2. Search Result
Search Result
Results for "

T

" in MCE Product Catalog:

1247

Inhibitors & Agonists

2

Screening Libraries

28

Fluorescent Dye

17

Biochemical Assay Reagents

146

Peptides

4

MCE Kits

112

Inhibitory Antibodies

133

Natural
Products

487

Recombinant Proteins

56

Isotope-Labeled Compounds

13

Antibodies

Cat. No. Product Name Target Research Areas
  • HY-N6792
    T-2 Toxin

    T-2 Mycotoxin

    		 Apoptosis DNA/RNA Synthesis Metabolic Disease
    T-2 Toxin (T-2 Mycotoxin) is a toxic trichothecene mycotoxin produced by various Fusarium species in feedstuffs and cereal grains, LD50 values of T-2 Toxin in mice and rats are 5.2 and 1.5 mg/kg BW a,respectively . T-2 Toxin (T-2 Mycotoxin) can be transformed into a variety of metabolite, the typical metabolites of T-2 toxin in animals are HT-2 toxin and T-2-triol, which are hydrolysates. T-2 Toxin (T-2 Mycotoxin) is an inhibitor of protein synthesis resulting from binding peptidyltransferase, which is an integral part of the 60s ribosomal subunit. T-2 Toxin (T-2 Mycotoxin) inhibits the synthesis of DNA and RNA, interferes with the metabolism of membrane phospholipids, and increases the level of liver lipid peroxides. T-2 Toxin (T-2 Mycotoxin) induces apoptosis in the immune system, gastrointestinal tissues, and fetal tissues.
  • HY-W015764
    T-1105

    		Influenza Virus Infection
    T-1105, a structural analogue of T-705, is a novel broad-spectrum viral polymerase inhibitor. T-1105 inhibits the polymerases of RNA viruses after being converted to ribonucleoside triphosphate (RTP) metabolite. T-1105 has antiviral activity against various RNA viruses. T-1105 can be formed by nicotinamide mononucleotide adenylyltransferase.
  • HY-N6720
    T-2 Triol

    		Endogenous Metabolite Metabolic Disease
    T-2 Triol is a trichothecene mycotoxin derived by the metabolism of T-2 toxin. It is less toxic than T-2 toxin. T-2 Triol major metabolites are evaluated in broiler chickens with Half-lives (t1/2λz), Peak plasma concentrations (Cmax) and Tmax values of 9.6 mins, 563 ng/ml , 2.5 mins, respectively.
  • HY-100682
    T-3256336

    		IAP Cancer
    T-3256336 is a potent and orally active cIAP1 and XIAP inhibitor with IC50s of 1.3, 200 nM, respectively. T-3256336 shows anti-tumor activity.
  • HY-105349
    T-0156

    		Phosphodiesterase (PDE) Neurological Disease
    T-0156 is a potent and selective phosphodiesterase type 5 (PDE5) inhibitor. T-0156 specifically inhibits the hydrolysis of cyclic guanosine monophosphate (cGMP) by PDE5 in a competitive manner (IC50=0.23 nM). T-0156 inhibits PDE6 (IC50=56 nM) and has low potencies against PDE1, PDE2, PDE3, and PDE4 (IC50>10 μM). T-0156 enhances the nitric oxide (NO)/cGMP pathway.
  • HY-125930A
    T-2513 hydrochloride

    		Topoisomerase DNA/RNA Synthesis Cancer
    T-2513 hydrochloride is a selective topoisomerase I inhibitor. T-2513 hydrochloride binds covalently to and stabilizes the topoisomerase I-DNA complex and inhibits DNA replication and RNA synthesis, ultimately leading to cell death.
  • HY-125930
    T-2513

    		Topoisomerase DNA/RNA Synthesis Cancer
    T-2513 is a selective topoisomerase I inhibitor. T-2513 binds covalently to and stabilizes the topoisomerase I-DNA complex and inhibits DNA replication and RNA synthesis, ultimately leading to cell death.
  • HY-N6721
    T-​2 Tetraol

    		Others Infection
    T-​2 Tetraol is a metabolite of T-2 toxin, and also a trichothecene mycotoxin, with less toxicity and is unable to induce apoptosis.
  • HY-19352
    T56-LIMKi

    T5601640

    		 LIM Kinase (LIMK) Cancer
    T56-LIMKi is a selective inhibitor of LIMK2; inhibits the growth of Panc-1 cells with an IC50 of 35.2 μM.
  • HY-B0724B
    Pazufloxacin

    T3761

    		 Bacterial Antibiotic Infection
    Pazufloxacin (T-3761) is a fluoroquinolone antibiotic.
  • HY-106158
    T-1095

    		SGLT Metabolic Disease
    T-1095 is a selective and orally active Na +-glucose cotransporter (SGLT) inhibitor with IC50s of 22.8 µM and 2.3 µM for human SGLT1 and SGLT2, respectively. T-1095 can be used for diabetes research.
  • HY-122635A
    T-448

    		Histone Demethylase Neurological Disease
    T-448 is a specific, orally active and irreversible inhibitor of lysine-specific demethylase 1 (LSD1, an H3K4 demethylase), with an IC50 of 22 nM. T-448 enhances H3K4 methylation in primary cultured rat neurons.
  • HY-136498
    T-705RMP

    		Drug Metabolite Infection
    T-705RMP, a phosphorylated metabolite of T-705, exhibits a very weak inhibitory effect on the IMP dehydrogenase (IMPDH) activities of the host cells, with an IC50 of 601 μM.
  • HY-102045
    T-3764518

    		Stearoyl-CoA Desaturase (SCD) Metabolic Disease
    T-3764518 is a novel and potent stearoyl coenzyme A desaturase (SCD) inhibitor with an IC50 of 4.7 nM.
  • HY-W190966
    t-Boc-Aminooxy-PEG4-t-butyl ester

    		PROTAC Linkers Others
    t-Boc-Aminooxy-PEG4-t-butyl ester is a PEG-based PROTAC linker can be used in the synthesis of PROTACs.
  • HY-142102
    T988C

    (+)-T988C

    		 Others Cancer
    T988C is a heptacyclic epidithiodioxopiperazine (ETP) natural product. T988C shows strong cytotoxicity to cultured P388 leukemia cells.
  • HY-N6792S
    T-2 Toxin-13C24

    T-2 Mycotoxin-13C24

    		 Isotope-Labeled Compounds Metabolic Disease
    T-2 Toxin- 13C24 (T-2 Mycotoxin- 13C24) is 13C-labeled T-2 Toxin (HY-N6792). T-2 Toxin (T-2 Mycotoxin) is a toxic trichothecene mycotoxin produced by various Fusarium species in feedstuffs and cereal grains. T-2 Toxin (T-2 Mycotoxin) inhibits the synthesis of DNA and RNA, interferes with the metabolism of membrane phospholipids, and increases the level of liver lipid peroxides. T-2 Toxin (T-2 Mycotoxin) induces apoptosis in the immune system, gastrointestinal tissues, and fetal tissues.
  • HY-103085
    T-3775440 hydrochloride

    		Histone Demethylase Cancer
    T-3775440 (hydrochloride) is an irreversible lysine-specific histone demethylase (LSD1) inhibitor with an IC50 value of 2.1 nM.
  • HY-135956
    T3 Acyl glucuronide

    		Endogenous Metabolite Metabolic Disease
    T3 Acyl glucuronide, an endogenous metabolite, is the acyl glucuronide formation of triiodothyronine (T3).
  • HY-114271A
    T3-ATA (S-isomer)

    		Thyroid Hormone Receptor Endocrinology
    T3-ATA S-isomer is the S-isomer of T3-ATA, which is the active form of the thyroid hormone.
  • HY-114272A
    T4-ATA (S-isomer)

    		Thyroid Hormone Receptor Endocrinology
    T4-ATA S-isomer is the S-isomer of T4-ATA, which is the active form of the thyroid hormone.
  • HY-114220
    T-2307

    		Fungal Infection
    T-2307, an arylamidine, has antifungal activities in vitro and in vivo. T-2307 exhibits broad-spectrum activity against clinically significant pathogens, including Candida species (MIC range, 0.00025 to 0.0078 μg/ml), Cryptococcus neoformans (MIC range, 0.0039 to 0.0625 μg/ml), and Aspergillus species (MIC range, 0.0156 to 4 μg/mL) .
  • HY-125961
    T3Inh-1

    		Others Cancer
    T3Inh-1 is a potent and selective inhibitor of ppGalNAc-T3 (IC50=7 µM). T3Inh-1 reduces FGF23 hormone levels in both tissue cells and mice, without causing any toxic side effects. T3Inh-1 also prevents breast cancer cells. The enzyme ppGalNAc-T3 is implicated in at least two medically important pathways: cancer metastasis and stabilization of FGF23 (regulates phosphate levels in the bloodstream).
  • HY-146404
    T761-0184

    		nAChR Neurological Disease
    T761-0184 is a potent α7 nicotinic receptor (nAChR) antagonist.
  • HY-148185
    T01-1

    		Others Cancer
    T01-1 is an anticancer agent (camptothecin derivative) with good anti-proliferative activity.
  • HY-P2251
    T-peptide

    		HIV Microtubule/Tubulin Cancer Infection Inflammation/Immunology
    T-peptide, a Tuftsin analog, can be used for the research of human immunodeficiency virus (HIV) infection. T-peptide prevents cellular immunosuppression and improves survival rate in septic mice. T-peptide also can inhibit the growth of residual tumor cells after surgical resection.
  • HY-10626
    T0901317

    		LXR FXR ROR Apoptosis Cancer Metabolic Disease Cardiovascular Disease
    T0901317 is an orally active and highly selective LXR agonist with an EC50 of 20 nM for LXRα. T0901317 activates FXR with an EC50 of 5 μM. T0901317 is RORα and RORγ dual inverse agonist with Ki values of 132 nM and 51 nM, respectively. T0901317 induces apoptosis and inhibits the development of atherosclerosis in low-density lipoprotein (LDL) receptor-deficient mice.
  • HY-12270
    T-5224

    		AP-1 MMP Others
    T-5224 is a transcription factor c-Fos/activator protein (AP)-1 inhibitor with anti-inflammatory effects, which specifically inhibits the DNA binding activity of c-Fos/c-Jun without affecting other transcription factors. T-5224 inhibits the IL-1β-induced up-regulation of Mmp-3, Mmp-13 and Adamts-5 transcription.
  • HY-120356A
    T-1101 tosylate

    TAI-95 tosylate

    		 Apoptosis Cancer
    T-1101 tosylate (TAI-95 tosylate) is a Hec1/Nek2 (Highly expressed in cancer 1 / NIMA-related kinase 2) inhibitor with antitumor activity. T-1101 tosylate is inactive toward normal cells, kinases and hERG
  • HY-18341
    L-Thyroxine

    Levothyroxine; T4

    		 Thyroid Hormone Receptor Endogenous Metabolite Endocrinology
    L-Thyroxine (Levothyroxine; T4) is a synthetic hormone for the research of hypothyroidism. DIO enzymes convert biologically active thyroid hormone (Triiodothyronine,T3) from L-Thyroxine (T4).
  • HY-139308
    T0467

    		Mitochondrial Metabolism Neurological Disease
    T0467 activates parkin mitochondrial translocation in a PINK1-dependent manner in vitro. T0467 do not induce mitochondrial accumulation of PINK1in dopaminergic neurons. T0467 is a potential compound for PINK1-Parkin signaling activation, and can be used for parkinson's disease and related disorders research.
  • HY-107533
    T-98475

    		Others Endocrinology
    T-98475 (Compound 26d) is a potent, orally active, non-peptide luteinizing hormone-releasing hormone (LHRH) receptor antagonist with an IC50 of 0.2 nM.
  • HY-105049
    T-91825

    PPI-0903M

    		 Bacterial Infection
    T-91825 (PPI-0903M), an N-phosphono-type cephalosporin, is the active form of TAK-599. T-91825 is active against both gram-positive and gram-negative bacteria.
  • HY-122635
    T-448 free base

    		Histone Demethylase Neurological Disease
    T-448 free base is a specific, orally active and irreversible inhibitor of lysine-specific demethylase 1 (LSD1, an H3K4 demethylase), with an IC50 of 22 nM. T-448 free base enhances H3K4 methylation in primary cultured rat neurons.
  • HY-16906
    T338C Src-IN-2

    		Src Cancer
    T338C Src-IN-2 is a potent mutant c-Src T338C kinase inhibitor with IC50 of 317 nM; also inhibits T338C/V323A and T338C/V323S with IC50 of 57 nM/19 nM.
  • HY-U00028
    T 82

    		5-HT Receptor Cholinesterase (ChE) Neurological Disease
    T 82 is a potent 5-HT3 antagonist and acetylcholinesterase (AChE) inhibitor, used for treatment of Alzheimer's Disease.
  • HY-13202
    T0070907

    		PPAR Cancer
    T0070907 is a potent PPARγ antagonist with a Ki of 1 nM.
  • HY-112296
    T025

    		CDK Apoptosis DYRK Cancer
    T025 is an orally active and highly potent inhibitor of Cdc2-like kinase (CLKs), with Kd values of 4.8, 0.096, 6.5, 0.61, 0.074, 1.5 and 32 nM for CLK1, CLK2, CLK3, CLK4, DYRK1A, DYRK1B and DYRK2, respectively. T025 induces caspase-3/7-mediated cell apoptosis. T025 reduces CLK-dependent phosphorylation. T025 exerts anti-proliferative activities in both hematological and solid cancer cell lines (IC50 values: 30-300 nM). T025 has an anti-tumor efficiency, mainly for MYC-driven disease research.
  • HY-18341B
    L-Thyroxine sodium

    Levothyroxine sodium; T4 sodium

    		 Thyroid Hormone Receptor Endogenous Metabolite Endocrinology Cancer
    L-Thyroxine sodium (Levothyroxine sodium) is a synthetic hormone for the research of hypothyroidism. DIO enzymes convert biologically active thyroid hormone (Triiodothyronine,T3) from L-Thyroxine (T4).
  • HY-14925
    Lapaquistat

    T-91485

    		 Endogenous Metabolite Drug Metabolite Metabolic Disease
    Lapaquistat (T-91485), a cholesterol biosynthesis inhibitor, is the active metabolite of Lapaquistat acetate (HY-16274). Lapaquistat can decrease statin-induced myotoxicity in lipid-lowering therapy.
  • HY-B0724A
    Pazufloxacin mesylate

    T-3762; Pazufloxacin methanesulfonate; Pazufloxacin mesilate

    		 Bacterial Antibiotic Infection
    Pazufloxacin (T-3761) mesylate is a fluoroquinolone antibiotic.
  • HY-16905
    T338C Src-IN-1

    		Src Cancer
    T338C Src-IN-1 is a potent mutant-Src T338C inhibitor; exhibited the most potent inhibition of T338C(IC50=111 nM) relative to WT c-Src (10-fold increase).
  • HY-P0052
    Enfuvirtide

    T20; DP178

    		 HIV Infection
    Enfuvirtide (T20;DP178) is an anti-HIV-1 fusion inhibitor peptide.
  • HY-108313
    T-00127_HEV1

    		PI4K Infection
    T-00127_HEV1 is a phosphatidylinositol 4-kinase III beta (PI4KB) inhibitor with an IC50 of 60 nM.
  • HY-124346
    T-3364366

    		Others Metabolic Disease
    T-3364366 is a reversible, slow-binding, thienopyrimidinone delta-5 desaturase (D5D) inhibitor with IC50s of 1.9 nM and 2.1 nM in HepG2 and RLN-10 cells, respectively. T-3364366 exhibits potent D5D (IC500=19 nM) inhibitory activity and excellent selectivity away from delta-6 desaturase (D6D, IC50=6200 nM) and delta-9 desaturase (stearoyl-CoA desaturase, SCD,50 >10000 nM) in the enzymatic activity assay.
  • HY-118170
    T16A(inh)-C01

    		Chloride Channel Others
    T16A(inh)-C01 is an inhibitor of TMEM16A (ANO1). T16A(inh)-C01 blocks chloride channel mediated by ANO1 with an IC50 of 8.4 μM, without interfering with calcium signaling.
  • HY-120356S1
    T-1101-d7

    TAI-95-d7

    		 Isotope-Labeled Compounds Others
    T-1101-d7 is the deuterium labeled T-1101[1].
  • HY-101185
    T808

    		Tau Protein Neurological Disease
    T808 is a tau-selective Alzheimer’s PET ligand. T808 is a type of imaging agent used in positron emission tomography (PET) scans. It is a radiotracer that is used to help visualize certain areas of the body, such as the brain, in order to diagnose and monitor various medical conditions.
  • HY-W127828
    t-Boc-aminocaproicnitrilotriacetic acid

    T-BOC-AC-NTA

    		 Biochemical Assay Reagents Others
    t-Boc-aminocaproicnitrilotriacetic Acid is a biochemical reagent that can be used as a biological material or organic compound for life science related research.
  • HY-100518
    T-26c

    		MMP Inflammation/Immunology
    T-26c is highly potent and selective matrix metalloproteinase-13 (MMP-13) inhibitor with an IC50 of 6.75 pM and more than 2600-fold selectivity over the other related metalloenzymes.
  • HY-14768
    Favipiravir

    T-705

    		 DNA/RNA Synthesis Influenza Virus SARS-CoV Bacterial Infection
    Favipiravir (T-705) is a potent viral RNA polymerase inhibitor, it is phosphoribosylated by cellular enzymes to its active form, Favipiravir-ribofuranosyl-5′-triphosphate (RTP). Favipiravir-RTP inhibits the influenza viral RNA-dependent RNA polymerase (RdRP) activity with an IC50 of 341 nM.
  • HY-P35433
    Tifuvirtide

    T-1249

    		 HIV Inflammation/Immunology
    Tifuvirtide (T-1249) is a peptide human immunodeficiency virus type-1 (HIV-1) fusion inhibitor. Tifuvirtide is a synthetically designed hybrid retroviral envelope polypeptide. Tifuvirtide has antiretroviral activity. Tifuvirtide can be used for the research of HIV infection.
  • HY-19744
    T6167923

