2

    Nucleoside Antimetabolite/Analog Endogenous Metabolite Neurological Disease
    Cytidine-d2 (Cytosine β-D-riboside-d2) is the deuterium labeled Cytidine. Cytidine is a pyrimidine nucleoside and acts as a component of RNA. Cytidine is a precursor of uridine. Cytidine controls neuronal-glial glutamate cycling, affecting cerebral phospholipid metabolism, catecholamine synthesis, and mitochondrial function.
  • HY-43520
    BODIPY-FL

    Others Others
    BODIPY-FL is a potent fluorescent dye. BODIPY-FL can be used to label probe or primer for fluorescent quenching-based quantitative detection of specific DNA/RNA.BODIPY-FL-labeled monoterpenoid can be used to examine the features of a broad spectrum of Gram-positive and Gram-negative bacteria and pathogenic fungi as well.
  • HY-B0275B
    Oxytetracycline dihydrate

    Bacterial HSV Antibiotic Endogenous Metabolite Infection
    Oxytetracycline dihydrate is an antibiotic belonging to the tetracycline class. Oxytetracycline dihydrate potent inhibits Gram-negative and Gram-positive bacteria. Oxytetracycline dihydrate is a protein synthesis inhibitor and prevents the binding from aminoacil-tRNA to the complex m-ribosomal RNA. Oxytetracycline dihydrate also possesses anti-HSV-1 activity.
  • HY-B0220S
    Erythromycin-d6

    Bacterial Antibiotic Infection
    Erythromycin-d6 is the deuterium labeled Erythromycin. Erythromycin is a macrolide antibiotic produced by actinomycete Streptomyces erythreus with a broad spectrum of antimicrobial activity. Erythromycin acts by binding to bacterial 50S ribosomal subunits and inhibits RNA-dependent protein synthesis by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid.
  • HY-109025AS
    Baloxavir-d5

    Baloxavir acid-d5; S-033447-d5

    Influenza Virus Infection
    Baloxavir-d5 is deuterium labeled Baloxavir. Baloxavir (Baloxavir acid), derived from the prodrug Baloxavir marboxil, is a first-in-class, potent and selective cap-dependent endonuclease (CEN) inhibitor within the polymerase PA subunit of influenza A and B viruses. Baloxavir inhibits viral RNA transcription and replication and has potently antiviral activity.
  • HY-10373
    Trimetrexate

    CI-898

    Bacterial Antibiotic Antifolate Parasite Infection Cancer
    Trimetrexate (CI-898) is an antibiotic, also a potent and orally active dihydrofolate reductase (DHFR) inhibitor, reducing the production of DNA and RNA precursors and leading to cell death, with IC50 values of 4.74 nM and 1.35 nM for human DHFR and Toxoplasma gondii DHFR. Trimetrexate can be used for researching Pneumocystis carinii pneumonia (PCP) and cancer.
  • HY-118874
    Oblimersen

    Bcl-2 Family Apoptosis Cancer
    Oblimersen is a BCL-2 inhibitor targeting BCL-2 RNA. Oblimersen specifically binds to the first six codons of the bcl-2 mRNA sequence, resulting in degradation of bcl-2 mRNA and induces apoptosis by down-regulating expression of Bcl-2. Oblimersen can be used for cancer research.
  • HY-B1002S
    Oxolinic acid-d5

    Bacterial Antibiotic DNA/RNA Synthesis Infection
    Oxolinic acid-d5 is the deuterium labeled Oxolinic acid. Oxolinic acid is an antibiotic against both Gram-negative and Gram-positive bacteria. Oxolinic acid can be used for the research of acute and chronic urinary tract infections. Oxolinic acid is a DNA/RNA synthesis inhibitor. Oxolinic acid acts a dopamine uptake inhibitor and stimulants locomotor effect in mice.
  • HY-10373A
    Trimetrexate trihydrochloride

    CI-898 trihydrochloride

    Antifolate Antibiotic Parasite Bacterial Infection
    Trimetrexate (CI-898) trihydrochloride is an antibiotic, also a potent and orally active dihydrofolate reductase (DHFR) inhibitor, reducing the production of DNA and RNA precursors and leading to cell death, with IC50 values of 4.74 nM and 1.35 nM for human DHFR and Toxoplasma gondii DHFR. Trimetrexate trihydrochloride can be used for researching Pneumocystis carinii pneumonia (PCP) and cancer.
  • HY-147918
    Anticancer agent 73