    		MyD88 Inflammation/Immunology
    T6167923 is a selective inhibitor of MyD88-dependent signaling pathways. T6167923 directly binds to Toll/IL1 receptor (TIR) domain of MyD88 and disrupts MyD88 homodimeric formation. T6167923 inhibits NF-κB driven Staphylococcus enterotoxin AP (SEAP) activity, and improves anti-inflammatory activity with IC50s of 2.7  μM, 2.9 μM, 2.66 μM and 2.66 μM for IFN-γ, IL-1β, IL-6 and TNF-α, respectively.
  • HY-103033
    T.cruzi-IN-1

    		Parasite Infection
    T.cruzi-IN-1 is a potent Trypanosoma cruzi inhibitor with an IC50 of 8 nM. T.cruzi-IN-1, a 4-trifluoromethyl substituted analog, has the potential for both the acute and chronic stages of Chagas disease.
  • HY-101184
    T807

    AV-1451

    		 Tau Protein Neurological Disease
    T807 a novel tau positron emission tomography (PET) tracer.
  • HY-113924
    Tri(t-butoxycarbonylethoxymethyl) ethanol

    		PROTAC Linkers Cancer
    Tri(t-butoxycarbonylethoxymethyl) ethanol is an alkyl/ether-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-32219
    T863

    		Acyltransferase Metabolic Disease
    T863 is an orally active, selective and potent DGAT1 (Acyl-CoA:diacylglycerol acyltransferase 1) inhibitor that interacts with the acyl-CoA binding site of DGAT1, and inhibits triacylglycerol synthesis in cells.
  • HY-P0052A
    Enfuvirtide acetate

    T20 acetate; DP178 acetate

    		 HIV Infection
    Enfuvirtide (T20; DP178) acetate is an anti-HIV-1 fusion inhibitor peptide.
  • HY-P99392
    Teclistamab

    		CD3 Cancer
    Teclistamab is a human bispecific antibody to BCMA and CD3 that recognizes BCMA on target cells and CD3 on T cells and induces T cell-mediated cytotoxicity leading to T cell activation and subsequent target cell lysis. Teclistamab can be used in studies of diseases related to multiple myeloma (MM).
  • HY-100612
    T16Ainh-A01

    		Chloride Channel Others
    T16Ainh-A01, an aminophenylthiazole, is a potent transmembrane protein 16A (TMEM16A) inhibitor, inhibiting TMEM16A-mediated chloride currents with an IC50 value of ~1 µM. TMEM16A (ANO1) functions as a calcium-activated chloride channel (CaCC).
  • HY-W074541
    Girard’s reagent T

    Trimethylacetohydrazideammonium chloride

    		 Biochemical Assay Reagents Others
    Girard’s reagent T is a biochemical reagent that can be used as a biological material or organic compound for life science related research.
  • HY-140414
    t-Boc-Aminooxy-PEG12-acid

    		PROTAC Linkers Cancer
    t-Boc-Aminooxy-PEG12-acid is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-144076
    t-Boc-amido-PEG10-acid

    		PROTAC Linkers Cancer
    t-Boc-amido-PEG10-acid is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132100
    Thiol-PEG2-t-butyl ester

    		PROTAC Linkers Cancer
    Thiol-PEG2-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-10035
    TTA-P2

    T-Type calcium channel inhibitor

    		 Calcium Channel Neurological Disease
    TTA-P2 (T-Type calcium channel inhibitor) is a potent inhibitor of T-Type calcium channel. TTA-P2 penetrates well the CNS and blocks the native T-type currents in deep cerebellar nuclear neurons, the window current is completely abolished both for wild-type and mutant Cav3.1 channels. TTA-P2 has the potential for the research of neurology disease.
  • HY-110111
    T2AA

    		DNA/RNA Synthesis Cancer
    T2AA is a monoubiquitinated proliferating cell nuclear antigen (PCNA) inhibitor that prevents DNA repair, increases double-strand break (DSB) formation and promotes necroptosis and cell cycle arrest in G1 phase.
  • HY-D0218
    Thioflavin T

    Basic Yellow 1

    		 Amyloid-β Others
    Thioflavin T is a cationic Benzothiazole dye that shows enhanced fluorescence upon binding to amyloid in tissue sections.
  • HY-135103
    Tauro-β-muricholic acid sodium

    T-βMCA sodium

    		 FXR Cancer
    Tauro-β-muricholic Acid sodium (T-βMCA sodium), a endogenous metabolite, is a competitive and reversible farnesoid X receptor (FXR) antagonist, with an IC50 of 40 μM.
  • HY-140378
    t-Boc-Aminooxy-PEG8-Ms

    		PROTAC Linkers Cancer
    t-Boc-Aminooxy-PEG8-Ms is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140437
    t-Boc-Aminooxy-PEG7-methane

    		PROTAC Linkers Cancer
    t-Boc-Aminooxy-PEG7-methane is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140418
    t-Boc-Aminooxy-PEG12-NHS ester

    		PROTAC Linkers Cancer
    t-Boc-Aminooxy-PEG12-NHS ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140434
    t-Boc-Aminooxy-PEG5-azide

    		PROTAC Linkers Cancer
    t-Boc-Aminooxy-PEG5-azide is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140054
    t-Boc-aminooxy-PEG6-propargyl

    		PROTAC Linkers Cancer
    t-Boc-aminooxy-PEG6-propargyl is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140436
    t-Boc-Aminooxy-PEG7-bromide

    		PROTAC Linkers Cancer
    t-Boc-Aminooxy-PEG7-bromide is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140417
    t-Boc-Aminooxy-PEG4-NHS ester

    		PROTAC Linkers Cancer
    t-Boc-Aminooxy-PEG4-NHS ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140429
    t-Boc-Aminooxy-PEG7-amine

    		PROTAC Linkers Cancer
    t-Boc-Aminooxy-PEG7-amine is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140419
    t-Boc-Aminooxy-PEG12-Boc

    		PROTAC Linkers Cancer
    t-Boc-Aminooxy-PEG12-Boc is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140424
    t-Boc-Aminooxy-PEG8-alcohol

    		PROTAC Linkers Cancer
    t-Boc-Aminooxy-PEG8-alcohol is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140431
    t-Boc-Aminooxy-PEG2-azide

    		PROTAC Linkers Cancer
    t-Boc-Aminooxy-PEG2-azide is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140422
    t-Boc-Aminooxy-PEG3-alcohol

    		PROTAC Linkers Cancer
    t-Boc-Aminooxy-PEG3-alcohol is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-143821
    t-Boc-Aminooxy-PEG4-amine

    		PROTAC Linkers Cancer
    t-Boc-Aminooxy-PEG4-amine is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-143825
    t-Boc-Aminooxy-PEG11-amine

    		PROTAC Linkers Cancer
    t-Boc-Aminooxy-PEG11-amine is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-101467A
    Trilaciclib hydrochloride

    G1T28 hydrochloride

    		 CDK Cancer
    Trilaciclib hydrochloride (G1T28 hydrochloride) is a CDK4/6 inhibitor with IC50s of 1 nM and 4 nM for CDK4 and CDK6, respectively.
  • HY-13563A
    Batabulin sodium

    T138067 sodium

    		 Microtubule/Tubulin Apoptosis Cancer
    Batabulin sodium (T138067 sodium) is an antitumor agent, which binds covalently and selectively to a subset of the β-tubulin isotypes, thereby disrupting microtubule polymerization. Batabulin sodium affects cell morphology and leads to cell-cycle arrest ultimately induces apoptotic cell death.
  • HY-13563
    Batabulin

    T138067

    		 Microtubule/Tubulin Apoptosis Cancer
    Batabulin (T138067) is an antitumor agent, which binds covalently and selectively to a subset of the β-tubulin isotypes, thereby disrupting microtubule polymerization. Batabulin affects cell morphology and leads to cell-cycle arrest ultimately induces apoptotic cell death.
  • HY-P99390
    Tepoditamab

    MCLA 117

    		 CD3 Cancer
    Tepoditamab (MCLA-117) is a bispecific monoclonal antibody that binds to CLEC12A of myeloid cells and CD3 of cytotoxic T cells. Among others, CLEC12A is a myeloid differentiation antigen. Tepoditamab (MCLA-117) kills AML leukaemia mother cells and AML leukaemia stem cells, induces T cell-mediated proliferative lysis of AML cells and can be used in acute myeloid leukaemia (AML) research.
  • HY-148494
    Tivumecirnon

    FLX475

    		 CCR Cancer
    Tivumecirnon (FLX475) is a potent CCR4 antagonist that blocks regulatory T cells that interfere with effective antitumor immune responses and has antitumor activity.
  • HY-143829
    t-Boc-N-amido-PEG15-Br

    		PROTAC Linkers Cancer
    t-Boc-N-amido-PEG15-Br is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-W096165
    t-Boc-N-amido-PEG6-Tos

    		PROTAC Linkers Cancer
    t-Boc-N-amido-PEG6-Tos is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-143828
    t-Boc-N-amido-PEG10-Br

    		PROTAC Linkers Cancer
    t-Boc-N-amido-PEG10-Br is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-147708
    T-Type calcium channel inhibitor 2

    		Calcium Channel Cancer
    T-Type calcium channel inhibitor 2 (compound 6g) is a potent T-type calcium channel inhibitor with IC50s of 31.0, 83.1, 69.3 µM for Cav3.1 (α1G), Cav3.2 (α1H), Cav3.3 (α1I) (α1H), respectively. T-Type calcium channel inhibitor 2 shows cytotoxicity for A549, HCT-116 cells with IC50s of 5.0, 6.4 µM, respectively.
  • HY-113974
    trans-AUCB

    t-AUCB

    		 Epoxide Hydrolase Cancer
    trans-AUCB (t-AUCB) is a potent, orally active and selective soluble epoxide hydrolase (sEH) inhibitor with IC50s of 1.3 nM, 8 nM, 8 nM for hsEH, mouse sEH and rat sEH, respectively. trans-AUCB has anti-glioma activity.
  • HY-P3410
    Trichomide A

    		SHP2 Phosphatase Inflammation/Immunology
    Trichomide A is a potent activator of SHP2. Trichomide A is a natural cyclodepsipeptide. Trichomide A displays immunosuppressive activity against activated T lymphocyte–mediated immune responses in Con A-activated T cells. Trichomide A have the potential for the research of immune-related skin diseases.
  • HY-18341S1
    Thyroxine hydrochloride-13C6

    Levothyroxine-13C6; T4-13C6

    		 Thyroid Hormone Receptor Endogenous Metabolite Endocrinology
    Thyroxine hydrochloride- 13C6 is the 13C-labeled L-Thyroxine. L-Thyroxine (Levothyroxine; T4) is a synthetic hormone for the research of hypothyroidism. DIO enzymes convert biologically active thyroid hormone (Triiodothyronine,T3) from L-Thyroxine (T4)[1].
  • HY-W096080
    t-Butyl acetate-PEG2-CH2COOH

    		PROTAC Linkers Cancer
    t-Butyl acetate-PEG2-CH2COOH is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-W096082
    t-Butyl acetate-PEG3-CH2COOH

    		PROTAC Linkers Cancer
    t-Butyl acetate-PEG3-CH2COOH is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-P4810
    Polyphemusin II-Derived Peptide

    T140

    		 CXCR Infection
    Polyphemusin II-Derived Peptide (T140), a CXCR4 inhibitor, shows high inhibitory activity against HIV-1 entry and the inhibitory effect on the binding of an anti-CXCR4 monoclonal antibody (12G5) to CXCR4.
  • HY-143830
    t-Boc-N-amido-PEG2-C6-Cl

    		PROTAC Linkers Cancer
    t-Boc-N-amido-PEG2-C6-Cl is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-138139A
    AXC-715 hydrochloride

    T785 hydrochloride

    		 Toll-like Receptor (TLR) Inflammation/Immunology
    AXC-715 (T785) hydrochloride is a TLR7/TLR8 dual agonist, extracted from patent WO2020168017 A1. AXC-715, compound D from WO2020190734A1, can be used for synthesis of antibody-adjuvant immunoconjugates, comprising an antibody construct that binds programmed death-ligand 1 (PD-L1) linked to one or more adjuvants.
  • HY-138139B
    AXC-715 trihydrochloride

    T785 trihydrochloride

    		 Toll-like Receptor (TLR) Inflammation/Immunology
    AXC-715 (T785) trihydrochloride is a TLR7/TLR8 dual agonist, extracted from patent WO2020168017 A1. AXC-715 trihydrochloride, compound D from WO2020190734A1, can be used for synthesis of antibody-adjuvant immunoconjugates, comprising an antibody construct that binds programmed death-ligand 1 (PD-L1) linked to one or more adjuvants.
  • HY-130422
    Tos-PEG4-t-butyl ester

    Tos-PEG4-Boc

    		 PROTAC Linkers Cancer
    Tos-PEG4-t-butyl ester (Tos-PEG4-Boc) is a PROTAC linker, which refers to the PEG composition. Tos-PEG4-t-butyl ester (Tos-PEG4-Boc) can be used in the synthesis of a series of PROTACs, such as BI-3663 (HY-111546). BI-3663 is a highly selective PTK2/FAK PROTAC, with cereblon ligands to hijack E3 ligases for PTK2 degradation, and inhibits PTK2 with an IC50 of 18 nM.
  • HY-103336
    Tocrifluor 1117

    T1117

    		 GPR55 Cannabinoid Receptor Cardiovascular Disease
    Tocrifluor 1117 (T1117), a fluorescent form of the cannabinoid CB1 receptor antagonist AM251 (HY-15443), is a selective fluorescent GPR55 ligand. Tocrifluor 1117 is a potent tool for identifying the cellular location of cannabinoid receptors (including GPR55 in living tissues) (Ex/Em=543/590 nm).
  • HY-18555
    TMPA

    		AMPK Cancer Metabolic Disease Inflammation/Immunology
    TMPA is a high-affinity Nur77 antagonist that binds to Nur77 leading to the release and shuttling of LKB1 in the cytoplasm to activate AMPKα. TMPA effectively lowers blood glucose and attenuates insulin resistance in type II db/db, high-fat diet and streptozotocin-induced diabetic mice. TMPA reduces RICD (restimulation-induced cell death) in human T cells, can also be used in studies of cancer and T-cell apoptosis dysregulation.
  • HY-115400
    1V209

    TLR7 agonist T7

    		 Toll-like Receptor (TLR) Cancer
    1V209 (TLR7 agonist T7) is a Toll-like receptor 7 (TLR7) agonist and has anti-tumor effects. 1V209 can be conjugated with various polysaccharides to improve its water solubility, and enhance its efficacy, and maintain low toxicity.
  • HY-112514
    1,3,6,8-Tetrahydroxynaphthalene

    1,3,6,8-THN; T4HN

    		 Others Others
    1,3,6,8-Tetrahydroxynaphthalene (T4HN) is an indispensable precursor to DHN (1,8-Dihydroxynaphthalene) melanin and is an unique symmetrical compound of polyketide origin.
  • HY-142118
    Trabedersen

    AP 12009

    		 TGF-beta/Smad Cancer
    Trabedersen (AP 12009) is an antisense oligodeoxynucleotide that specifically inhibits TGF-β2 (TGF-beta/Smad). Trabedersen can be used for the study of malignant brain tumors and other solid tumors overexpressing TGF-β2, such as those of the skin, pancreas and colon.
  • HY-147406
    Tonlamarsen

    ION-904

    		 Endogenous Metabolite Cardiovascular Disease
    Tonlamarsen is a angiotensinogen synthesis reducer, with antihypertensive activity.
  • HY-12279
    Umbralisib

    TGR-1202; RP5264

    		 PI3K Casein Kinase Cancer
    Umbralisib (TGR-1202) is an orally active, potent and selective dual PI3Kδ and casein kinase-1-ε (CK1ε) inhibitor, with EC50 of 22.2 nM and 6.0 μM, respectively. Umbralisib exhibits unique immunomodulatory effects on chronic lymphocytic leukemia (CLL) T cells. Umbralisib can be used for haematological malignancies reseach.
  • HY-151123
    Pelacarsen

    AKCEA-APO(a)-LRx; TQJ230

    		 Others Cardiovascular Disease
    Pelacarsen (AKCEA-APO(a)-LRx) is a liver-specific antisense oligonucleotide against apolipoprotein(a) that reduces lipoprotein(a) up to 80% with good tolerability.
  • HY-12279B
    Umbralisib sulfate

    TGR-1202 sulfate; RP-5264 sulfate

    		 PI3K Casein Kinase Cancer
    Umbralisib (TGR-1202) sulfate is an orally active, potent and selective dual PI3Kδ and casein kinase-1-ε (CK1ε) inhibitor, with EC50 of 22.2 nM and 6.0 μM, respectively. Umbralisib sulfate exhibits unique immunomodulatory effects on chronic lymphocytic leukemia (CLL) T cells. Umbralisib sulfate can be used for haematological malignancies reseach.
  • HY-17631A
    Edonerpic maleate

    T-817 maleate; T-817MA

    		 Amyloid-β Neurological Disease
    Edonerpic maleate is a novel neurotrophic agent which can inhibit amyloid-β peptides (Aβ).
  • HY-P9975
    Theralizumab

    TGN1412

    		 CD28 Inflammation/Immunology
    Theralizumab (TGN1412) is a superagonist anti-CD28 monoclonal antibody that directly stimulates T cells. Theralizumab can be used for the research of rheumatoid arthritis.
  • HY-12279C
    Umbralisib hydrochloride

    TGR-1202 hydrochloride; RP5264 hydrochloride

    		 PI3K Casein Kinase Cancer
    Umbralisib (TGR-1202) hydrochloride is an orally active, potent and selective dual PI3Kδ and casein kinase-1-ε (CK1ε) inhibitor, with EC50 of 22.2 nM and 6.0 μM, respectively. Umbralisib hydrochloride exhibits unique immunomodulatory effects on chronic lymphocytic leukemia (CLL) T cells. Umbralisib hydrochloride can be used for haematological malignancies reseach.
  • HY-12279A
    Umbralisib tosylate

    TGR-1202 tosylate; RP5264 tosylate

    		 PI3K Casein Kinase Cancer
    Umbralisib (TGR-1202) tosylate is an orally active, potent and selective dual PI3Kδ and casein kinase-1-ε (CK1ε) inhibitor, with EC50 of 22.2 nM and 6.0 μM, respectively. Umbralisib tosylate exhibits unique immunomodulatory effects on chronic lymphocytic leukemia (CLL) T cells. Umbralisib tosylate can be used for haematological malignancies reseach.
  • HY-152880
    2’-Deoxy-2’-fluoro-arabino-tubercidine

    T 70179

    		 Nucleoside Antimetabolite/Analog Others
    2’-Deoxy-2’-fluoro-arabino-tubercidine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc.
  • HY-17009
    Iguratimod

    T614

    		 Macrophage migration inhibitory factor (MIF) COX Inflammation/Immunology
    Iguratimod is an antirheumatic agent, acts as an inhibitor of COX-2, with an IC50 of 20 μM (7.7 μg/mL), but shows no effect on COX-1. Iguratimod also inhibits macrophage migration inhibitory factor (MIF) with an IC50 of 6.81 μM.
  • HY-14957
    Ozenoxacin

    T-3912

    		 Bacterial Antibiotic Infection
    Ozenoxacin is a nonfluorinated quinolone antibacterial, which shows potent activities against the main microorganisms isolated from skin and soft tissue infections.
  • HY-P99325
    Toralizumab

    IDEC-131; Anti-Human CD40 ligand Recombinant Antibody

    		 TNF Receptor Inflammation/Immunology
    Toralizumab (IDEC-131) is a humanized monoclonal antibody (mAb) against CD40L (CD154) comprised of human gamma 1 heavy chains and human kappa light chains. Toralizumab binds specifically to human CD40L on T cells, thereby preventing CD40 signaling. Toralizumab, a immunosuppressive agent, has the potential for active systemic lupus erythematosus (SLE) research.
  • HY-P99827
    Cobolimab

    TSR-022; GSK4069889

    		 Tim3 Cancer
    Cobolimab (TSR-022) is an anti-TIM-3 monoclonal antibody. Cobolimab mediates the internalization of TIM3 with an IC50 value of 0.4464 nM. Cobolimab has potential application in solid tumors and non-small cell lung cancer (NSCLC).
  • HY-135955
    Levothyroxine acyl glucuronide

    Thyroxine acyl-β-D-glucuronide

    		 Endogenous Metabolite Metabolic Disease
    Levothyroxine acyl glucuronide (Thyroxine Acyl-β-D-glucuronide), an endogenous metabolite, is the acyl glucuronide formation of thyroxine (T4).
  • HY-U00220
    KAT681

    T0681

    		 Thyroid Hormone Receptor Metabolic Disease Endocrinology
    KAT681 is a liver-selective thyromimetic.
  • HY-114266
    UC-1728

    t-TUCB

    		 Epoxide Hydrolase Inflammation/Immunology Cardiovascular Disease
    UC-1728 is a potent rabbit soluble epoxide hydrolase (sEH) inhibitor, with an IC50 of 2 nM on rabbit liver.
  • HY-D0984A
    TMRM Perchlorate

    T668

    		 Fluorescent Dye Others
    Rhodamine dyes are membrane-permeable cationic fluorescent probes that specifically recognize mitochondrial membrane potentials, thereby attaching to mitochondria and producing bright fluorescence, and at certain concentrations, rhodamine dyes have low toxicity to cells, so they are commonly used to detect mitochondria in animal cells, plant cells, and microorganisms.
  • HY-P9921
    Trastuzumab emtansine

    Ado-Trastuzumab emtansine; PRO132365; T-DM 1

    		 Antibody-Drug Conjugates (ADCs) EGFR Cancer
    Trastuzumab emtansine (Ado-Trastuzumab emtansine) is an antibody-drug conjugate (ADC) that incorporates the HER2-targeted antitumor properties of trastuzumab with the cytotoxic activity of the microtubule-inhibitory agent DM1 (derivative of maytansine). Trastuzumab emtansine can be used for the research of advanced breast cancer.
  • HY-W008859
    Tetrac

    Tetraiodothyroacetic acid; 3,3',5,5'-Tetraiodothyroacetic acid

    		 Integrin Endogenous Metabolite Cancer
    Tetrac (Tetraiodothyroacetic acid), a derivative of L-thyroxine (T4), is a thyrointegrin receptor antagonist. Tetrac blocks the actions of T4 and 3,5,3'-triiodo-L-thyronine (T3) at the cell surface receptor for thyroid hormone on integrin αvβ3. Tetra has anti-angiogenic and anti-tumor activities.
  • HY-B1802A
    Tosufloxacin tosylate hydrate

    A-61827 tosylate hydrate; T-3262

    		 Bacterial Antibiotic Infection
    Tosufloxacin tosylate hydrate (A-61827) is an orally active fluoroquinolone antibiotic. Tosufloxacin shows a broad spectrum of antibacterial activity against gram-positive and gram-negative bacteria.
  • HY-101467
    Trilaciclib

    G1T28

    		 CDK Cancer
    Trilaciclib is a CDK4/6 inhibitor with IC50s of 1 nM and 4 nM for CDK4 and CDK6, respectively.
  • HY-101406
    Thyroxine sulfate

    T4 Sulfate

    		 Thyroid Hormone Receptor Drug Metabolite Endogenous Metabolite Metabolic Disease Endocrinology
    Thyroxine sulfate is a thyroid hormone metabolite.
  • HY-148571
    TP0597850

    		MMP Cancer Inflammation/Immunology
    TP0597850 is a selective inhibitor of MMP2 (IC50=0.22 nM). TP0597850 has a long MMP2 dissociation half-life (t1/2=265 min).
  • HY-14737
    Ceftaroline fosamil

    TAK-599; PPI0903

    		 Bacterial Antibiotic Infection
    Ceftaroline fosamil (TAK-599), a cephalosporin derivative, is an N-phosphono proagent of anti-methicillin-resistant Staphylococcus aureus (MRSA) T-91825. Ceftaroline fosamil can be used for the research of MRSA infection.
  • HY-14738
    Ceftaroline fosamil inner salt

    TAK-599 free acid; PPI0903 free acid

    		 Bacterial Antibiotic Infection
    Ceftaroline fosamil (TAK-599) inner salt, a cephalosporin derivative, is an N-phosphono proagent of anti-methicillin-resistant Staphylococcus aureus (MRSA) T-91825. Ceftaroline fosamil inner salt can be used for the research of MRSA infection.
  • HY-139722
    Tenofovir-C3-O-C12-trimethylsilylacetylene ammonium

    		HIV Infection
    Tenofovir-C3-O-C12-trimethylsilylacetylene (ammonium) exhibits substantially longer t1/2 values than tenofovir in human liver microsomes, potent anti-HIV activity in vitro, and enhances pharmacokinetic properties in vivo.
  • HY-15408
    Trelagliptin

    SYR-472

    		 Dipeptidyl Peptidase Metabolic Disease
    Trelagliptin (SYR-472) is a potent, orally active and highly selective DPP-4 inhibitor with an IC50 of 4 nM. Trelagliptin succinate improves glycemic control in vivo and can be used for the study of type 2 diabetes mellitus (T2DM).
  • HY-P1191
    JIP-1(153-163)

    T1-JIP

    		 JNK Others
    JIP-1(153-163) (TI-JIP) is a peptide inhibitor of c-JNK, based on residues 153-163 of JNK-interacting protein-1 (JIP-1) (Modifications: Phe-11 = C-terminal amide).
  • HY-106571
    Cefteram pivoxil

    Ro 19-5248; T-2588

    		 Bacterial Antibiotic Infection
    Cefteram pivoxil (Ro 19-5248), an orally active cephalosporin antibiotic, is used for bacterial infections.
  • HY-W190962
    t-Boc-N-amido-PEG5-acetic acid

    		PROTAC Linkers Cancer
    BocNH-PEG5-acid is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-P99339
    Tebentafusp

    IMCgp100

    		 Interleukin Related TNF Receptor Cancer
    Tebentafusp (IMCgp100) is a bispecific fusion protein to target gp100 peptide-HLA-A*02:01 (a melanoma-associated antigen). Tebentafusp guides T cells to kill gp100-expressing tumor cells via a high affinity T-cell receptor (TCR) binding domain and an anti-CD3 T-cell engaging domain. Tebentafusp leads to inflammatory cytokines and cytolytic proteins production, resulting in the direct lysis of tumour cells.
  • HY-139721
    Tenofovir-C3-O-C15-CF3 ammonium

    		HIV Infection
    Tenofovir-C3-O-C15-CF3 (ammonium) exhibits substantially longer t1/2 values than tenofovir in human liver microsomes, potent anti-HIV activity in vitro, and enhances pharmacokinetic properties in vivo.
  • HY-15408A
    Trelagliptin succinate

    SYR-472 succinate

    		 Dipeptidyl Peptidase Metabolic Disease
    Trelagliptin (SYR-472) succinate is a potent, orally active and highly selective DPP-4 inhibitor with an IC50 of 4 nM. Trelagliptin succinate improves glycemic control in vivo and can be used for the study of type 2 diabetes mellitus (T2DM).
  • HY-10449A
    Luseogliflozin hydrate

    TS 071 hydrate

    		 SGLT Metabolic Disease
    Luseogliflozin (TS 071) hydrate is a selective potent and orally active second-generation sodium-glucose co-transporter 2 (SGLT2) inhibitor with an IC50 of 2.26 nM. Luseogliflozin hydrate can be used for the research of type 2 diabetes mellitus (T2DM).
  • HY-120075
    TJ191

    		Apoptosis Cancer
    TJ191 is a potent and specific anti-cancer agent that targets low TβRIII-expressing malignant T-cell leukemia/lymphoma cells. TJ191 has no affects on the proliferation of other cancer cells or normal fibroblasts or immune cells. TJ191 can be used for cancer research.
  • HY-113408
    Tiglyl carnitine

    		Endogenous Metabolite Metabolic Disease
    Tiglyl carnitine is found to be associated with celiac disease and mitochondrial acetoacetyl-CoA thiolase (T2) deficiency.
  • HY-104066A
    Theliatinib tartrate

    Xiliertinib tartrate; HMPL-309 tartrate

    		 EGFR Cancer
    Theliatinib (Xiliertinib) tartrate is a potent, ATP-competitive, orally active and highly selective EGFR inhibitor with a Ki of 0.05 nM and an IC50 of 3 nM. Theliatinib has an IC50 of 22 nM for EGFR T790M/L858R mutant. Theliatinib shows >50-fold selectivity for EGFR than other kinases.
  • HY-10955
    TTA-P1

    		Calcium Channel Neurological Disease
    TTA-P1 is a potent state-independent compound inhibiting human T-type calcium channel. T-type calcium channels play a role in diverse physiological responses including neuronal burst firing, hormone secretion, and cell growth. TTA-P1 has the potential for the research of absence epilepsy.
  • HY-104066
    Theliatinib

    Xiliertinib; HMPL-309

    		 EGFR Cancer
    Theliatinib (Xiliertinib) is a potent, ATP-competitive, orally active and highly selective EGFR inhibitor with a Ki of 0.05 nM and an IC50 of 3 nM. Theliatinib has an IC50 of 22 nM for EGFR T790M/L858R mutant. Theliatinib shows >50-fold selectivity for EGFR than other kinases.
  • HY-W010538
    trans-4-Methylcyclohexanamine

    		Parasite Infection
    trans-4-Methylcyclohexanamine is an intermediate and can be used for the development of T. cruzi enzyme inhibitor.
  • HY-P99562
    Tidutamab

    XmAb-18087

    		 CD3 Cancer
    Tidutamab (XmAb-18087) is a humanized and affinity-optimized bispecific antibody (bsAb) targeting SSTR2 binding domain and T-cell binding domain (CD3). Tidutamab possesses a full Fc domain to maintain long serum half-life.Tidutamab eliminates SSTR+ tumor cells by stimulating redirected T cellmediated cytotoxicity (RTcC).
  • HY-P1191A
    JIP-1(153-163) TFA

    T1-JIP TFA

    		 JNK Others
    JIP-1(153-163) TFA (TI-JIP TFA) is a peptide inhibitor of c-JNK, based on residues 153-163 of JNK-interacting protein-1 (JIP-1) (Modifications: Phe-11 = C-terminal amide).
  • HY-141328
    Thiol-PEG4-Boc

    Thiol-PEG4-t-butyl ester

    		 PROTAC Linkers Cancer
    Thiol-PEG4-Boc is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-141327
    Thiol-PEG3-Boc

    Thiol-PEG3-t-butyl ester

    		 PROTAC Linkers Cancer
    Thiol-PEG3-Boc is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-B0724BS
    Pazufloxacin-d4

    T3761-d4

    		 Bacterial Antibiotic Infection
    Pazufloxacin-d4 is deuterium labeled Pazufloxacin.
  • HY-U00087
    Tosylchloramide sodium trihydrate

    		Bacterial Infection
    Tosylchloramide sodium trihydrate (Chloramine T sodium trihydrate) is a disinfectant agent widely used in laboratories, kitchens and hospitals. It is also used as a biocide in air fresheners and deodorants.
  • HY-P99394
    Talquetamab

    JNJ-64407564

    		 CD3 Cancer
    Talquetamab (JNJ-64407564) is a humanized bispecific antibody that binds to GPRC5D (member of G protein-coupled receptor family C5 group D) and CD3 to induce T cell-mediated killing of GPRC5D-expressing MM cells through T cell recruitment and activation. Talquetamab (JNJ-64407564) has antitumor activity.
  • HY-10388
    TTA-Q6

    		Calcium Channel Neurological Disease
    TTA-Q6 is a selective T-type Ca 2+ channel antagonist, which can be used in the research of neurological disease.
  • HY-15405
    Teriflunomide

    A77 1726

    		 Drug Metabolite Inflammation/Immunology
    Teriflunomide is the active metabolite of leflunomide, an approved therapy for rheumatoid arthritis. It inhibits pyrimidine synthesis and therefore potently decreases T cell and B cell proliferation.
  • HY-A0070B
    Liothyronine sodium hydrate

    Triiodothyronine sodium hydrate; 3,3',5-Triiodo-L-thyronine sodium hydrate; T3 sodium hydrate

    		 Thyroid Hormone Receptor Endogenous Metabolite Cancer Endocrinology
    Liothyronine sodium hydrate is an active form of thyroid hormone. Liothyronine sodium hydrate is a potent thyroid hormone receptors TRα and TRβ agonist with Kis of 2.33 nM for hTRα and hTRβ, respectively.
  • HY-A0070
    Liothyronine sodium

    Triiodothyronine sodium; 3,3',5-Triiodo-L-thyronine sodium; T3 sodium

    		 Thyroid Hormone Receptor Endogenous Metabolite Cancer Endocrinology
    Liothyronine sodium is an active form of thyroid hormone. Liothyronine sodium is a potent thyroid hormone receptors TRα and TRβ agonist with Kis of 2.33 nM for hTRα and hTRβ, respectively.
  • HY-A0070C
    Liothyronine hydrochloride

    Triiodothyronine hydrochloride; 3,3',5-Triiodo-L-thyronine hydrochloride; T3 hydrochloride

    		 Thyroid Hormone Receptor Endogenous Metabolite Cancer Endocrinology
    Liothyronine hydrochloride is an active form of thyroid hormone. Liothyronine hydrochloride is a potent thyroid hormone receptors TRα and TRβ agonist with Kis of 2.33 nM for hTRα and hTRβ, respectively.
  • HY-14957AS
    Ozenoxacin-d3 hydrochloride

    T-3912-d3 (hydrochloride)

    		 Bacterial Antibiotic Inflammation/Immunology
    Ozenoxacin-d3 (hydrochloride) is the deuterium labeled Ozenoxacin hydrochloride. Ozenoxacin hydrochloride is a nonfluorinated quinolone antibacterial, which shows potent activities against the main microorganisms isolated from skin and soft tissue infections[1][2][3].
  • HY-A0070A
    Liothyronine

    Triiodothyronine; 3,3',5-Triiodo-L-thyronine; T3

    		 Thyroid Hormone Receptor Endogenous Metabolite Cancer Endocrinology
    Liothyronine is an active form of thyroid hormone. Liothyronine is a potent thyroid hormone receptors TRα and TRβ agonist with Kis of 2.33 nM for hTRα and hTRβ, respectively.
  • HY-15440
    Temsavir

    BMS-626529

    		 HIV Infection
    Temsavir (BMS-626529) is a novel attachment inhibitor that targets HIV-1 gp120 and prevents its binding to CD4 + T cells.
  • HY-10388A
    TTA-Q6(isomer)

    		Calcium Channel Others
    TTA-Q6(isomer) is an isomer of TTA-Q6. TTA-Q6 is a selective T-type Ca 2+ channel antagonist.
  • HY-P99345
    Dostarlimab

    TSR-042

    		 PD-1/PD-L1 Cancer
    Dostarlimab (TSR-042) is a humanized anti-PD-1 monoclonal antibody. Dostarlimab binds with high affinity to human PD-1 and competitively inhibits its interaction with its ligands, PD-L1 and PD-L2, with IC50s of 1.8 and 1.5 nM, respectively.
  • HY-148751
    TRPV1 activator-1

    		TRP Channel Cancer
    TRPV1 activator-1 (compound 8), a capsaicin analog, has an altered neck structure. TRPV1 activator-1 interacts specifically with T551 residue.
  • HY-P99222
    Teplizumab

    MGA-031; PRV-031

    		 CD3 Metabolic Disease
    Teplizumab (MGA-031) is a Fc receptor non-binding anti-human CD3 monoclonal antibody. Teplizumab reduces the loss of beta-cell function. Teplizumab can be used in the research of type 1 diabetes.
  • HY-136066
    Tauro-ω-muricholic acid sodium