    DNA/RNA Synthesis Cancer
    Anticancer agent 73 (compound CIB-3b) is a anticancer agent, potently targeting TAR RNA-binding protein 2 (TRBP) and disrupts its interaction with Dicer. Anticancer agent 73 can rebalance the expression profile of oncogenic or tumor-suppressive miRNAs. Anticancer agent 73 suppresses the proliferation and metastasis of HCC in vitro and in vivo.
  • HY-I0626S
    Cytosine-2,4-13C2-1,3-15N2

    Endogenous Metabolite Others
    Cytosine-2,4-13C2-1,3-15N2 is the 13C-labeled and 15N-labeled Cytosine. Cytosine is one of the four main bases found in DNA and RNA. Cytosine modifications exhibit circadian oscillations that are involved in epigenetic diversity and aging.
  • HY-107202A
    Poly (I:C):Kanamycin (1:1)

    Infection
    Poly (I:C):Kanamycin (1:1) is a mixture of poly (I:C) and kanamycin. Poly(I:C) is a synthetic double-stranded RNA (dsRNA), which is a Toll-like receptor 3 (TLR3) agonist. Kanamycin is positively charged (poly-NH3) and can thus neutralize the negative charge of Poly I:C and thereby stabilized the molecule.
  • HY-145994
    ATV006

    SARS-CoV Infection
    ATV006 is a potent, orally active antiviral agent and ester prodrugs of GS-441524. ATV006 inhibits the replication of SARS-CoV-2 and its variants. ATV006 can be used for SARS-CoV-2 research.
  • HY-13704S1
    SN-38-d5

    NK012-d5

    Topoisomerase ADC Cytotoxin Autophagy Cancer
    SN-38-d5 is deuterium labeled SN-38. SN-38 (NK012) is an active metabolite of the Topoisomerase I inhibitor Irinotecan. SN-38 (NK012) inhibits DNA and RNA synthesis with IC50s of 0.077 and 1.3 μM, respectively.
  • HY-17470
    Mizoribine

    NSC 289637; HE 69

    HCV SARS-CoV Inflammation/Immunology
    Mizoribine (NSC 289637), an imidazole nucleoside, inhibits HCV RNA replication with IC50 of approximately 100 μM for anti-HCV activity. Immunosuppressant. Mizoribine, an IMPDH inhibitor, inhibits replication of SARS-CoV with IC50s of 3.5 μg/mL and 16 μg/mL for SARS-CoV Frankfurt-1 and SARS-CoV HKU39849, respectively.
  • HY-17580S
    Fidaxomicin-d7

    Bacterial Apoptosis Antibiotic Infection
    Fidaxomicin-D7 (OPT-80-D7) is the deuterium labeled Fidaxomicin. Fidaxomicin (OPT-80), a macrocyclic RNA polymerase inhibitor, has a narrow spectrum of activity. Fidaxomicin selectively eradicates pathogenic Clostridium difficile with minimal disruption to the multiple species of bacteria that make up the normal, healthy intestinal flora.
  • HY-B0956
    Paromomycin sulfate

    Aminosidine sulfate

    Antibiotic Parasite Bacterial Infection
    Paromomycin (Aminosidine) sulfate, a neomycin (HY-B0470) derivative, is a broad spectrum aminoglycoside antibiotic with amebicidal and bactericidal effects. Paromomycin sulfate prematures termination of translation of mRNA and inhibits protein synthesis by specifically binds to the RNA oligonucleotide at the A site of bacterial 30S ribosomes. Paromomycin sulfate can be used for the research of bacterial and parasitic infections.
  • HY-10373B
    Trimetrexate isethionate

    CI-898 isethionate

    Antibiotic Antifolate Parasite Bacterial Cancer Infection
    Trimetrexate (CI-898) isethionate is an antibiotic, also a potent and orally active dihydrofolate reductase (DHFR) inhibitor, reducing the production of DNA and RNA precursors and leading to cell death, with IC50 values of 4.74 nM and 1.35 nM for human DHFR and Toxoplasma gondii DHFR. Trimetrexate isethionate can be used for researching Pneumocystis carinii pneumonia (PCP) and cancer.
  • HY-13704S
    SN-38-d3

    NK012-d3

    Topoisomerase ADC Cytotoxin Autophagy Cancer
    SN-38-d3 is the deuterium labeled SN-38. SN-38 (NK012) is an active metabolite of the Topoisomerase I inhibitor Irinotecan. SN-38 (NK012) inhibits DNA and RNA synthesis with IC50s of 0.077 and 1.3 μM, respectively.
  • HY-108466
    Ro 08-2750