    TωMCA sodium

    		 Others Metabolic Disease
    Tauro-ω-muricholic acid sodium (TωMCA sodium) is a bile acid released by the liver and an analog of tauro-α-muricholic acid. Tauro-ω-muricholic acid sodium is investigated as a potential marker in plasma for early-onset neonatal sepsis (EOS) and cholestasis studies
  • HY-N11507
    Tibesaikosaponin V

    TKV

    		 PPAR Metabolic Disease
    Tibesaikosaponin V (TKV) is a triterpene diglycoside, which can be isolated from the methanol extract of the roots of Bupleurum chinense DC.. Tibesaikosaponin V inhibits lipid accumulation and triacylglycerol content occurred without cytotoxicity to adipocytes. Tibesaikosaponin V suppresses the mRNA expression of nuclear transcription factors, such as peroxisome proliferator-activated receptor γ (PPARγ) and CCAAT/enhancer binding protein α (C/EBPα). Tibesaikosaponin V inhibits 3T3-L1 preadipocyte differentiation. Tibesaikosaponin V can be used fro research of obesity and its associated metabolic disorders.
  • HY-P99565
    Tengonermin

    ARENEGYR; NGR-TNF; NGR-hTNF

    		 TNF Receptor Cancer
    Tengonermin (ARENEGYR) is a vascular-targeting agent consisting of the human Tumour Necrosis Factor-α (TNF-α) conjugated with the CNGRCG peptide. Tengonermin increases penetration of intratumoral chemotherapy and T-cell infiltration by modifying the tumour microenvironment.
  • HY-13756A
    Tacrolimus monohydrate

    FK506 monohydrate; Fujimycin monohydrate; FR900506 monohydrate

    		 Phosphatase FKBP Autophagy Bacterial Antibiotic Cancer Infection Inflammation/Immunology
    Tacrolimus monohydrate (FK506 monohydrate), a macrocyclic lactone, binds to FK506 binding protein (FKBP) to form a complex and inhibits calcineurin phosphatase, which inhibits T-lymphocyte signal transduction and IL-2 transcription. Immunosuppressive properties.
  • HY-A0070AG
    Liothyronine

    Triiodothyronine; 3,3',5-Triiodo-L-thyronine; T3

    		 Thyroid Hormone Receptor Cancer Endocrinology
    Liothyronine (Triiodothyronine) (GMP) is Liothyronine (HY-A0070A) produced by using GMP guidelines. GMP small molecules work appropriately as an auxiliary reagent for cell therapy manufacture. Liothyronine is a potent thyroid hormone receptors TRα and TRβ agonist with Kis of 2.33 nM for hTRα and hTRβ, respectively.
  • HY-13756
    Tacrolimus

    FK506; Fujimycin; FR900506

    		 Phosphatase FKBP Bacterial Autophagy Antibiotic Cancer Infection Inflammation/Immunology
    Tacrolimus (FK506), a macrocyclic lactone, binds to FK506 binding protein (FKBP) to form a complex. Tacrolimus inhibits calcineurin phosphatase, which inhibits T-lymphocyte signal transduction and IL-2 transcription. Immunosuppressive properties.
  • HY-N7087
    Tulipalin A

    α-Methylene butyrolactone

    		 Drug Metabolite
    Tulipalin A (α-Methylene butyrolactone) is a glycoside. Tulipalin A is a causative allergen that induces Allergic contact dermatitides. Tulipalin A (α-Methylene butyrolactone) at low dose affects the functionality of immune cells, such as Jurkat T cells.
  • HY-A0092
    Trimethadione

    3,5,5,-Trimethyloxazolidine-2,4-dione

    		 Calcium Channel Neurological Disease
    Trimethadione (3,5,5,-Trimethyloxazolidine-2,4-dione) is an oxazolidinedione anticonvulsant agent widely used against absences seizures. Trimethadione also is a T-type calcium channel blocker which has antihyperalgesic effects.
  • HY-100800
    TACA

    trans-4-Aminocrotonic acid

    		 GABA Receptor Neurological Disease
    TACA (trans-4-Aminocrotonic acid) is a potent agonist of GABAA and GABAC receptors (KD= 0.6 μM). TACA also is GABA uptake inhibitor and substrate for GABA-T. TACA produces late biphasic responses in the MPG neurons.
  • HY-135103S
    Tauro-β-muricholic acid-d4 sodium

    		FXR Cancer
    Tauro-β-muricholic acid-d4 (sodium) is the deuterium labeled Tauro-β-muricholic acid sodium. Tauro-β-muricholic Acid sodium (T-βMCA sodium), a endogenous metabolite, is a competitive and reversible farnesoid X receptor (FXR) antagonist, with an IC50 of 40 μM[1][2][3].
  • HY-P99961
    Tifcemalimab

    JS004

    		 CD28 Cancer
    Tifcemalimab (JS004) is a humanized anti-BTLA (B and T lymphocyte attenuation factor) monoclonal antibody. Tifcemalimab blocks the interaction of HVEM-BTLA by binding to BTLA, and thus blocks the inhibitory signaling pathway mediated by BTLA. Tifcemalimab can be used in research of cancer.
  • HY-B0199
    Mycophenolate Mofetil

    RS 61443; TM-MMF

    		 Drug Metabolite Apoptosis Endogenous Metabolite Bacterial Cancer
    Mycophenolate mofetil (RS 61443) is the morpholinoethylester proagent of Mycophenolic acid. Mycophenolate mofetil inhibits de novo purine synthesis via the inhibition of inosine monophosphate dehydrogenase (IMPDH). Mycophenolate mofetil shows selective lymphocyte antiproliferative effects involve both T and B cells, preventing antibody formation.
  • HY-21577
    Tris[[2-(tert-butoxycarbonyl)ethoxy]methyl]methylamine

    		ADC Linker PROTAC Linkers Cancer
    Tris[[2-(tert-butoxycarbonyl)ethoxy]methyl]methylamine is a cleavable PEG ADC linker used in the synthesis of antibody-drug conjugates (ADCs). Amino-Tri-(t-butoxycarbonylethoxymethyl)-methane is also a PEG/Alkyl/ether-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-N7122
    Thymopentin

    		Endogenous Metabolite Inflammation/Immunology Cancer
    Thymopentin is a biologically active peptide secreted mainly by the epithelial cells of thymic cortex and medulla. Thymopentin is an effective immunomodulatory agent with a short plasma half-life of 30 seconds. Thymopentin enhances the generation of T-cell lineage derived from human embryonic stem cells (hESCs).
  • HY-N7122A
    Thymopentin acetate

    		Endogenous Metabolite Cancer Inflammation/Immunology
    Thymopentin acetate is a biologically active peptide secreted mainly by the epithelial cells of thymic cortex and medulla. Thymopentin acetate is an effective immunomodulatory agent with a short plasma half-life of 30 seconds. Thymopentin acetate enhances the generation of T-cell lineage derived from human embryonic stem cells (hESCs).
  • HY-148029
    Dazostinag disodium

    TAK-676

    		 STING Cancer
    Dazostinag disodium (TAK-676) is an agonist of STING, triggering the activation of STING signaling pathway and type I interferons. Dazostinag disodium is also a modulator of immune system, resulting complete regressions and durable memory T-cell immunity. Dazostinag disodium promotes durable IFN-dependent antitumor immunity.
  • HY-128679
    TBK1/IKKε-IN-5

    		IKK Cancer
    TBK1/IKKε-IN-5 (compound 1) is an orally active TBK1 and IKKε dual inhibitor, with IC50 values of 1 and 5.6 nM, respectively. TBK1/IKKε-IN-5 enhances the blockade response to PD-1 and induces immune memory in rats when combines with anti-PD-L1. TBK1/IKKε-IN-5 can be used in cancer research, especially in tumour immunity.
  • HY-146780
    TGFβRI-IN-4

    		TGF-β Receptor Cancer
    TGFβRI-IN-4 is a highly potent and orally active TGFβ receptor type I (TGFβRI) inhibitor, with IC50s of 44 nM and 42.5 nM for ALK5 and NIH3T3. TGFβRI-IN-4 can suppress tumor growth and tumor weight in tumor xenograft model.
  • HY-P1102
    TC14012

    		CXCR HIV Cancer Infection
    TC14012, a serum-stable derivative of T140, is a selective and peptidomimetic CXCR4 antagonist with an IC50 of 19.3 nM. TC14012 is a potent CXCR7 agonist with an EC50 of 350 nM for recruiting β-arrestin 2 to CXCR7. TC14012 has anti-HIV activity and anti-cancer activity.
  • HY-153090
    Transketolase-IN-4

    		Bacterial Cancer Infection
    Transketolase-IN-4 is a potent transketolase inhibitor (IC50=3.9 μM). Transketolase-IN-4 inhibits tumor cell proliferation of SW620, LS174T, and MIA PaCa-2. Transketolase-IN-4 is a possible Mycobacterium tuberculosis DXS inhibitor, with an IC50 value of 114.1 μM.
  • HY-P99052
    Tislelizumab

    		PD-1/PD-L1 Cancer Inflammation/Immunology
    Tislelizumab, a monoclonal antibody with high binding affinity to the PD-1 receptor, minimizes Fcγ receptor binding on macrophages, thereby abrogating antibody-dependent phagocytosis, a mechanism of T cell clearance and potential resistance to anti-PD-1 research. Tislelizumab can be used for the research of advanced squamous non-small-cell lung cancer.
  • HY-P1102A
    TC14012 TFA

    		CXCR HIV Cancer Infection
    TC14012 TFA, a serum-stable derivative of T140, is a selective and peptidomimetic CXCR4 antagonist with an IC50 of 19.3 nM. TC14012 TFA is a potent CXCR7 agonist with an EC50 of 350 nM for recruiting β-arrestin 2 to CXCR7. TC14012 TFA has anti-HIV activity and anti-cancer activity.
  • HY-P3139
    TPP-1

    		PD-1/PD-L1 Cancer
    TPP-1 is a potent inhibitor of the PD-1/PD-L1 interaction. TPP-1 binds specifically to PD-L1 with a high affinity (KD=95 nM). TPP-1 inhibits human tumor growth in vivo via reactivating T-cell function.
  • HY-13756S
    Tacrolimus-13C,d2

    FK506-13C,d2; Fujimycin-13C,d2; FR900506-13C,d2

    		 Phosphatase FKBP Bacterial Autophagy Antibiotic Cancer Infection Inflammation/Immunology
    Tacrolimus- 13C,d2 is a 13C-labeled and deuterium labeled Tacrolimus. Tacrolimus (FK506), a macrocyclic lactone, binds to FK506 binding protein (FKBP) to form a complex. Tacrolimus inhibits calcineurin phosphatase, which inhibits T-lymphocyte signal transduction and IL-2 transcription. Immunosuppressive properties[1].
  • HY-P3139A
    TPP-1 TFA

    		PD-1/PD-L1 Cancer
    TPP-1 TFA is a potent inhibitor of the PD-1/PD-L1 interaction. TPP-1 TFA binds specifically to PD-L1 with a high affinity (KD=95 nM). TPP-1 TFA inhibits human tumor growth in vivo via reactivating T-cell function.
  • HY-N7634
    Tectol

    		Farnesyl Transferase Parasite Cancer Infection
    Tectol, isolated from Lippia sidoides, exhibits significant activity against human leukemia cell lines HL60 and CEM. Tectol is a farnesyltransferase (FTase) inhibitor with IC50s of 2.09 and 1.73 μM for human and T. brucei FTase, respectively. Tectol inhibits drug-resistant strain of P. falciparum (FcB1) with an IC50 of 3.44 μM.
  • HY-Y1239S
    Trihydro(tetrahydrofuran)boron-d3

    (T-4)-Trihydro-d3-(tetrahydrofuran)boron; Hydride-d, boron complex; Trideuterio(tetrahydrofuran)boron; Trideuteroborane-tetrahydrofuran complex

    		 Isotope-Labeled Compounds Others
    Trihydro(tetrahydrofuran)boron-d3 is the deuterium labeled Trihydro(tetrahydrofuran)boron[1].
  • HY-130665
    TL12-186

    		PROTACs CDK Cancer
    TL12-186 is a Cereblon-dependent multi-kinase PROTAC degrader. Multi-kinases include CDK, BTK, FLT3, Aurora kinases, TEC, ULK, ITK, et al. TL12-186 inhibits CDK2/cyclin A (IC50=73 nM) and CDK9/cyclin T1 (IC50=55 nM).
  • HY-141939S
    Triiodothyronine-13C6( hydrochloride)

    L-Liothyronine-13C6; T3-13C6

    		 Isotope-Labeled Compounds Others
    Triiodothyronine- 13C6 (hydrochloride) is the 13C labeled Triiodothyronine[1].
  • HY-138298
    Trastuzumab deruxtecan (solution)

    DS-8201 (solution); DS-8201a (solution)

    		 Antibody-Drug Conjugates (ADCs) EGFR Cancer
    Trastuzumab deruxtecan (T-DXd; DS-8201a) (solution) is an anti-human epidermal growth factor receptor 2 (HER2) antibody-drug conjugate (ADC). Trastuzumab deruxtecan is composed of a humanized anti-HER2 antibody, an enzymatically cleavable peptide-linker, a topoisomerase I inhibitor (a toxin component of Dxd). Trastuzumab deruxtecan can be used for the research of HER2-positive breast cancer and gastric cancer.
  • HY-A0070AS2
    Liothyronine-13C6-1

    Triiodothyronine-13C6-1; 3,3',5-Triiodo-L-thyronine-13C6-1; T3-13C6-1

    		 Thyroid Hormone Receptor Cancer Endocrinology
    Liothyronine-13C6-1 is a 13C-labeled Liothyronine. Liothyronine is a potent thyroid hormone receptors TRα and TRβ agonist with Kis of 2.33 nM for hTRα and hTRβ, respectively.
  • HY-W454729S
    tert-Butyl 4-hydroxypiperidine-1-carboxylate-3,3,4,5,5-d5

    4-Hydroxypiperidine-3,3,4,5,5-d5-N-t-BOC

    		 Isotope-Labeled Compounds Others
    tert-Butyl 4-hydroxypiperidine-1-carboxylate-3,3,4,5,5-d5 is the deuterium labeled tert-Butyl 4-hydroxypiperidine-1-carboxylate[1].
  • HY-111828
    TTA-A2

    		Calcium Channel Neurological Disease
    TTA-A2 is a potent, selective and orally active t-type voltage gated calcium channel antagonist with reduced pregnane X receptor (PXR) activation. TTA-A2 is equally potent against the Cav3.1 (a1G) and Cav3.2 (a1H) channels with IC50 values of 89 nM and 92 nM, respectively, at -80 and -100 mV holding potentials. TTA-A2 can be used for the research of a variety of human neurological diseases, including sleep disorders and epilepsy.
  • HY-P99575
    Tarlatamab

    AMG-757

    		 Notch Cancer Inflammation/Immunology
    Tarlatamab (AMG-757) is a bispecific T-cell engager (BiTE) antibody targeting delta-like ligand 3 (DLL3). DLL3 is a target that is selectively expressed in small-cell lung cancer (SCLC) tumors, but with minimal normal tissue expression. Tarlatamab has the KDs of 0.64 nM and 0.50 nM for human and nonhuman primate (NHP) DLL3, respectively. Tarlatamab has the KDs of 14.9 nM and 12 nM for human and NHP CD3, respectively. Tarlatamab is a first-in-class HLE BiTE immuno-oncology therapy targeting DLL3 and has the potential for SCLC research.
  • HY-13757A
    Tamoxifen

    ICI 47699; (Z)-Tamoxifen; trans-Tamoxifen

    		 Estrogen Receptor/ERR HSP Autophagy Apoptosis Cancer
    Tamoxifen (ICI 47699) is an orally active, selective estrogen receptor modulator (SERM) which blocks estrogen action in breast cells and can activate estrogen activity in other cells, such as bone, liver, and uterine cells. Tamoxifen is a potent Hsp90 activator and enhances the Hsp90 molecular chaperone ATPase activity. Tamoxifen also potent inhibits infectious EBOV Zaire and Marburg (MARV) with IC50 of 0.1 µM and 1.8 µM, respectively. Tamoxifen activates autophagy and induces apoptosis. Tamoxifen also can induce gene knockout of CreER(T2) transgenic mouse.
  • HY-P99573
    Tebotelimab

    MGD-013

    		 PD-1/PD-L1 Cancer Inflammation/Immunology
    Tebotelimab (MGD-013) is a human IgG4κ bispecific PD-1/LAG-3 dual-affinity re-targeting (DART) antibody. Tebotelimab binds cell-surface expressed PD-1 and LAG-3 with EC50s of 1.65 nM and 0.41 nM in NS0 cells, respectively. Tebotelimab blocks PD-1/PD-L1, PD-1/PD-L2 and LAG-3/HLA (MHC-II) interactions and PD-1 signaling. Tebotelimab restores exhausted T-cell responses and and enhances antitumour immunity.
  • HY-13757AS1
    Tamoxifen-d3

    ICI 47699-d3; (Z)-Tamoxifen-d3; trans-Tamoxifen-d3

    		 Estrogen Receptor/ERR Apoptosis Autophagy HSP Cancer
    Tamoxifen-d3 is the deuterium labeled Tamoxifen[1]. Tamoxifen (ICI 47699) is an orally active, selective estrogen receptor modulator (SERM) which blocks estrogen action in breast cells and can activate estrogen activity in other cells, such as bone, liver, and uterine cells[2][3][4]. Tamoxifen is a potent Hsp90 activator and enhances the Hsp90 molecular chaperone ATPase activity. Tamoxifen also potent inhibits infectious EBOV Zaire and Marburg (MARV) with IC50 of 0.1 μM and 1.8 μM, respectively[6]. Tamoxifen activates autophagy and induces apoptosis[5]. Tamoxifen also can induce gene knockout of CreER(T2) transgenic mouse[7].
  • HY-13757
    Tamoxifen Citrate

    ICI 46474; (Z)-Tamoxifen Citrate; trans-Tamoxifen Citrate

    		 Estrogen Receptor/ERR HSP Autophagy Apoptosis Cancer
    Tamoxifen Citrate (ICI 46474) is an orally active, selective estrogen receptor modulator (SERM) which blocks estrogen action in breast cells and can activate estrogen activity in other cells, such as bone, liver, and uterine cells.Tamoxifen Citrate is a potent Hsp90 activator and enhances the Hsp90 molecular chaperone ATPase activity. Tamoxifen Citrate also potent inhibits infectious EBOV Zaire and Marburg (MARV) with IC50 of 0.1 µM and 1.8 µM, respectively. Tamoxifen Citrate activates autophagy and induces apoptosis.Tamoxifen Citrate also can induce gene knockout of CreER(T2) transgenic mouse.
  • HY-A0070AS1
    Liothyronine-13C9,15N

    Triiodothyronine-13C9,15N; 3,3',5-Triiodo-L-thyronine-13C9,15N; T3-13C9,15N

    		 Thyroid Hormone Receptor Endogenous Metabolite
    Liothyronine- 13C9, 15N is the 13C and 15N labeled Liothyronine[1]. Liothyronine is an active form of thyroid hormone. Liothyronine is a potent thyroid hormone receptors TRα and TRβ agonist with Kis of 2.33 nM for hTRα and hTRβ, respectively[2][3][4].
  • HY-150751
    ODN TTAGGG

    ODN A151

    		 Toll-like Receptor (TLR) AIM2 Inflammation/Immunology
    ODN TTAGGG (A151), inhibitory oligonucleotide (ODN), is a TLR9, AIM2 and cGAS antagonist. ODN TTAGGG is immunosuppressive and inhibits AIM2 inflammasome activation, as well as cGAS activation, by competing with DNA. ODN TTAGGG can be used in the study of lupus erythematosus and other related autoimmune diseases. ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3'.
  • HY-150748
    ODN D-SL01

    		Toll-like Receptor (TLR) Cancer Inflammation/Immunology
    ODN D-SL01, a class B CpG ODN (oligodeoxynucleotide), is a TLR9 agonist. ODN D-SL01 has strong immunostimulatory activity in a variety of vertebrate species and has anticancer activity. ODN D-SL01 sequence: 5'- T-C-G-C-G-A-C-G-T-T-C-G-C-C-C-G-A-C-G-T-T-C-G-G-T-A-3'.
  • HY-N8039
    Ganoderic acid T-Q

    Ganodermic acid T-Q

    		 Microtubule/Tubulin Cancer
    Ganoderic acid T-Q (Ganodermic acid T-Q) (compound 1) is a natural product that can be found in ganoderma lucidum. Ganoderic acid T-Q stimulates tubulin polymerization.
  • HY-P0229
    Ribonuclease T1

    Rnase T1

    		 DNA/RNA Synthesis Others
    Ribonuclease T1 (Rnase T1), is commonly used in biochemical research. Ribonuclease T1 is an endonuclease that can specifically degrade single stranded RNA. Ribonuclease T1 can form nucleoside 2 ', 3 '-cyclic phosphoric acid intermediates to cut the phosphodiester bond between 3' -guanosine residues and adjacent nucleoside 5 '-OH groups to produce 3' -GMP terminal oligonucleotides.
  • HY-B0959
    Chloramine-T

    		Bacterial Infection
    Chloramine-T is a titrimetric reagent, and an oxidizing agent. Chloramine-T is an oxidizing biocide.
  • HY-N10375
    Kuwanon T

    		Others Others
    Kuwanon T is an isoprenylated flavonoid compound isolated from the root bark of Morus alba. Kuwanon T shows protective effects on t-BHP-induced oxidative stress with a EC50 of 30.32 μM.
  • HY-110251
    DFHBI-1T

    		DNA Stain Others
    DFHBI-1T is a membrane-permeable RNA aptamers-activated fluorescence probe (ex/em=472 nm/507 nm). DFHBI-1T binds to RNA aptamers (Spinach, Spinach2, iSpinach, and Broccoli) and causes specific fluorescence and lower background fluorescence. DFHBI-1T is used to image RNA in live cells. Storage: protect from light.
  • HY-150747
    ODN 6016

    		IFNAR Inflammation/Immunology
    ODN 6016 is a CpG-A oligonucleotides. ODN 6016 can induce IFN-α production, can be used for researching immune disorders including immunodeficiency caused by HIV-1. ODN 6016 sequence: T-sp-C-G-A-C-G-T-C-G-T-G-G-sp-G-sp-G-sp-G.
  • HY-111595
    SAHA chloroalkane T1

    		Others Cancer
    SAHA chloroalkane T1 is a chloroalkane capture tag by tethering Vorinostat (SAHA) and a chloroalkane tag T1.
  • HY-N11648
    Ganoderic acid T1

    		Apoptosis Caspase Cancer Inflammation/Immunology
    Ganoderic acid T1 is a deacetylated derivative of Ganoderic acid T. Ganoderic acid T1 attenuates antioxidant defense system and induces apoptosis of cancer cells. Ganoderic acid T1 decreases mitochondrial membrane potential and activates caspase-9 and caspase-3, to trigger apoptosis. Ganoderic acid T1 also increases the generation of intracellular ROS to produce pro-oxidant activities and cytotoxicity.
  • HY-110251A
    DFHBI-2T

    		DNA Stain Others
    DFHBI-2T is a membrane-permeable RNA aptamers-activated fluorescence probe (ex/em=500 nm/523 nm). DFHBI-2T is used to image RNA in live cells. Storage: protect from light.
  • HY-P1115
    AKTide-2T

    		Akt Others
    AKTide-2T is an excellent in vitro substrate for AKT and shows competitive inhibition of histone H2B phosphorylation with a Ki of 12 nM. AKTide-2T mimics the optimal phosphorylation sequence of Akt and is an inhibitory peptide with the wildtype AKTide lacking Thr in the S22 position.
  • HY-P1287
    Conantokin-T

    		iGluR Neurological Disease
    Conantokin-T is a γ-carboxyglutamate-containing, N-methyl-D-aspartate (NMDA) antagonist peptidewith an IC50 value of 2 μM. Conantokin-T inhibits NMDA receptor-mediated calcium influx in central nervous system neurons. Conantokin-T can be purified from the venom of the fish-hunting cone snail, Conus tulipa.
  • HY-P0272
    Peptide T

    		HIV Infection
    Peptide T is an octapeptide from the V2 region of HIV-1 gp120. Peptide T is a ligand for the CD4 receptor and prevents binding of HIV to the CD4 receptor.
  • HY-P9947
    Efalizumab

    		Integrin Others
    Efalizumab is a targeted T cell modulator, and is a humanized monoclonal antibody of CD11a, the α subunit of LFA-1. Efalizumab inhibits T cell activation, cutaneous T cell trafficking, and T cell adhesion to keratinocytes, can be used for plaque psoriasis research.
  • HY-P1115A
    AKTide-2T TFA

    		Akt Others
    AKTide-2T TFA is an excellent in vitro substrate for AKT and shows competitive inhibition of histone H2B phosphorylation with a Ki of 12 nM. AKTide-2T TFA mimics the optimal phosphorylation sequence of Akt and is an inhibitory peptide with the wildtype AKTide lacking Thr in the S22 position.
  • HY-N6581
    Notoginsenoside T5

    		Others Cancer Cardiovascular Disease
    Notoginsenoside T5 is a dammarane 61 glycoside. Notoginsenoside T5 is isolated from the acidic deglycosylation of saponins from the roots of P. 62 notoginseng.
  • HY-146775S
    Dihydro T-MAS-d6

    		Isotope-Labeled Compounds Others
    Dihydro T-MAS-d6 is deuterium labeled Dihydro T-MAS.
  • HY-122649
    UU-T01

    		β-catenin Cancer
    UU-T01 is a selective inhibitor for β-Catenin/T-cell factor 4 protein-protein interaction (β-catenin/Tcf PPI) with an Ki value of 3.14 µM. UU-T01 is directly combined with β-catenin, and the KD value is 0.531 µM.
  • HY-117233
    UU-T02

    		β-catenin Wnt Cancer Metabolic Disease
    UU-T02 is a novel potent, selective small-molecule inhibitor of β-Catenin/T-cell factor protein-protein interaction (β-catenin/Tcf PPI) with a Ki of 1.36 μM. UU-T02 inhibits canonical Wnt signaling and the growth of colorectal cancer cells.
  • HY-148761
    PSMA I&T

    		Others Cancer
    PSMA I&T is a potent PSMA (prostate-specific membrane antigen) inhibitor. PSMA I&T can be used for SPECT/CT imaging and radionuclide research of prostate cancer (PCa).
  • HY-P0272A
    Peptide T TFA

    		HIV Infection
    Peptide T (TFA) is an octapeptide from the V2 region of HIV-1 gp120. Peptide T is a ligand for the CD4 receptor and prevents binding of HIV to the CD4 receptor.
  • HY-147696
    SMTIN-T140

    		HSP AMPK Reactive Oxygen Species Cancer
    SMTIN-T140 (compound 6a) is a potent TRAP1 (tumor-necrosis-factor-receptor associated protein 1) inhibitor, with an IC50 of 1.646 μM. SMTIN-T140 shows anticancer activity. SMTIN-T140 leads to mitochondrial dysfunction, increases mitochondrial ROS production and activates AMPK. SMTIN-T140 potently suppressed tumor growth without any noticeable in vivo toxicity in a mouse model xenografted with PC3 prostate cancer cells.
  • HY-N11591
    Ganoderic acid T

    		Others Others
    Ganoderic acid T is a natural product that can be found in ganoderma lucidum.
  • HY-105840
    Dichloramine-T

    p-Toluenesulfondichloramide

    		 Bacterial Infection
    Dichloramine-T is a strong oxidizer and disinfectant, with strong oxidation and sterilization. Dichloramine-T is also widely used in the medical and health field for disinfection and sterilization operations.
  • HY-130676
    CLK-IN-T3N

    		CDK Cancer
    CLK-IN-T3N, the negative control of CLK-IN-T3 (HY-115470), is a chemical probe for CDC-like kinase (CLK).
  • HY-110353
    CU-T12-9

    		Toll-like Receptor (TLR) Cancer Inflammation/Immunology
    CU-T12-9 is a specific TLR1/2 agonist with EC50 of 52.9 nM in HEK-Blue hTLR2 SEAP assay. CU-T12-9 activates both the innate and the adaptive immune systems. CU-T12-9 selectively activates the TLR1/2 heterodimer, not TLR2/6. CU-T12-9 signals through NF-κB and invokes an elevation of the downstream effectors TNF-α, IL-10, and iNOS.
  • HY-22296
    Fmoc-Thr-OBu-t

    		Amino Acid Derivatives Others
    Fmoc-Thr-OBu-t is a threonine derivative.
  • HY-144088
    ZYF0033

    HPK1-IN-22

    		 MAP4K Cancer Inflammation/Immunology
    ZYF0033 (HPK1-IN-22, compound ZYF0033) is a hematopoietic progenitor kinase 1 (HPK1) inhibitor with an IC50 less than 10 nM based on the phosphorylation inhibition of MBP protein. ZYF0033 decreases the phosphorylation of SLP76 (serine 376). ZYF0033 promotes anticancer immune responses. ZYF0033 inhibits tumor growth and caused increases intratumoral infiltration of DCs, NK cells, and CD107a +CD8 + T cells but decreased infiltration of regulatory T cells, PD-1 +CD8 + T cells, TIM-3 +CD8 + T cells, and LAG3 +CD8 + T cells in the 4T-1 syngeneic mouse model.
  • HY-125832
    PBDB-T

    		Biochemical Assay Reagents Others
    PBDB-T is a wide bandgap polymer donor in Perylene diimide (PDI)-based polymer solar cells (PSCs).
  • HY-123295
    HDAC3-IN-T247

    		HDAC Cancer Infection
    HDAC3-IN-T247 is a potent and selective HDAC3 (histone deacetylase 3) inhibitor, with an IC50 of 0.24 µM. HDAC3-IN-T247 induces a selective increase of NF-κB acetylation in HCT116 cells. HDAC3-IN-T247 shows anticancer and antiviral activity. HDAC3-IN-T247 inhibits growth of cancer cells, and activates HIV gene expression in latent HIV-infected cells.
  • HY-151212
    BCP-T.A

    		Ferroptosis Glutathione Peroxidase Cancer
    BCP-T.A, a tunable heterocyclic electrophile, is a potent ferroptosis inducer by binding to GPX4.
  • HY-137449
    Rintodestrant

    G1T48

    		 Estrogen Receptor/ERR CDK Cancer
    Rintodestrant (G1T48) is an orally active, non-steroidal and selective estrogen receptor degrader. Rintodestrant (G1T48) is also a CDK4/6 inhibitor.
  • HY-142537S
    p-t-Butylphenyl diphenyl phosphate-d10

    		Isotope-Labeled Compounds Others
    p-t-Butylphenyl diphenyl phosphate-d10 is the deuterium labeled p-t-Butylphenyl diphenyl phosphate[1].
  • HY-129152
    Ganoderic acid T-N

    		Influenza Virus Infection
    Ganoderic acid T-N, a triterpenoid, is a H5N1 and H1N1 influenza neuraminidase (NA) inhibitor with IC50s of 2.7 μM and 42 μM, respectively. Ganoderic acid T-Q shows cytotoxicity against MCF7 cells (CC50=24.4 μM).
  • HY-P1404
    R8-T198wt

    		Pim Cancer
    R8-T198wt is a cell-permeable carboxyl-terminal p27 Kip1 peptide exhibits anti-tumor activity by inhibiting Pim-1 kinase.
  • HY-146911S
    CER9 (t18:0/26:0/18:1)-d9

    		Isotope-Labeled Compounds Others
    CER9 (t18:0/26:0/18:1)-d9 is deuterium labeled CER9 (t18:0/26:0/18:1).
  • HY-124855
    STD1T

    		Deubiquitinase Cancer
    STD1T is a deubiquitinase USP2a inhibitor with an IC50 of 3.3 μM in Ub-AMC Assay.
  • HY-W007599S
    L-Lysine-bis-N-t-BOC-d4

    		Isotope-Labeled Compounds Others
    L-Lysine-bis-N-t-BOC-d4 is the deuterium labeled L-Lysine-bis-N-t-BOC.
  • HY-131140
    BD750

    		JAK STAT Cancer Inflammation/Immunology
    BD750, an effective immunosuppressant and a JAK3/STAT5 inhibitor, inhibits IL-2-induced JAK3/STAT5-dependent T cell proliferation, with IC50 values of 1.5 μM and 1.1 μM in mouse and human T cells, respectively.
  • HY-18676
    OSU-T315

    		Integrin Autophagy Apoptosis Cancer
    OSU-T315 (ILK-IN-1) is a small Integrin-linked kinase (ILK) inhibitor with an IC50 of 0.6 μM, inhibiting PI3K/AKT signaling by dephosphorylation of AKT-Ser473 and other ILK targets (GSK-3β and myosin light chain). OSU-T315 abrogates AKT activation by impeding AKT localization in lipid rafts and triggers caspase-dependent apoptosis in an ILK-independent manner. OSU-T315 causes cell death through apoptosis and autophagy.
  • HY-115470
    CLK-IN-T3

    		CDK DYRK Cancer
    CLK-IN-T3 is a high potent, selective, and stable CDC-like kinase (CLK) inhibitor with IC50s of 0.67 nM, 15 nM, and 110 nM for CLK1, CLK2, and CLK3 protein kinases, respectively. CLK-IN-T3 has anti-cancer activity.
  • HY-W009412S
    D-Phenyl-alanine-N-t-Boc-d5

    		Isotope-Labeled Compounds Others
    D-Phenyl-alanine-N-t-Boc-d5 is the deuterium labeled D-Phenyl-alanine-N-t-Boc[1].
  • HY-126539
    UBE2T/FANCL-IN-1

    		E1/E2/E3 Enzyme Cancer
    UBE2T/FANCL-IN-1 is a potent inhibitor of UBE2T/FANCL-mediated FANCD2 monoubiquitylation that sensitizes cells to the DNA cross-linking agent, Carboplatin.
  • HY-101458
    IT1t

    		CXCR HIV Inflammation/Immunology Endocrinology
    IT1t is a potent CXCR4 antagonist; inhibits CXCL12/CXCR4 interaction with an IC50 of 2.1 nM.
  • HY-101458A
    IT1t dihydrochloride

    		CXCR HIV Inflammation/Immunology Endocrinology Cancer
    IT1t dihydrochloride is a potent CXCR4 antagonist; inhibits CXCL12/CXCR4 interaction with an IC50 of 2.1 nM.
  • HY-148859
    AA-T3A-C12

    		Liposome Metabolic Disease Inflammation/Immunology
    AA-T3A-C12 is an anisamide ligand-tethered lipidoid (AA-lipidoid). AA-T3A-C12 mediates great RNA delivery and transfection of activated fibroblasts.
  • HY-W010696
    Reverse T3

    3′,5′,3-Triiodothyronine

    		 Thyroid Hormone Receptor Cardiovascular Disease
    Reverse T3 is a thyroid hormone generated by deiodination of the prohormone thyroxine. Reverse T3 inhibits the increase of sodium current generated by other thyroid hormone analogs in neonatal rat myocytes.
  • HY-R01698
    hsa-miR-548t-5p mimic

    		MicroRNA Cancer
    hsa-miR-548t-5p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
  • HY-132088
    N-Boc-PEG-t-butyl ester

    		PROTAC Linkers Cancer
    N-Boc-PEG-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-P99302
    Lulizumab

    Humanized Anti-CD28 Recombinant Antibody

    		 CD28 Inflammation/Immunology
    Lulizumab (Humanized Anti-CD28 Recombinant Antibody) is a selective CD28 blockade, Lulizumab prevents T cell activation by selectively targeting CD28 signaling.
  • HY-P99523
    Vepsitamab