    Apoptosis Cancer Neurological Disease
    Ro 08-2750 is a non-peptide and reversible nerve growth factor (NGF) inhibitor which binds to NGF, and with an IC50 of ~ 1 µM. Ro 08-2750 inhibits NGF binding to p75 NTR selectively over TRKA. Ro 08-2750 is a selective MSI RNA-binding activity inhibitor, with an IC50 of 2.7 μM.
  • HY-147903
    HIV-1 inhibitor-42

    HIV Infection
    HIV-1 inhibitor-42 (compound 5b) is a potent HIV-1 inhibitor, with an IC50 of 0.06 μM. HIV-1 inhibitor-42 inhibits HIV-1 RT RNA-dependent DNA polymerase and DNA-dependent DNA polymerase, with IC50 values of 0.518 and 0.072 μM.
  • HY-146178
    IMP2-IN-1

    Others Cancer
    IMP2-IN-1 (compound 4) is a potent IMP2 inhibitor with IC50 value of 81.3~127.5 for IMP2 RNA sequence. IMP2-IN-1 reduces IMP2 in SW480 cells. IMP2-IN-1 significantly reduces the viability of both differentiated and non-differentiated Huh7 cells.
  • HY-150015
    4,5'-Dimethylangelicin-NHS

    DNA/RNA Synthesis Cancer
    4,5'-Dimethylangelicin-NHS is a modified 4,5'-Dimethylangelicin containing an NHS. 4,5'-Dimethylangelicin is an angular furocoumarin with photochemical and photosensitizing properties. 4,5'-Dimethylangelicin can inhibit the DNA and RNA syntheses in Ehrlich ascites tumor cells alter irradiation at 365 nm. 4,5'-Dimethylangelicin has potential as a photochemotherapy agent.
  • HY-125918
    Bleomycin A5 hydrochloride

    Pingyangmycin hydrochloride

    Apoptosis Antibiotic Cancer Infection
    Bleomycin A5 (Pingyangmycin) hydrochloride is an anti-neoplastic glycoprotein antibiotic. Bleomycin A5 suppresses Drp1-mediated mitochondrial fission and induces apoptosis in human nasal polyp-derived fibroblasts. Bleomycin A5 hydrochloride has anticancer activities relying on its ability to produce RNA and DNA breaks, thus, leading to cell death..
  • HY-13062A
    Daunorubicin

    Daunomycin; RP 13057; Rubidomycin

    Topoisomerase DNA/RNA Synthesis ADC Cytotoxin Autophagy Bacterial Antibiotic Apoptosis Cancer Infection Neurological Disease
    Daunorubicin (Daunomycin) is a topoisomerase II inhibitor with potent anti-tumor activity. Daunorubicin inhibits DNA and RNA synthesis. Daunorubicin is a cytotoxin that inhibits cancer cell viability and induces apoptosis and necrosis. Daunorubicin is also an anthracycline antibiotic. Daunorubicin can be used in the research of infection and variety of cancers, including leukemia, non-Hodgkin lymphomas, Ewing's sarcoma, Wilms' tumor.
  • HY-B0220S1
    Erythromycin-13C,d3

    Bacterial Antibiotic Infection
    Erythromycin-13C,d3 is the 13C- and deuterium labeled Erythromycin. Erythromycin is a macrolide antibiotic produced by actinomycete Streptomyces erythreus with a broad spectrum of antimicrobial activity. Erythromycin acts by binding to bacterial 50S ribosomal subunits and inhibits RNA-dependent protein synthesis by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid.
  • HY-13062
    Daunorubicin hydrochloride

    Daunomycin hydrochloride; RP 13057 hydrochloride; Rubidomycin hydrochloride

    Topoisomerase DNA/RNA Synthesis ADC Cytotoxin Bacterial Autophagy Apoptosis Antibiotic Cancer Infection Neurological Disease
    Daunorubicin (Daunomycin) hydrochloride is a topoisomerase II inhibitor with potent anti-tumor activity. Daunorubicin hydrochloride inhibits DNA and RNA synthesis. Daunorubicin hydrochloride is a cytotoxin that inhibits cancer cell viability and induces apoptosis and necrosis. Daunorubicin hydrochloride is also an anthracycline antibiotic. Daunorubicin hydrochloride can be used in the research of infection and variety of cancers, including leukemia, non-Hodgkin lymphomas, Ewing's sarcoma, Wilms' tumor.
  • HY-16908A
    Lefamulin acetate