    AMG 199

    		 CD3 Cancer
    Vepsitamab (AMG 199) is an anti-MUC17/CD3 BiTE antibody that binds to CD3 on T cells and MUC17 expressed on tumor cells, mediates redirected tumor cell lysis, and induces T cell activation and proliferation.
  • HY-13821
    Epoxomicin

    BU-4061T

    		 Proteasome Apoptosis Cancer Inflammation/Immunology
    Epoxomicin (BU-4061T) is an epoxyketone-containing natural product and a potent, selective and irreversible proteasome inhibitor. Epoxomicin covalently binds to the LMP7, X, MECL1, and Z catalytic subunits of the proteasome and potently inhibits primarily the chymotrypsin-like activity. Epoxomicin can cross the blood-brain barrier. Epoxomicin has strongly antitumor and anti-inflammatory activity.
  • HY-W127622
    NDSB 256-4T

    3-(4-(tert-Butyl)pyridinio)-1-propanesulfonate

    		 Biochemical Assay Reagents Others
    NDSB 256-4T is a biochemical reagent that can be used as a biological material or organic compound for life science related research.
  • HY-18676B
    ILK-IN-2

    OSU-T315 analog

    		 Integrin Cancer
    ILK-IN-2 (OSU-T315 analog) is a ILK inhibitor.
  • HY-132064
    FmocNH-PEG4-t-butyl ester

    		PROTAC Linkers Cancer
    FmocNH-PEG4-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132101
    Amino-PEG7-t-butyl ester

    		PROTAC Linkers Cancer
    Amino-PEG7-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132025
    Benzyl-PEG7-t-butyl ester

    		PROTAC Linkers Cancer
    Benzyl-PEG7-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-143837
    Acid-PEG12-t-butyl ester

    		PROTAC Linkers Cancer
    Acid-PEG12-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132117
    Bromo-PEG12-t-butyl ester

    		PROTAC Linkers Cancer
    Bromo-PEG12-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132067
    Bis-PEG4-t-butyl ester

    		PROTAC Linkers Cancer
    Bis-PEG4-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132022
    Bis-PEG7-t-butyl ester

    		PROTAC Linkers Cancer
    Bis-PEG7-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-143836
    Acid-PEG10-t-butyl ester

    		PROTAC Linkers Cancer
    Acid-PEG10-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132066
    Bis-PEG3-t-butyl ester

    		PROTAC Linkers Cancer
    Bis-PEG3-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132109
    MS-PEG4-t-butyl ester

    		PROTAC Linkers Cancer
    MS-PEG4-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132056
    Hydroxy-PEG14-t-butyl ester

    		PROTAC Linkers Cancer
    Hydroxy-PEG14-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-W096076
    Bis-PEG6-t-butyl ester

    		PROTAC Linkers Cancer
    Bis-PEG6-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132118
    Bromo-PEG10-t-butyl ester

    		PROTAC Linkers Cancer
    Bromo-PEG10-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132057
    Bis-PEG10-t-butyl ester

    		PROTAC Linkers Cancer
    Bis-PEG10-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132062
    Azido-PEG11-t-butyl ester

    		PROTAC Linkers Cancer
    Azido-PEG11-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132034
    Benzyl-PEG6-t-butyl ester

    		PROTAC Linkers Cancer
    Benzyl-PEG6-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132081
    Benzyl-PEG10-t-butyl ester

    		PROTAC Linkers Cancer
    Benzyl-PEG10-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132044
    Benzyl-PEG8-t-butyl ester

    		PROTAC Linkers Cancer
    Benzyl-PEG8-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132071
    Methylamino-PEG3-t-butyl ester

    		PROTAC Linkers Cancer
    Methylamino-PEG3-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132073
    Benzyl-PEG14-t-butyl-ester

    		PROTAC Linkers Cancer
    Benzyl-PEG14-t-butyl-ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140783
    Azido-PEG15-t-butyl ester

    		PROTAC Linkers Cancer
    Azido-PEG15-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-W190816
    Acid-PEG7-t-butyl ester

    		PROTAC Linkers Cancer
    Acid-PEG7-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-143838
    Acid-PEG14-t-butyl ester

    		PROTAC Linkers Cancer
    Acid-PEG14-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132061
    Azido-PEG14-t-butyl ester

    		PROTAC Linkers Cancer
    Azido-PEG14-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-A0152A
    D-Thyroxine sodium

    D-T4 sodium

    		 Others Cardiovascular Disease
    D-thyroxine (D-T4) sodium is a laevorotatory isomer of thyroxine, and can used for the research of the dysfunctions of thyroid.
  • HY-140386
    Ms-PEG10-t-butyl ester

    		PROTAC Linkers Cancer
    Ms-PEG10-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132054
    Benzyl-PEG17-t-butyl ester

    		PROTAC Linkers Cancer
    Benzyl-PEG17-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140384
    Ms-PEG5-t-butyl ester

    		PROTAC Linkers Cancer
    Ms-PEG5-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132060
    Azido-PEG7-t-butyl ester

    		PROTAC Linkers Cancer
    Azido-PEG7-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132079
    FmocNH-PEG4-t-butyl acetate

    		PROTAC Linkers Cancer
    FmocNH-PEG4-t-butyl acetate is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132080
    Bis-PEG8-t-butyl ester

    		PROTAC Linkers Cancer
    Bis-PEG8-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-143835
    Acid-PEG9-t-butyl ester

    		PROTAC Linkers Cancer
    Acid-PEG9-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132084
    Bromoacetamido-PEG8-t-butyl acetate

    		PROTAC Linkers Cancer
    Bromoacetamido-PEG8-t-butyl acetate is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-129974
    3,3'-Diiodo-L-thyronine

    3,3'-T2

    		 Endogenous Metabolite COX Metabolic Disease
    3,3'-Diiodo-L-thyronine (3,3'-T2) is an endogenous metabolite of thyroid hormone. 3,3'-Diiodo-L-thyronine significantly enhances COX activity.
  • HY-P3994
    [3,5 Diiodo-Tyr7] Peptide T

    		Amino Acid Derivatives Others
    [3,5 Diiodo-Tyr7] Peptide T is a threonine derivative.
  • HY-W010696AS
    Reverse T3-13C6 hydrochloride

    3′,5′,3-Triiodothyronine-13C6 (hydrochloride)

    		 Isotope-Labeled Compounds Thyroid Hormone Receptor Others
    Reverse T3- 13C6 (hydrochloride) is the 13C labeled Reverse T3[1].
  • HY-152657
    N1-Methyl-N3-[(2S)-2-(t-butoxycarbonyl)amino-3-(t-butoxycarbonyl)] propylpseudouridine

    		Nucleoside Antimetabolite/Analog Others
    N1-Methyl-N3-[(2S)-2-(t-butoxycarbonyl)amino-3-(t-butoxycarbonyl)] propylpseudouridine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc.
  • HY-106199
    Adenosine A1 receptor activator T62

    		Adenosine Receptor Inflammation/Immunology Neurological Disease
    Adenosine A1 receptor activator T62 is an allosteric enhancer of adenosine A1 receptor. Adenosine A1 receptor activator T62 produces antinociception in animal models of acute pain and also reduces hypersensitivity in models of inflammatory and nerve-injury pain.
  • HY-Y1164S1
    D-Alanine-3,3,3-N-t-Boc-d4

    		Isotope-Labeled Compounds Others
    D-Alanine-3,3,3-N-t-Boc-d4 is the deuterium labeled D-Alanine-3,3,3-N-t-Boc.
  • HY-79404A
    Boc-beta-t-butyl-d-alanine

    		Amino Acid Derivatives Others
    Boc-beta-t-butyl-d-alanine is an intermediate, can be used in the synthesis of peptides and other amino acids.
  • HY-19344
    Lifitegrast

    SAR 1118; SHP-606

    		 Integrin Inflammation/Immunology
    Lifitegrast (SAR 1118) is a potent integrin antagonist. Lifitegrast blocks the binding of intercellular adhesion molecule 1 (ICAM-1) to lymphocyte function-associated antigen 1 (LFA-1), interrupting the T cell-mediated inflammatory cycle. Lifitegrast inhibits Jurkat T cell attachment to ICAM-1 with an IC50 of 2.98 nM. Lifitegrast can be used for researching dry eye disease.
  • HY-19344A
    Lifitegrast sodium

    SAR 1118 sodium; SHP-606 sodium

    		 Integrin Inflammation/Immunology
    Lifitegrast (SAR 1118) sodium is a potent integrin antagonist. Lifitegrast sodium blocks the binding of intercellular adhesion molecule 1 (ICAM-1) to lymphocyte function-associated antigen 1 (LFA-1), interrupting the T cell-mediated inflammatory cycle. Lifitegrast sodium inhibits Jurkat T cell attachment to ICAM-1 with an IC50 of 2.98 nM. Lifitegrast sodium can be used for researching dry eye disease.
  • HY-151772
    Methyltetrazine-PEG12-t-butyl ester

    		ADC Linker Others
    Methyltetrazine-PEG12-t-butyl ester is a monodisperse PEG compound. Methyltetrazine-PEG12-t-butyl ester is a click chemistry reagent containing a tetrazine group. Click chemistry has great potential for use in binding between nucleic acids, lipids, proteins, and other molecules, and has been used in many research fields because of its beneficial characteristics, including high yield, high specificity, and simplicity.
  • HY-Y1164S
    D-Alanine-3,3,3-N-t-Boc-d3

    		Isotope-Labeled Compounds Others
    D-Alanine-3,3,3-N-t-Boc-d3 is the deuterium labeled D-Alanine-3,3,3-N-t-Boc[1].
  • HY-A0152
    D-Thyroxine

    D-T4

    		 Endogenous Metabolite Metabolic Disease
    D-Thyroxine (D-T4) is a thyroid hormone that can inhibit TSH secretion. D-Thyroxine can be used for the research of hypercholesterolemia.
  • HY-132089
    N-Boc-PEG3-t-butyl ester

    		PROTAC Linkers Cancer
    N-Boc-PEG3-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-152299
    5-(t-Butyloxycarbonylmethoxy)uridine

    		Nucleoside Antimetabolite/Analog Others
    5-(t-Butyloxycarbonylmethoxy)uridine is a uridine analogue. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents.
  • HY-153406
    Activated T Subunit

    		Others Others
    Activated T Subunit can be used in the synthesis of exon jumping oligomer conjugates. The oligomer conjugates complement selected target sites in the human anti-muscular atrophy protein gene and induce exon 51 jumping. It can be used for research of muscular dystrophy.
  • HY-148174
    JNJ-3790339

    		DGK Cancer
    JNJ-3790339, a Ritanserin (HY-10791) analog, is a potent and selective diacylglycerol kinase (DGKα) inhibitor with an IC50 of 9.6 μM. JNJ-3790339 has induction of toxicity in malignant cells, and improves ability to upregulate T cell activation.
  • HY-P3918
    EGF-R (661-681) T669 Peptide

    		p38 MAPK Others
    EGF-R (661-681) T669 Peptide is a MAPK substrate that can used to measure MAPK catalytic activity.
  • HY-W034551
    DOTA-tri(t-butyl ester)

    		Others Others
    DOTA-tri(t-butyl ester) can be used in the synthesis of generations 3 (G3) nanoglobular magnetic resonance imaging (MRI) contrast agents for MR angiography and tumor angiogenesis imaging.
  • HY-126037
    (±)-ML 209

    		ROR Inflammation/Immunology
    (±)-ML 209 (compound 4n), a diphenylpropanamide, is a retinoic acid-related orphan receptor RORγ antagonist with an IC50 of 1.1 μM. (±)-ML 209 inhibits RORγt transcriptional activity with an IC50 of 300 nM in HEK293t cells. (±)-ML 209 inhibits the transcriptional activity of RORγt, but not RORα in cells. (±)-ML 209 selectively inhibits murine Th17 cell differentiation without affecting the differentiation of naïve CD4 + T cells into other lineages, including Th1 and regulatory T cells.
  • HY-W108399
    3’-O-t-Bulyldimethylsilylthymidine

    		Nucleoside Antimetabolite/Analog Cancer
    3’-O-t-Bulyldimethylsilylthymidine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc.
  • HY-140510
    N-Methyl-N-(t-Boc)-PEG4-acid

    		PROTAC Linkers Cancer
    N-Methyl-N-(t-Boc)-PEG4-acid is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-141902S
    FMOC-L-Glutamic Acid-13C5,15N- 5-t-butyl ester

    		Isotope-Labeled Compounds Others
    FMOC-L-Glutamic Acid- 13C5, 15N-5-t-butyl ester is the 13C and 15N labeled FMOC-L-Glutamic Acid-5-t-butyl ester[1].
  • HY-D0215
    Safranin

    Safranine T

    		 Fluorescent Dye Others
    Safranin (Safranin T) is an important and classical phenazinium dye. Safranin has been extensively used in the academic field as a spectroscopic probe and indicator. Safranin possesses a planar structure and cationic charge. It can readily intercalate into biological macromolecules, including DNA and proteins. Safranin can be used as a redox indicator in the determination of metal ion concentration.
  • HY-140405
    1-(t-Boc-Aminooxy)-3-aminooxy-propane

    		PROTAC Linkers Cancer
    1-(t-Boc-Aminooxy)-3-aminooxy-propane is an alkyl/ether-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-144079
    Bromo-C4-PEG4-t-butyl ester

    		PROTAC Linkers Cancer
    Bromo-C4-PEG4-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140753
    DOTA-(t-butyl)3-PEG5-azide

    		PROTAC Linkers Cancer
    DOTA-(t-butyl)3-PEG5-azide is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-132304
    CC-90005

    		PKC Inflammation/Immunology
    CC-90005 is a potent, selective and orally active inhibitor of protein kinase C-θ (PKC-θ), with an IC50 of 8 nM. CC-90005 shows selectivity for PKC-θ over PKC-δ (IC50=4440 nM). CC-90005 can inhibit T cell activation by inhibiting IL-2 expression.
  • HY-119347
    Cirsilineol

    		IFNAR STAT Cancer Inflammation/Immunology
    Cirsilineol, a natural flavone compound, selectively inhibits IFN-γ/STAT1/T-bet signaling in intestinal CD4 + T cells. Cirsilineol has potent immunosuppressive and anti-tumor properties. Cirsilineol significantly ameliorates trinitro-benzene sulfonic acid (TNBS)-induced T-cell-mediated experimental colitis in mice.
  • HY-20142
    3’-O-(t-Butyldiphenylsilyl) thymidine

    		Nucleoside Antimetabolite/Analog Cancer
    3’-O-(t-Butyldiphenylsilyl) thymidine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc.
  • HY-112272
    Lerociclib

    G1T38

    		 CDK Cancer
    Lerociclib (G1T38) is a potent and selective inhibitor of CDK4/6, with IC50s of 1 nM, 2 nM for CDK4/CyclinD1 and CDK6/CyclinD3, respectively.
  • HY-140874
    Azido-PEG4-Amido-tri-(t-butoxycarbonylethoxymethyl)-methane

    		PROTAC Linkers Cancer
    Azido-PEG4-Amido-tri-(t-butoxycarbonylethoxymethyl)-methane is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-141549
    BPK-21

    		Others Inflammation/Immunology
    BPK-21, an active acrylamide, suppresses T cell activation through blockade of ERCC3 function. BPK-21 specifically targets C342 in the helicase ERCC3.
  • HY-148243
    IGUANA-1 free base

    STL5-T-0057

    		 Aldehyde Dehydrogenase (ALDH) Cancer
    IGUANA-1 free base (STL5-T-0057) is an selective ALDH1 B1 inhibitor with an IC50 value of 30 nM. IGUANA-1 free base inhibits cell growth of SW480 cells in adherent and spheroid conditions with IC50 values of 2.46 and 0.39 μM, respectively. IGUANA-1 free base can be used for the research of cancer.
  • HY-112272A
    Lerociclib dihydrochloride

    G1T38 dihydrochloride

    		 CDK Cancer
    Lerociclib dihydrochloride (G1T38 dihydrochloride) is a potent and selective inhibitor of CDK4/CDK6, with IC50s of 1 nM and 2 nM for CDK4/CyclinD1 and CDK6/CyclinD3, respectively.
  • HY-140592
    Azido-PEG3-S-PEG4-t-butyl ester

    		PROTAC Linkers Cancer
    Azido-PEG3-S-PEG4-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-W112280
    meso-Tetra-(3,5-di-t-butylphenyl)porphine

    		Biochemical Assay Reagents Others
    meso-tetra-(3,5-Di-t-butylphenyl)porphine is a biochemical reagent that can be used as a biological material or organic compound for life science related research.
  • HY-W019721
    Cyclosporin D

    		Nuclear Factor of activated T Cells (NFAT) Inflammation/Immunology
    Cyclosporin D, a metabolite of Cyclosporin A, is a weak immunosuppressant. Cyclosporin D is used as internal standard for quantification of Cyclosporin A. Cyclosporin A is a potent immunosuppressant agent, suppress T cell activation by inhibiting calcineurin and the calcineurin-dependent transcription factors nuclear factor of activated T cells (NFAc).
  • HY-P99024
    Glofitamab

    RO7082859

    		 CD20 Cancer
    Glofitamab (RO7082859) is a T-cell-engaging bispecific antibody possessing a novel 2:1 structure with bivalency for CD20 on B cells and monovalency for CD3 on T cells. Glofitamab leads to T-cell activation, proliferation, and tumor cell killing upon binding to CD20 on malignant cells. Glofitamab induces durable complete remissions in relapsed or refractory B-Cell lymphoma.
  • HY-140584
    N-Desthiobiotin-N-bis(PEG4-t-butyl ester)

    		PROTAC Linkers Cancer
    N-Desthiobiotin-N-bis(PEG4-t-butyl ester) is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-W558459
    3’-O-t-Butyldimethylsilyladenosine

    		Nucleoside Antimetabolite/Analog Cancer
    3’-O-t-Butyldimethylsilyladenosine is an adenosine analog. Adenosine analogs mostly act as smooth muscle vasodilators and have also been shown to inhibit cancer progression. Its popular products are adenosine phosphate, Acadesine (HY-13417), Clofarabine (HY-A0005), Fludarabine phosphate (HY-B0028) and Vidarabine (HY-B0277).
  • HY-152968
    2’-O-t-Butyldimethylsilyladenosine

    		Others Others
    2’-O-t-Butyldimethylsilyladenosine is a adenosine analog. Adenosine analogs mostly act as smooth muscle vasodilators and have also been shown to inhibit cancer progression. Its popular products are adenosine phosphate, Acadesine (HY-13417), Clofarabine (HY-A0005), Fludarabine phosphate (HY-B0028) and Vidarabine (HY-B0277).
  • HY-W110910
    Eriochrome black T indicator (C.I. 14645), 1% solid

    		Biochemical Assay Reagents Others
    Eriochrome black T indicator (C.I. 14645), 1% solid is a biochemical reagent that can be used as a biological material or organic compound for life science related research.
  • HY-B0116
    Stavudine

    d4T

    		 Reverse Transcriptase HIV Nucleoside Antimetabolite/Analog NOD-like Receptor (NLR) Autophagy Apoptosis Infection
    Stavudine (d4T) is an orally active nucleoside reverse transcriptase inhibitor (NRTI). Stavudine has activity against HIV-1 and HIV-2. Stavudine also inhibits the replication of mitochondrial DNA (mtDNA). Stavudine reduces NLRP3 inflammasome activation and modulates Amyloid-β autophagy. Stavudine induces apoptosis.
  • HY-B0116A
    Stavudine sodium

    d4T sodium

    		 Reverse Transcriptase HIV Nucleoside Antimetabolite/Analog NOD-like Receptor (NLR) Autophagy Apoptosis Infection
    Stavudine (d4T) sodium is an orally active nucleoside reverse transcriptase inhibitor (NRTI). Stavudine sodium has activity against HIV-1 and HIV-2. Stavudine sodium also inhibits the replication of mitochondrial DNA (mtDNA). Stavudine sodium reduces NLRP3 inflammasome activation and modulates Amyloid-β autophagy. Stavudine sodium induces apoptosis.
  • HY-150741
    ODN 2216

    		Toll-like Receptor (TLR) IFNAR Interleukin Related Cancer Infection Inflammation/Immunology
    ODN 2216 is a human-specific TLR9 (toll-like receptor 9) ligand or agonist. ODN 2216 induces high amounts of IFN-α and IFN-β. ODN 2216 induces IFN-α by pDC (plasmacytoid DC) and IL-12 (p40) production by DC (dendritic cells). ODN 2216 stimulates IFN-γ production in peripheral blood mononuclear cells (PBMC), which is indirect and mediated by IFN-α/β. ODN 2216 can activate NK cells and promote IFN-γ production of TCR-triggered CD4 + T cells.
  • HY-N10196
    Cerebroside D

    		Endogenous Metabolite Inflammation/Immunology
    Cerebroside D, a glycoceramide compound, improves experimental colitis in mice with multiple targets against activated T lymphocytes.
  • HY-150745
    ODN 24987

    		Toll-like Receptor (TLR) Inflammation/Immunology
    ODN 24987 is a Guanine-modified inhibitory oligonucleotides (ODN), targeting TLR9. ODN 24987 can inhibit IL-6 and IFN-α release. ODN 24987 can be used for research immune disorders. ODN 24987 sequence: 5’-C-C-T-G-G-C-c7G-G-G-G-3’.
  • HY-13624A
    Epirubicin hydrochloride

    4'-Epidoxorubicin hydrochloride

    		 DNA/RNA Synthesis Topoisomerase Apoptosis Antibiotic Cancer
    Epirubicin hydrochloride (4'-Epidoxorubicin hydrochloride), a semisynthetic L-arabino derivative of doxorubicin, has an antineoplastic agent by inhibiting Topoisomerase. Epirubicin hydrochloride inhibits DNA and RNA synthesis. Epirubicin hydrochloride is a Forkhead box protein p3 (Foxp3) inhibitor and inhibits regulatory T cell activity.
  • HY-13624
    Epirubicin

    4'-Epidoxorubicin

    		 DNA/RNA Synthesis Topoisomerase Apoptosis Antibiotic Cancer
    Epirubicin (4'-Epidoxorubicin), a semisynthetic L-arabino derivative of doxorubicin, has an antineoplastic agent by inhibiting Topoisomerase. Epirubicin inhibits DNA and RNA synthesis. Epirubicin is a Forkhead box protein p3 (Foxp3) inhibitor and inhibits regulatory T cell activity.
  • HY-154420
    2’,3’-Bis-(O-t-butyldimethylsilyl)uridine

    		Nucleoside Antimetabolite/Analog Cancer
    2’,3’-Bis-(O-t-butyldimethylsilyl)uridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc.
  • HY-17002
    Suplatast (Tosilate)

    IPD 1151T

    		 Interleukin Related Inflammation/Immunology
    Suplatast Tosilate (IPD 1151T) is an orally active Th2 cytokine inhibitor which can inhibit both IL-4 and IL-5 production from Th2 cells and suppress IgE synthesis. Suplatast Tosilate is an anti-allergic agent. Suplatast Tosilate has antiasthmatic, anti-inflammatory and antifibrotic activity.
  • HY-140999
    Mal-PEG4-Lys(t-Boc)-NH-m-PEG24

    		PROTAC Linkers Cancer
    Mal-PEG4-Lys(t-Boc)-NH-m-PEG24 is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140094
    N-(Propargyl-PEG2)-N-Boc-PEG3-t-butyl ester

    		PROTAC Linkers Cancer
    N-(Propargyl-PEG2)-N-Boc-PEG3-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140564
    N-(Azido-PEG3)-N-Boc-PEG3-t-butyl ester

    		PROTAC Linkers Cancer
    N-(Azido-PEG3)-N-Boc-PEG3-t-butyl ester is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140928
    Biotin-PEG4-amino-t-Bu-DADPS-C3-alykne

    		PROTAC Linkers Cancer
    Biotin-PEG4-amino-t-Bu-DADPS-C3-alykne is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140921
    Biotin-PEG4-amino-t-Bu-DADPS-C6-azide

    		PROTAC Linkers Cancer
    Biotin-PEG4-amino-t-Bu-DADPS-C6-azide is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-B0172A
    Isoallolithocholic acid

    3β-Hydroxy-5α-cholanic acid

    		 Others Inflammation/Immunology
    Isoallolithocholic acid (3β-Hydroxy-5α-cholanic acid), a derivative of Lithocholic acid (HY-10219), is a T cell regulator. Isoallolithocholic acid enhances regulatory T cells (Tregs) differentiation.
  • HY-149213
    LSD1-IN-24

    		Histone Demethylase PD-1/PD-L1 Cancer
    LSD1-IN-24(compound 3S) is a selective LSD1 inhibitor with IC50 = 0.247 μM. LSD1-IN-24 can mediate the expression of PD-L1, enhance T cell killing response, and can be used in cancer research.
  • HY-P99259
    Cabiralizumab

    FPA 008; Anti-Human CSF1R Recombinant Antibody

    		 c-Fms Cancer Inflammation/Immunology
    Cabiralizumab (FPA 008) is an anti-CSF1R monoclonal antibody (MAb). Cabiralizumab enhances T cell infiltration and antitumor T cell immune responses. Cabiralizumab inhibits the activation of osteoclasts and blocks bone destruction, and can be used in the research of rheumatoid arthritis (RA). Cabiralizumab can combine with Nivolumab (HY-P9903) for lung cancer research.
  • HY-150746
    ODN 24991

    		Toll-like Receptor (TLR) Inflammation/Immunology
    ODN 24991, a guanine-modified inhibitory oligonucleotide (INH-ODN), is a TLR3, TLR7 and TLR9 (Toll-like receptor) inhibitor, and its parent is INH-ODN 2088. ODN 24991 disrupts TLR3-, TLR7- and TLR9-mediated immune cell immune responses. ODN 24991 sequence: 5'-C-C-T-G-G-C-c7rGm-G-G-G-3'.
  • HY-140870
    N-(Azido-PEG4)-N-bis(PEG4-t-butyl ester)

    		PROTAC Linkers Cancer
    N-(Azido-PEG4)-N-bis(PEG4-t-butyl ester) is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140873
    N-(Azido-PEG3)-N-bis(PEG1-t-butyl ester)

    		PROTAC Linkers Cancer
    N-(Azido-PEG3)-N-bis(PEG1-t-butyl ester) is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140092
    N-(t-Boc-Aminooxy-PEG2)-N-bis(PEG3-propargyl)

    		PROTAC Linkers Cancer
    N-(t-Boc-Aminooxy-PEG2)-N-bis(PEG3-propargyl) is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-154417
    2’,3’-Bis(O-t-butyldimethylsilyl)-2-thiouridine

    		Nucleoside Antimetabolite/Analog Cancer
    2’,3’-Bis(O-t-butyldimethylsilyl)-2-thiouridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc.
  • HY-154418
    2’,3’-Bis(O-(t-butyldimethylsilyl)-5-methoxyuridine

    		Nucleoside Antimetabolite/Analog Cancer
    2’,3’-Bis(O-(t-butyldimethylsilyl)-5-methoxyuridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc.
  • HY-P3554
    Carbomethoxycarbonyl-D-Pro-D-Phe-OBzl

    		HIV Infection
    Carbomethoxycarbonyl-D-Pro-D-Phe-OBzl (compound (CPF(LL)) is an HIV-1 inhibitor. Carbomethoxycarbonyl-D-Pro-D-Phe-OBzl interacts with gp120 to block gp120 binding to CD4 and preserve CD4-dependent T cell function.
  • HY-143849
    N-bis(t-boc-N-amido-PEG3)-N-(PEG3-acid) (hydrochloride)

    		PROTAC Linkers Cancer
    N-bis(t-boc-N-amido-PEG3)-N-(PEG3-acid) hydrochloride is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-154173
    3’-O-(t-Butyldimethylsilyl)-2’-O-(2-methoxyethyl) uridine

    		Nucleoside Antimetabolite/Analog Cancer
    3’-O-(t-Butyldimethylsilyl)-2’-O-(2-methoxyethyl) uridine is a uridine analog. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents.
  • HY-154370
    2’,3’-Bis-O-(t-butyldimethylsilyl)-N1-methylpseudouridine

    		Nucleoside Antimetabolite/Analog Cancer
    2’,3’-Bis-O-(t-butyldimethylsilyl)-N1-methylpseudouridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc.
  • HY-B0078
    Dacarbazine

    Imidazole Carboxamide

    		 Nucleoside Antimetabolite/Analog Apoptosis Cancer
    Dacarbazine is a cell cycle nonspecific antineoplastic alkylating agent. Dacarbazine inhibits T and B lymphoblastic response, with IC50 values of 50 and 10 μg/ml, respectively. Dacarbazine can be used for the research of metastatic malignant melanoma.
  • HY-B0078B
    Dacarbazine hydrochloride

    Imidazole Carboxamide hydrochloride

    		 Antibiotic Cancer
    Dacarbazine hydrochloride is a cell cycle nonspecific antineoplastic alkylating agent. Dacarbazine hydrochloride inhibits T and B lymphoblastic response, with IC50 values of 50 and 10 μg/mL, respectively. Dacarbazine hydrochloride can be used for the research of metastatic malignant melanoma.
  • HY-P2561
    Influenza Matrix Protein (61-72)

    		Influenza Virus Infection Inflammation/Immunology
    Influenza Matrix Protein (61-72) is a peptide fragment derived from matrix protein of influenza viruses, corresponds to amino acids 61-72. Influenza Matrix Protein (61-72) is a specific epitope which can induce CD4 + T-cell response.
  • HY-P99814
    Pavurutamab

    AMG-701

    		 CD3 Cancer Inflammation/Immunology
    Pavurutamab (AMG-701) is a bispecific T cell engager molecule that anti-CD3 and anti-B cell maturation antigens (BCMA). Pavurutamab has an extended half-life based on Pacanalotamab (HY-P99798). The Fc of Pavurutamab is coupled to molecules to improve pharmacokinetic parameters. Pavurutamab has potential applications in immune regulation and multiple myeloma (MM).
  • HY-129055
    Isoeleutherin

    		Fungal Inflammation/Immunology
    Isoeleutherin is a naphthopyran derivative isolated from E. americana Merr. Et Heyne with anti-fungal, anti-viral, and anti-tumor activities. Isoeleutherin plays an important role in selective modulation of T helper cell-mediated immune responses.
  • HY-101093
    CA-170

    		PD-1/PD-L1 Inflammation/Immunology Cancer
    CA-170 is an orally delivered dual inhibitor of VISTA and PD-L1. CA-170 exhibits potent rescue of proliferation and effector functions of T cells inhibited by PD-L1/L2 and VISTA with selectivity over other immune checkpoint proteins as well as a broad panel of receptors and enzymes.
  • HY-129974S
    3,3'-Diiodo-L-thyronine-13C6

    3,3'-T2-13C6

    		 COX Endogenous Metabolite Metabolic Disease
    3,3'-Diiodo-L-thyronine- 13C6 is the 13C labeled 3,3'-Diiodo-L-thyronine[1]. 3,3'-Diiodo-L-thyronine (3,3'-T2) is an endogenous metabolite of thyroid hormone. 3,3'-Diiodo-L-thyronine significantly enhances COX activity[2][3].
  • HY-109520
    Glatiramer acetate

    		Others Inflammation/Immunology
    Glatiramer acetate, a synthetic analogue of myelin basic protein and an immunomodulating agent, can be used for the research of multiple sclerosis. Glatiramer acetate exhibits strong and promiscuous binding to MHC molecules and consequent competition with various myelin antigens for their presentation to T cells. A further aspect of its action is potent induction of specific suppressor cells of the T helper 2 (Th2) type that migrate to the brain and lead to in situ bystander suppression.
  • HY-154218
    2-O-Benzoyl-3-O-t-butyldiphenylsilyl-L-threono lactone

    		Nucleoside Antimetabolite/Analog Cancer
    2-O-Benzoyl-3-O-t-butyldiphenylsilyl-L-threono lactone is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc.
  • HY-154357
    4’-alpha-C-Azido-2’,3’-bis(O-t-butyldimethylsilyl)uridine

    		Nucleoside Antimetabolite/Analog Cancer
    4’-alpha-C-Azido-2’,3’-bis(O-t-butyldimethylsilyl)uridine is a uridine analog. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents.
  • HY-154358
    4’-alpha-C-Allyl-2’,3’-bis(O-t-butyldimethylsilyl) uridine

    		Nucleoside Antimetabolite/Analog Cancer
    4’-alpha-C-Allyl-2’,3’-bis(O-t-butyldimethylsilyl) uridine is a uridine analog. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents.
  • HY-49199
    2',3',5'-Tri-O-(t-butyldimethylsilyl)-4'-C-hydroxymethyl uridine

    		Nucleoside Antimetabolite/Analog Cancer
    2',3',5'-Tri-O-(t-butyldimethylsilyl)-4'-C-hydroxymethyl uridine is a uridine analog. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents.
  • HY-12072
    Lck Inhibitor

    		Src Inflammation/Immunology
    Lck Inhibitor is a potent, orally active Lck (lymphocyte specific kinase) inhibitor with IC50s of 7, 2.1, 4.2 and 200 nM for Lck, Lyn, Src and Syk kinases, respectively. Lck Inhibitor shows >1000-fold selectivity for Lck over MAPK, CDK and RSK family representatives. Lck Inhibitor inhibits T cell proliferation and in vivo models of arthritis.
  • HY-P99752
    Nemvaleukin alfa

    ALKS 4230; RDB-1450

    		 Interleukin Related Cancer Inflammation/Immunology
    Nemvaleukin alfa (ALKS 4230) is a IL-2 fusion protein that selectively binds to intermediate-affinity IL-2R. Nemvaleukin alfa is an activator of NK and effector T cells. Nemvaleukin alfa can be used for research of cancer.
  • HY-154492
    2’,3’-Bis(O-t-butyldimethylsilyl)-4’,5’-didehydro-5’-deoxyuridine

    		Nucleoside Antimetabolite/Analog Cancer
    2’,3’-Bis(O-t-butyldimethylsilyl)-4’,5’-didehydro-5’-deoxyuridine is a uridine analog. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents.
  • HY-152874
    5-N-(t-Butyloxycarbonylmethyl)-N-trifluoro acetyl-aminomethyl-2’-O-methyluridine

    		Nucleoside Antimetabolite/Analog Others
    5-N-(t-Butyloxycarbonylmethyl)-N-trifluoro acetyl-aminomethyl-2’-O-methyluridine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc.
  • HY-146727
    JAK3-IN-11

    		JAK Inflammation/Immunology
    JAK3-IN-11 (Compound 12), a potent, noncytotoxic, irreversible, orally active JAK3 inhibitor with IC50 value of 1.7 nM, has excellent selectivity (>588-fold compared to other JAK isoforms), covalently bind to the ATP-binding pocket in JAK3. JAK3-IN-11 strongly inhibits JAK3-dependent signaling and T cell proliferation, is a promising tool for study autoimmune diseases.
  • HY-P99680
    Keliximab

    SB-210396; IDEC CE9.1

    		 Interleukin Related Cancer
    Keliximab (SB-210396) is a chimeric human/macaque IgG1 anti-CD4 monoclonal antibody with a Ki value of 1.0 nM for soluble CD4. Keliximab blocks T cell proliferation and inhibits IL-2 production. Keliximab can be used for cancer research.
  • HY-P99765
    Odulimomab

    anti-LFA1

    		 Integrin Inflammation/Immunology
    Odulimomab (anti-LFA1) is an anti-LFA-1 monoclonal antibody. Odulimomab inhibits proliferation of T lymphocyte and shows protective effects against ischemia and reperfusion injury. Odulimomab can be used for the research of transplant rejection and immunological disease.
  • HY-154000
    3,5’-Bis(O-t-butyldimethylsilyl)-2’-O-methyl-5-methyl cytidine