    BC-3781 acetate

    Bacterial Antibiotic Infection
    Lefamulin acetate (BC-3781 acetate) is an orally active antibiotic for community-acquired bacterial pneumonia (CABP) treatment. Lefamulin acetate (BC-3781 acetate) is the first semi-synthetic pleuromutilin for systemic treatment of bacterial infections in humans. Lefamulin acetate (BC-3781 acetate) inhibits protein synthesis by binding to the peptidyl transferase center of the 50S bacterial ribosome, preventing the binding of transfer RNA for peptide transfer.
  • HY-B0220
    Erythromycin

    Bacterial Antibiotic Infection Cancer
    Erythromycin is a macrolide antibiotic produced by actinomycete Streptomyces erythreus with a broad spectrum of antimicrobial activity. Erythromycin binds to bacterial 50S ribosomal subunits and inhibits RNA-dependent protein synthesis by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid[1][2]. Erythromycin also exhibits antitumor and neuroprotective effect in different fields of research[3][4].
  • HY-B0402S
    Amantadine-d15

    1-Adamantanamine-d15; 1-Aminoadamantane-d15

    Influenza Virus Cancer Infection Neurological Disease
    Amantadine-d15 (1-Adamantanamine-d15) is the deuterium labeled Amantadine. Amantadine (1-Adamantanamine) is an antiviral agent with activity against influenza A viruses. Amantadine blocks the proton flow through the M2 ion channel (M2 proton channel of influenza A) and thus prevents the release of viral RNA into the cytoplasm of the infected cells. Amantadine is an antiparkinsonian agent.
  • HY-B0220C
    Erythromycin (aspartate)

    Antibiotic Bacterial DNA/RNA Synthesis Cancer Infection
    Erythromycin aspartate is a macrolide antibiotic produced by actinomycete Streptomyces erythreus with a broad spectrum of antimicrobial activity. Erythromycin aspartate binds to bacterial 50S ribosomal subunits and inhibits RNA-dependent protein synthesis by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid[1][2]. Erythromycin aspartate also exhibits antitumor and neuroprotective effect in different fields of research[3][4].
  • HY-W010832
    Uridine-5'-diphosphate disodium salt

    P2Y Receptor DNA/RNA Synthesis Endogenous Metabolite Metabolic Disease Inflammation/Immunology
    Uridine-5'-diphosphate disodium salt is a potent, selective P2Y6 receptor native agonist (EC50=300 nM; pEC50=6.52 for human P2Y6 receptor). Uridine-5'-diphosphate disodium salt, an endogenous metabolite, catalyzes the glucuronidation of a wide array of substrates and is used in nucleic acid (RNA) biosynthesis.
  • HY-W010820
    Uridine 5'-diphosphate sodium salt

    P2Y Receptor DNA/RNA Synthesis Endogenous Metabolite Metabolic Disease Inflammation/Immunology
    Uridine 5'-diphosphate sodium salt is a potent, selective P2Y6 receptor native agonist (EC50=300 nM; pEC50=6.52) and a potent P2Y14 antagonist (pEC50=7.28). Uridine 5'-diphosphate sodium salt, an endogenous metabolite, catalyzes the glucuronidation of a wide array of substrates and is used in nucleic acid (RNA) biosynthesis.
  • HY-B0220D
    Erythromycin thiocyanate

    Bacterial Antibiotic Infection Cancer
    Erythromycin thiocyanate is a macrolide antibiotic produced by actinomycete Streptomyces erythreus with a broad spectrum of antimicrobial activity. Erythromycin thiocyanate binds to bacterial 50S ribosomal subunits and inhibits RNA-dependent protein synthesis by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid[1][2]. Erythromycin thiocyanate also exhibits antitumor and neuroprotective effect in different fields of research[3][4].
  • HY-B0220B
    Erythromycin (gluceptate)

    Antibiotic Bacterial Cancer Infection
    Erythromycin gluceptate is a macrolide antibiotic produced by actinomycete Streptomyces erythreus with a broad spectrum of antimicrobial activity. Erythromycin gluceptate binds to bacterial 50S ribosomal subunits and inhibits RNA-dependent protein synthesis by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid[1][2]. Erythromycin gluceptate also exhibits antitumor and neuroprotective effect in different fields of research[3][4].
  • HY-N2513
    β-Boswellic acid

    Lipoxygenase DNA/RNA Synthesis Cancer
    β-Boswellic acid is isolated from the gum resin of Boswellia serrate. β-Boswellic acid is a nonreducing-type inhibitor of the 5-lipoxygenase (5-LO) product formation either interacting directly with the 5-LO or blocking its translocation. β-Boswellic acid inhibits the synthesis of DNA, RNA and protein in human leukemia HL-60 cells.
  • HY-150641
    CDK-IN-9

    CDK Apoptosis Cancer
    CDK-IN-9 (compound 24) is a potent CDK inhibitor, also as a molecular glue inducing an interaction between CDK12 and DDB1, with an IC50 values of 4 nM for CDK2/E. CDK-IN-9 leads to polyubiquitination of cyclin K and its subsequent degradation. CDK-IN-9 induce apoptosis through dephosphorylation of retinoblastoma protein and RNA polymerase II.
  • HY-18979
    Lactimidomycin

    Influenza Virus Cancer Infection
    Lactimidomycin is a glutarimide-containing compound isolated from Streptomyces. Lactimidomycin is a potent inhibitor of eukaryotic translation elongation. Lactimidomycin has a potent antiproliferative effect on tumor cell lines and selectively inhibit protein translation. Lactimidomycin inhibits protein synthesis with an IC50 value of 37.82 nM. Lactimidomycin is also a potent and non-toxic inhibitor of dengue virus 2 and other RNA viruses. Anticancer and antiviral activities.
  • HY-129767
    CMLD012612

    Eukaryotic Initiation Factor (eIF) Cancer
    CMLD012612 is an amidino-rocaglate containing a hydroxamate group and is a potent eukaryotic initiation factor 4A (eIF4A) inhibitor. CMLD012612 inhibits cell translation and is cytotoxic to NIH/3T3 cells with an IC50 value of 2 nM. CMLD012612 inhibits eukaryotic translation initiation by modifying the behavior of the RNA helicase (eIF4A) and possesses potent anti-neoplastic activity.
  • HY-B0220E
    Erythromycin A dihydrate

    Bacterial Antibiotic Infection Cancer
    Erythromycin A dihydrate is a macrolide antibiotic produced by actinomycete Streptomyces erythreus with a broad spectrum of antimicrobial activity. Erythromycin A dihydrate binds to bacterial 50S ribosomal subunits and inhibits RNA-dependent protein synthesis by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid[1][2]. Erythromycin A dihydrate also exhibits antitumor and neuroprotective effect in different fields of research[3][4].
  • HY-108875
    Erythromycin stearate

    Antibiotic Bacterial DNA/RNA Synthesis Cancer Infection
    Erythromycin stearate is a macrolide antibiotic produced by actinomycete Streptomyces erythreus with a broad spectrum of antimicrobial activity. Erythromycin stearate binds to bacterial 50S ribosomal subunits and inhibits RNA-dependent protein synthesis by blockage of transpeptidation and/or translocation reactions, without affecting synthesis of nucleic acid[1][2]. Erythromycin stearate also exhibits antitumor and neuroprotective effect in different fields of research[3][4].
  • HY-N144101
    SARS-CoV MPro-IN-2

    SARS-CoV Infection
    SARS-CoV MPro-IN-2 (compound 15) is a potent inhibitor of SARS-CoV-2 M pro with an IC50 value of 72.07 nM. The main protease (M pro) of the virus as the major enzyme processing viral polyproteins contributes to the replication and transcription of SARS-CoV-2 in host cells, and has been characterized as an attractive target in drug discovery. SARS-CoV MPro-IN-2 has the potential for the research of COVID-19.
  • HY-N4192
    Toringin

    Others Cancer Cardiovascular Disease
    Toringin, a bioflavonoid, is isolated from the bark of Docyniopsis tschonoski. Toringin progressively decreases not only the cis-effect of the expanded CTG repeats but cytotoxicity as well. Exposure to isosakuranetin, Toringin rescues PC12 neuronal cells. Flavonoids are efficacious for ameliorating the RNA gain of function caused by expanded CTG repeats, and have various biological activities and beneficial actions against cancers, coronary heart disease, among other pathologies.
  • HY-15256
    Faldaprevir

    BI 201335

    HCV Protease Infection
    Faldaprevir (BI 201335) is a potent, orally active and selective noncovalent inhibitor of NS3/4A protease of HCV (hepatitis C virus) genotypes 1a and 1b, with Ki values of 2.6 and 2.0 nM, respectively. Faldaprevir inhibits HCV RNA replication, with EC50 values of 6.5 and 3.1 nM, respectively. Faldaprevir has potent antiviral activity against chronic HCV infection.
  • HY-143587
    CDK7-IN-2

    CDK Cancer
    CDK7-IN-2 is a potent inhibitor of CDK7. CDK7 is implicated in both temporal control of the cell cycle and transcriptional activity. CDK7 is implicated in the transcriptional initiation process by phosphorylation of Rbpl subunit of RNA Polymerase II (RNAPII). CDK7 has the potential for the research of cancer disease, in particular aggressive and hard- to-treat cancers (extracted from patent WO2019099298A1, compound 1).
  • HY-17624
    Framycetin

    Neomycin B; Fradiomycin B

    Bacterial Antibiotic Infection
    Framycetin (Neomycin B), an aminoglycoside antibiotic, is a potent RNase P cleavage activity inhibitor with a Ki of 35 μM. Framycetin competes for specific divalent metal ion binding sites in RNase P RNA. Framycetin inhibits hammerhead ribozyme with a Ki of 13.5 μM. Framycetin, a 5″-azido neomycin B precursor, binds the Drosha site in miR-525 and is used for hepatic encephalopathy and enteropathogenic E. coli infections.
  • HY-P0063
    Copper tripeptide

    GHK-Cu

    Endogenous Metabolite Inflammation/Immunology
    Copper tripeptide (GHK-Cu), a naturally occurring tripeptide, is first isolated from human plasma, but can be found in saliva and urine. During wound healing, Copper tripeptide may be freed from existing extracellular proteins via proteolysis and serves as a chemoattractant for inflammatory and endothelial cells. Copper tripeptide has been shown to increase messenger RNA production for collagen, elastin, proteoglycans, and glycosaminoglycans in fibroblasts. Copper tripeptide is a Natural Modulator of Multiple Cellular Pathways in Skin Regeneration.
  • HY-17624A
    Framycetin sulfate

    Neomycin B sulfate; Fradiomycin B sulfate

    Antibiotic Bacterial Infection
    Framycetin sulfate (Neomycin B sulfate), an aminoglycoside antibiotic, is a potent RNase P cleavage activity inhibitor with a Ki of 35 μM. Framycetin sulfate competes for specific divalent metal ion binding sites in RNase P RNA. Framycetin sulfate inhibits hammerhead ribozyme with a Ki of 13.5 μM. Framycetin sulfate, a 5″-azido neomycin B precursor, binds the Drosha site in miR-525 and is used for hepatic encephalopathy and enteropathogenic E. coli infections.
  • HY-150599
    HIV-1 inhibitor-43

    HIV Infection
    HIV-1 inhibitor-43 (compound 12) is a potent HIV-1 inhibitor with an EC50 of 21.3 nM, 6.2 nM, < 0.7 nM and < 0.7 nM for Y188L, K103N-Y181C, K103N and Y181C, respectively. HIV-1 inhibitor-43 can reduce HIV-1 RNA and protein p24.
  • HY-134581
    Enpatoran

    M5049

    Toll-like Receptor (TLR) Inflammation/Immunology
    Enpatoran (M5049) is a potent, orally active and dual TLR7/8 inhibitor with IC50s of 11.1 nM and 24.1 nM in HEK293 cells, respectively. Enpatoran is inactive against TLR3, TLR4 and TLR9. Enpatoran can block molecule synthetic ligands and natural endogenous RNA ligands. Enpatoran exhibits excellent pharmacokinetic properties in vivo. Enpatoran can be used for both innate and adaptive autoimmunity blocking research .
  • HY-150680
    SARS-CoV-2 nsp14-IN-1

    SARS-CoV Histone Methyltransferase DNA Methyltransferase Infection
    SARS-CoV-2 nsp14-IN-1 (Compound 3) is a prototypic bisubstrate inhibitor of SARS-CoV-2 Nsp14 MTase with an IC50 value of 0.061 μM. SARS-CoV-2 nsp14-IN-1 (Compound 3) has an excellent selectivity profile over a panel of human methyltransferases, can against apanel of 10 human MTases including histone lysine, proteinarginine, and DNA and RNA MTases.
  • HY-W039442
    2′-Deoxy-2′-fluoroadenosine

    Nucleoside Antimetabolite/Analog Cancer
    2′-Deoxy-2′-fluoroadenosine can be used for the synthesis of 2′-Deoxy-2′-fluoro-modified oligonucleotides hybridized with RNA. 2′-Deoxy-2′-fluoroadenosine can be cleaved efficiently by E. coli purine nucleoside phosphorylase (PNP) to the toxic agent 2-fluoroadenine (FAde). 2′-Deoxy-2′-fluoroadenosine shows excellent in vivo activity against tumors expressing E. coli PNP.
  • HY-109035
    Inarigivir soproxil

    SB9200; GS-9992

    HCV HBV Infection
    Inarigivir soproxil (SB9200) is an agonist of innate immunity and shows potent antiviral activity against resistant HCV variants, with EC50s of 2.2 and 1.0 μM for HCV 1a/1b in cells of genotype 1 HCV replicon systems. Inarigivir soproxil, an orally bioavailable prodrug of SB 9000, has broad-spectrum antiviral activity against RNA viruses including HCV, norovirus, respiratory syncytial virus and influenza and HBV.
  • HY-146722
    Antibacterial agent 89

    Bacterial DNA/RNA Synthesis Infection
    Antibacterial agent 89 is a potent antibacterial agent. Antibacterial agent 89 shows anti-clostridial activity. Antibacterial agent 89 inhibits the release of cytotoxins and the β’CH-σ interaction. Antibacterial agent 89 disrupts the process of bacterial transcription.
  • HY-139311
    YH-53

    SARS-CoV Infection
    YH-53 is a potent 3CL pro inhibitor with Ki values of 6.3 nM, 34.7 nM for SARS-CoV-1 3CL pro and SARS-CoV-2 3CL pro, respectively. YH-53 strongly blocks the SARS-CoV-2 replication. YH-53 is a peptidomimetic compound with a unique benzothiazolyl ketone. YH-53 has the potential for COVID-19 research.
  • HY-139798
    Iboxamycin

    Bacterial Infection
    Iboxamycin is a potent antibiotic candidate bearing a fused bicyclic amino acid residue. Iboxamycin is orally bioavailable, safe and effective in treating both Gram-positive and Gram-negative bacterial infections in mice.
  • HY-102074
    ERDRP-0519

    Others Infection
    ERDRP-0519, an orally bioavailable small-molecule Measles virus (MeV) polymerase inhibitor, prevents measles disease in squirrel monkeys (Saimiri sciureus). ERDRP-0519 inhibits morbilliviruses with nanomolar potency..
  • HY-B0268A
    Enoxacin hydrate

    Enoxacin sesquihydrate; AT-2266 hydrate; CI-919 hydrate

    Bacterial DNA/RNA Synthesis MicroRNA Antibiotic Infection Cancer
    Enoxacin hydrate (Enoxacin sesquihydrate), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC50=126 µg/ml) and topoisomerase IV (IC50=26.5 µg/ml). Enoxacin hydrate is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin hydrate has potent activities against gram-positive and -negative bacteria. Enoxacin hydrate is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing.
  • HY-B0268
    Enoxacin

    AT 2266; CI 919

    Bacterial DNA/RNA Synthesis MicroRNA Antibiotic Cancer Infection
    Enoxacin (AT 2266), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC50=126 µg/ml) and topoisomerase IV (IC50=26.5 µg/ml). Enoxacin is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin has potent activities against gram-positive and -negative bacteria. Enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing.
  • HY-101513
    eIF4A3-IN-1

    Eukaryotic Initiation Factor (eIF) Cancer
    eIF4A3-IN-1 (compound 53a) is a selective eukaryotic initiation factor 4A3 (eIF4A3) inhibitor (IC50=0.26 μM; Kd=0.043 μM), which binds to a non-ATP binding site of eIF4A3 and shows significant cellular nonsense-mediated RNA decay (NMD) inhibition at 10 and 3 μM and can be as a probe for further study of eIF4A3, the exon junction complex (EJC), and NMD.
  • HY-124131
    DS-437

    Histone Methyltransferase Cancer Inflammation/Immunology
    DS-437 is a dual PRMT5/7 inhibitor (IC50s of PRMT5/7=6 μM). DS-437 is selective for PRMT5 and PRMT7 over 29 other human protein-, DNA-, and RNA-methyltransferases. DS-437 is a S-adenosylmethionine (SAM)-competitive inhibitor of PRMT5. DS-437 also inhibits DNMT3A and DNMT3B, with IC50s of 52 and 62 μM, respectively. DS-437 inhibits the methylation of FOXP3.
  • HY-100008
    Peretinoin

    NIK333

    RAR/RXR SphK Autophagy HCV Cancer Infection
    Peretinoin is an oral acyclic retinoid with a vitamin A-like structure that targets retinoid nuclear receptors such as retinoid X receptor (RXR) and retinoic acid receptor (RAR). Peretinoin reduces the mRNA level of sphingosine kinase 1 (SPHK1) in vitro by downregulating a transcription factor, Sp1. Peretinoin prevents the progression of non-alcoholic steatohepatitis (NASH) and the development of hepatocellular carcinoma (HCC) through activating the autophagy pathway by increased Atg16L1 expression. Peretinoin inhibits HCV RNA amplification and virus release by altering lipid metabolism with a EC50 of 9 μM.
  • HY-B0268S1
    Enoxacin-d8 hydrochloride

    Bacterial DNA/RNA Synthesis MicroRNA Antibiotic Cancer Infection
    Enoxacin-d8 (hydrochloride) is deuterium labeled Enoxacin. Enoxacin (AT 2266), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC50=126 µg/ml) and topoisomerase IV (IC50=26.5 µg/ml). Enoxacin is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin has potent activities against gram-positive and -negative bacteria. Enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing.
  • HY-B0268S
    Enoxacin-d8

    Bacterial DNA/RNA Synthesis MicroRNA Antibiotic Cancer Infection
    Enoxacin-d8 (AT 2266-d8) is the deuterium labeled Enoxacin. Enoxacin (AT 2266), a fluoroquinolone, interferes with DNA replication and inhibits bacterial DNA gyrase (IC50=126 µg/ml) and topoisomerase IV (IC50=26.5 µg/ml). Enoxacin is a miRNA processing activator and enhances siRNA-mediated mRNA degradation and promotes the biogenesis of endogenous miRNAs. Enoxacin has potent activities against gram-positive and -negative bacteria. Enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2 (TRBP)-mediated microRNA processing.
  • HY-150760
    GSK5852

    GSK2485852

    HCV Inflammation/Immunology
    GSK5852 (GSK2485852) is an HCV NS5B polymerase inhibitor, with an IC50 value of 50 nM. GSK5852 displays antiviral activity and inhibits HCV with EC50s of 3.0 nM (genotype 1a, GT1a) and 1.7 nM (GT1b), respectively.
  • HY-101257B
    YKL-5-124 TFA

    CDK Cancer
    YKL-5-124 TFA is a potent, selective, irreversible and covalent CDK7 inhibitor with IC50s of 53.5 nM and 9.7 nM for CDK7 and CDK7/Mat1/CycH, respectively. YKL-5-124 TFA is >100-fold greater selective for CDK7 than CDK9 and CDK2, and inactive against CDK12 and CDK13. YKL-5-124 TFA induces a strong cell-cycle arrest, inhibits E2F-driven gene expression, and exhibits little effect on RNA polymerase II phosphorylation status.
  • HY-101257
    YKL-5-124

    CDK Cancer
    YKL-5-124 is a potent, selective, irreversible and covalent CDK7 inhibitor with IC50s of 53.5 nM and 9.7 nM for CDK7 and CDK7/Mat1/CycH, respectively. YKL-5-124 is >100-fold greater selective for CDK7 than CDK9 and CDK2, and inactive against CDK12 and CDK13. YKL-5-124 induces a strong cell-cycle arrest, inhibits E2F-driven gene expression, and exhibits little effect on RNA polymerase II phosphorylation status.
  • HY-107620
    PD 198306

    MEK Neurological Disease
    PD 198306 is a selective MAPK/ERK-kinase (MEK) inhibitor. PD 198306 results in an observable reduction in the Streptozocin induced increase in the level of active ERK1 and 2. Antihyperalgesic effects.
  • HY-N6792
    T-2 Toxin

    T-2 Mycotoxin

    Apoptosis DNA/RNA Synthesis Metabolic Disease
    T-2 Toxin (T-2 Mycotoxin) is a toxic trichothecene mycotoxin produced by various Fusarium species in feedstuffs and cereal grains, LD50 values of T-2 Toxin in mice and rats are 5.2 and 1.5 mg/kg BW a,respectively . T-2 Toxin (T-2 Mycotoxin) can be transformed into a variety of metabolite, the typical metabolites of T-2 toxin in animals are HT-2 toxin and T-2-triol, which are hydrolysates. T-2 Toxin (T-2 Mycotoxin) is an inhibitor of protein synthesis resulting from binding peptidyltransferase, which is an integral part of the 60s ribosomal subunit. T-2 Toxin (T-2 Mycotoxin) inhibits the synthesis of DNA and RNA, interferes with the metabolism of membrane phospholipids, and increases the level of liver lipid peroxides. T-2 Toxin (T-2 Mycotoxin) induces apoptosis in the immune system, gastrointestinal tissues, and fetal tissues.