    		Nucleoside Antimetabolite/Analog Cancer
    3,5’-Bis(O-t-butyldimethylsilyl)-2’-O-methyl-5-methyl cytidine is a cytidine analog. Cytidine analogs have a mechanism of inhibiting DNA methyltransferases (such as Zebularine, HY-13420), and have potential anti-metabolic and anti-tumor activities.
  • HY-18522
    AA26-9

    		Phospholipase Metabolic Disease
    AA26-9 is a potent and broad spectrum serine hydrolase inhibitor. AA26-9 targets included serine peptidases, lipases, amidases, esterases, and thioesterases. AA26-9 shows inhibitory activity against approximately 1/3 of the 40+ serine hydrolases detected in immortalized T cell lines .
  • HY-123531
    JNJ 10329670

    		Cathepsin Inflammation/Immunology
    JNJ 10329670 is a potent and selective noncovalent cathepsin S inhibitor with a Ki value of 34 nM for human cathepsin S. JNJ 10329670 blocks invariant chain proteolysis in B cells and dendritic cells, as well as antigen-induced T cell proliferation.
  • HY-P2560
    LCMV GP (61-80)

    		Arenavirus Infection Inflammation/Immunology
    LCMV GP (61-80) is a peptide fragment derived from lymphocytic choriomeningitis virus (LCMV) glycoprotein (GP), and corresponds to amino acids 61-80. LCMV GP (61-80) is a specific epitope which can induce CD4 + T-cell response.
  • HY-146740
    PD-1/PD-L1-IN-27

    		PD-1/PD-L1 Cancer
    PD-1/PD-L1-IN-27 is a potent PD-1/PD-L1 inhibitor with an IC50 value of 134 nM. PD-1/PD-L1-IN-27 shows antitumor effects with low T cell cytotoxicity. PD-1/PD-L1-IN-27 has the ability to activate CD8 + T cells and reduces T cell exhaustion.
  • HY-102011
    BMS-1166

    		PD-1/PD-L1 Cancer Inflammation/Immunology
    BMS-1166 is a potent PD-1/PD-L1 immune checkpoint inhibitor. BMS-1166 induces dimerization of PD-L1 and blocks its interaction with PD-1, with an IC50 of 1.4 nM. BMS-1166 antagonizes the inhibitory effect of PD-1/PD-L1 immune checkpoint on T cell activation.
  • HY-P99238
    Rolinsatamab

    		Interleukin Related Cancer Inflammation/Immunology
    Rolinsatamab is a potent dual IL-4 and IL-13 inhibitor as a fully humanized bispecific monoclonal antibody. Rolinsatamab chimeric antigen receptor sequence T cell. Rolinsatamab can be used in research of immune disease.
  • HY-W560806
    5’-O-(4,4’-Dimethoxytrityl)-3’-O-t-butyldimethylsilyl adenosine

    		Nucleoside Antimetabolite/Analog Cancer
    5’-O-(4,4’-Dimethoxytrityl)-3’-O-t-butyldimethylsilyl adenosine is an adenosine analog. Adenosine analogs mostly act as smooth muscle vasodilators and have also been shown to inhibit cancer progression. Its popular products are adenosine phosphate, Acadesine (HY-13417), Clofarabine (HY-A0005), Fludarabine phosphate (HY-B0028) and Vidarabine (HY-B0277).
  • HY-W560807
    5’-O-(4,4’-Dimethoxytrityl)-2’-O-t-butyldimethylsilyl adenosine

    		Nucleoside Antimetabolite/Analog Cancer
    5’-O-(4,4’-Dimethoxytrityl)-2’-O-t-butyldimethylsilyl adenosine is an adenosine analog. Adenosine analogs mostly act as smooth muscle vasodilators and have also been shown to inhibit cancer progression. Its popular products are adenosine phosphate, Acadesine (HY-13417), Clofarabine (HY-A0005), Fludarabine phosphate (HY-B0028) and Vidarabine (HY-B0277).
  • HY-139780
    JNJ-61803534

    		ROR Inflammation/Immunology
    JNJ-61803534 is a potent and orally active RORγt inverse agonist with an IC50 of 9.6  nM. JNJ-61803534 has anti-inflammatory activity. JNJ-61803534 inhibits IL-17A production in human CD4+ T cells under Th17 differentiation conditions.
  • HY-P2375
    Lefitolimod

    MGN 1703

    		 Toll-like Receptor (TLR) HIV Cancer Infection Inflammation/Immunology
    Lefitolimod (MGN 1703) is a DNA-based TLR9 agonist and an immune surveillance reactivator. Lefitolimod induces HIV-specific immune responses and can be used for the research of cancer and HIV-1.
  • HY-150218
    Agatolimod sodium

    ODN 7909; PF-3512676; CpG 7909

    		 Toll-like Receptor (TLR) Cancer
    Agatolimod sodium (ODN 7909) is a class B CpG ODN and is a TLR9 agonist. Agatolimod sodium can be used as vaccine adjuvant. Agatolimod sodium can be used for the research of cancer. Sequence: 5’-TCGTCGTTTTGTCGTTTTGTCGTT-3’.
  • HY-146244
    Agatolimod

    ODN 2006; PF-3512676 free acid; CpG 7909 free acid

    		 Toll-like Receptor (TLR) Cancer Inflammation/Immunology
    Agatolimod (ODN 2006), a class B ODN (oligodeoxynucleotide), is a TLR9 agonist. Agatolimod is also an optimal CpG sequence for humans. Agatolimod stimulates very strong production of NO2 and IL-6 in HD11 cells. Agatolimod can be used for breast cancer research. Sequence: 5'-tcgtcgttttgtcgttttgtcgtt-3'.
  • HY-150734
    ODN 2007

    		Toll-like Receptor (TLR) Infection Inflammation/Immunology
    ODN 2007, a class B CpG ODN (oligodeoxynucleotide), is a Toll-like receptor (TLR) ligand. ODN 2007 can be used as an immunomodulator, vaccine adjuvant, and enhance immune responses in mammals, fish, and humans. ODN 2007 sequence: 5'-TCGTCGTTGTCGTTTTGTCGTT-3'.
  • HY-145256
    GABAA receptor agent 4

    		GABA Receptor Neurological Disease
    GABAA receptor agent 4 (compound 1e) is a potent γ-GABAAR antagonist with an Ki of 0.18 µM. GABAA receptor agent 4 efficiently rescues inhibition of T cell proliferation. GABAA receptor agent 4 has the immunomodulatory potential.
  • HY-109528
    Fomivirsen sodium

    ISIS-2922

    		 CMV Infection
    Fomivirsen (ISIS-2922) sodium is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen sodium is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen sodium binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation.
  • HY-N3796
    Echinulin

    Echinuline

    		 NF-κB Inflammation/Immunology
    Echinulin (Echinuline) is a cyclic dipeptide carrying a triprenylated indole moiety. Echinulin contributes to the activation of T cell subsets, which leads to NF-κB activation.Echinulin exerts its immune roles by the NF-κB pathway.Echinulin has the potential to serve as a immunotherapeutic agent.
  • HY-148412
    Monarsen

    EN101; ODN 7040; BL 7040

    		 Cholinesterase (ChE) Others
    Monarsen (EN101) is a synthetic 20-base antisense oligodeoxynucleotide directed against the human AChE gene. Monarsen is used in the study of Autoimmune myasthenia gravis (MG), a neuromuscular disorder caused by autoantibodies directed against the acetylcholine receptor (AChR).
  • HY-110177
    SP-100030

    		NF-κB Inflammation/Immunology
    SP-100030 is a potent NF-κB and activator protein-1 (AP-1) double inhibitor (IC50s=50 and 50 nM, respectively). SP-100030 inhibits IL-2, IL-8, and TNF-alpha production in Jurkat and other T cell lines. SP-100030 decreases murine collagen-induced arthritis (CIA).
  • HY-129624A
    Bisindolylmaleimide VIII acetate

    Ro 31-7549 acetate; Bis VIII acetate

    		 PKC Apoptosis Cancer Inflammation/Immunology
    Bisindolylmaleimide VIII acetate (Ro 31-7549 acetate) is a potent and selective protein kinase C (PKC) inhibitor with an IC50 of 158 nM for rat brain PKC. Bisindolylmaleimide VIII acetate has IC50s of 53, 195, 163, 213, and 175 nM for PKC-α, PKC-βI, PKC-βII, PKC-γ, PKC-ε, respectively. Bisindolylmaleimide VIII acetate facilitates Fas-mediated apoptosis and inhibits T cell-mediated autoimmune diseases.
  • HY-147081
    AS 1411

    AGRO-100

    		 Others Cancer
    AS1411 is a quadruplex-forming oligonucleotide aptamer that targets nucleolin. It has anti-tumor activity.
  • HY-148413
    Aprinocarsen sodium

    ISIS 3521 sodium

    		 PKC Cancer
    Aprinocarsen (ISIS 3521) sodium, a specific antisense oligonucleotide inhibitor of protein kinase C-alpha (PKC-α). Aprinocarsen sodium is a 20-mer oligonucleotide, it regulates cell differentiation and proliferation. Aprinocarsen sodium inhibits the growth of human tumor cell lines in nude mice. Aprinocarsen sodium shows the value as a chemotherapeutic compound of human cancers.
  • HY-150750
    ODN M362

    		Toll-like Receptor (TLR) Apoptosis Cancer Inflammation/Immunology
    ODN M362, a class C oligodeoxynucleotide, is a TLR-9 agonist and can be used as a vaccine adjuvant. ODN M362 induces cancer cell apoptosis.
  • HY-142937
    RORγt agonist 2

    		ROR Inflammation/Immunology
    RORγt agonist 2 is a potent agonist of RORγt. RORγt agonist 2 promotes the differentiation of Th17 cells and enhances the levels of pro-inflammatory cytokines, thereby increasing the cytotoxicity of lymphocytes. RORγt agonist 2 inhibits the production of regulatory T cells, which suppresses the immune response (extracted from patent WO2021136339A1, compound 17).
  • HY-142938
    RORγt agonist 3

    		ROR Inflammation/Immunology
    RORγt agonist 3 is a potent agonist of RORγt. RORγt agonist 3 promotes the differentiation of Th17 cells and enhances the levels of pro-inflammatory cytokines, thereby increasing the cytotoxicity of lymphocytes. RORγt agonist 3 inhibits the production of regulatory T cells, which suppresses the immune response (extracted from patent WO2021136326A1, compound 23).
  • HY-W176465
    BTA-2

    		Amyloid-β Others
    BTA-2, a benzothiazole dye, is structurally similar to thioflavin T (ThT), which exhibits an enhanced fluorescence signal when bound to amyloid fibrils. BTA-2 has distinct absorption and emission characteristics in solution and when bound to amyloid fibrils, which makes it can used for identifying amyloid fibrils using spectroscopy.
  • HY-146245
    ODN 1826

    CpG 1826

    		 Toll-like Receptor (TLR) Apoptosis Cancer Inflammation/Immunology
    ODN 1826, a class B CpG ODN (oligodeoxynucleotide), is a TLR9 agonist. CpG ODN 1826 is an excellent immunostimulator that induces NO and iNOS production in the murine model. CpG ODN 1826 enhances cell apoptosis. ODN 1826 sequence: 5’-tccatgacgttcctgacgtt-3’.
  • HY-150726
    ODN 1668

    		Toll-like Receptor (TLR) Inflammation/Immunology
    ODN 1668, a class B CpG ODN (oligodeoxynucleotide), is a TLR-9 agonist. ODN 1668 is an immunostimulatory sequence and can be used as vaccine adjuvant. Sequence: 5'-tccatgacgttcctgatgct-3’.
  • HY-150729
    ODN 1982

    		Others Inflammation/Immunology
    ODN 1982 is a unmethylated oligodeoxyribonucleotide (ODN) with no CpG motif, can be used to prepare DNA vaccines. ODN 1982 inhibits R-848 signaling. ODN 1982 sequence: 5’-tccaggacttctctcaggtt-3’.
  • HY-143423A
    (S)-MALT1-IN-5

    		MALT1 Cancer Inflammation/Immunology
    (S)-MALT1-IN-5 is a potent inhibitor of MALT1 protease. (S)-MALT1-IN-5 inhibits the activity of MALT1 is expected to be able to correct the enhancement of MALT1 activity due to abnormality of T cell receptor signal or B cell receptor signal, and cancer or inflammatory disease caused by MALT1 activity is expected. (S)-MALT1-IN-5 has the potential for the research of MALT1-related diseases (extracted from patent WO2020111087A1, compound 1).
  • HY-P99152
    Muromonab

    		CD3 Cancer Inflammation/Immunology
    Muromonab is a monoclonal antibody targeting the CD3 receptor. Muromonab can block all cytotoxic T cell function. Muromonab also as an immunosuppressant agent given to reduce acute solid organ transplant rejection.
  • HY-12521
    GSK-5498A

    		CRAC Channel Inflammation/Immunology
    GSK-5498A is a selective CARC channel inhibitor (IC50: 1 μM). GSK-5498A inhibits mediators release from mast cells and pro-inflammatory cytokines release from T cells. GSK-5498A can be used in the research of inflammatory disorders.
  • HY-150217
    CpG ODN 10101

    ODN 10101

    		 Toll-like Receptor (TLR) HCV Infection Inflammation/Immunology
    CpG ODN 10101, a synthetic oligodeoxynucleotide (ODN),  is a toll-like receptor 9 (TLR9) agonist. CpG ODN 10101 is a potent inducer of cytokine/chemokine expression ex vivo when used in combination with HH2(VQLRIRVAVIRA-NH2). CpG ODN 10101 induces IFN- secretion from dendritic cells (DCs) and stimulates B-cells.CpG ODN 10101 has antiviral and immunomodulatory properties that can influence chronic infection with HCV.
  • HY-150724
    ODN 1018

    1018 ISS

    		 Toll-like Receptor (TLR) Inflammation/Immunology
    ODN 1018 (1018 ISS), an oligodeoxynucleotide, is a TLR-9 agonist. ODN 1018 is also a synthetic immunostimulatory sequence that can be used as vaccine adjuvant. Sequence: 5′-TGACTGTGAACGTTCGAGATGA-3′.
  • HY-150214
    ODN MT 01

    		Others Cancer
    ODN MT 01 is a synthetic oligodeoxynucleotide. ODN MT 01 can be used for experiment research.
  • HY-139874
    CXCR2 antagonist 3

    		CXCR Cancer Inflammation/Immunology
    CXCR2 antagonist 3 (compound 11h) is a potent antagonist of CXC chemokine receptor 2 (CXCR2). CXCR2 antagonist 3 demonstrates double-digit nanomolar potencies against CXCR2 and significantly inhibited neutrophil infiltration into the air pouch. CXCR2 antagonist 3 reduces the infiltration of neutrophils and MDSCs and enhance the infiltration of CD3 + T lymphocytes into the Pan02 tumor tissues.
  • HY-P4046
    HBV Seq2 aa:179-186

    		HIV Inflammation/Immunology
    HBV Seq2 aa:179-186 serve as effective motifs for CTL response in H-2b system after in vitro restimulation of the primed T cells. HBV Seq2 aa:179-186 is a novel epitope identified on the surface antigen of hepatitis B virus.
  • HY-148130
    Rugonersen

    RG6091; RO7248824

    		 E1/E2/E3 Enzyme Others
    Rugonersen (RG6091; RO7248824) is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch.
  • HY-134771
    YM-341619

    AS1617612

    		 STAT Inflammation/Immunology
    YM-341619 (AS1617612) is a potent and orally active STAT6 inhibitor with an IC50 of 0.70 nM. YM-341619 inhibits Th2 differentiation in mouse spleen T cells induced by IL-4 (IC50=0.28 nM) without affecting Th1 cell differentiation. YM-341619 is a promising compound for the the research of allergic diseases, such as allergic asthma.
  • HY-130625
    PD-1/PD-L1-IN 6

    		PD-1/PD-L1 Cancer Inflammation/Immunology
    PD-1/PD-L1-IN 6 (compound A13) is a potent PD-1/PD-L1 interaction inhibitor, with an IC50 of 132.8 nM. PD-1/PD-L1-IN 6 exhibits outstanding immunoregulatory activity. PD-1/PD-L1-IN 6 significantly elevates interferon-γ secretion in a Hep3B/OS-8/hPD-L1 and CD3 T cell co-culture model, without significant toxic effect. PD-1/PD-L1-IN 6 restores the immune response in a T cell-tumor co-culture model.
  • HY-154369
    1,4-Anhydro-2,3-O-isopropylidene-5-O-t-butyldiphenylsilyl-4-thio-D-ribitol

    		Nucleoside Antimetabolite/Analog Cancer
    1,4-Anhydro-2,3-O-isopropylidene-5-O-t-butyldiphenylsilyl-4-thio-D-ribitol is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc.
  • HY-147008
    XP-524

    		Epigenetic Reader Domain Cancer
    XP-524 is a potent BET and EP300 inhibitor. XP-524 shows great tumoricidal activity in vivo. XP-524 prevents KRAS-induced, neoplastic transformation in vivo and extends survival in two transgenic mouse models of aggressive PDAC. XP-524 also enhances the presentation of self-peptide and tumor recruitment of cytotoxic T lymphocytes. XP-524 has the potential for the research of pancreatic ductal adenocarcinoma (PDAC).
  • HY-143869
    HPK1-IN-28

    		MAP4K Cancer
    HPK1-IN-28 is a potent inhibitor of HPK1. Hematopoietic progenitor kinase 1 (HPK1) is a negative regulator of the activation response of dendritic cells (DCs), T cells and B cells. HPK1-IN-28 enhances the body's anti-tumor immunity. HPK1-IN-28 has the potential for the research of immune-related diseases, especially tumor (extracted from patent WO2021175270A1, compound 1).
  • HY-143870
    HPK1-IN-29

    		MAP4K Cancer
    HPK1-IN-29 is a potent inhibitor of HPK1. Hematopoietic progenitor kinase 1 (HPK1) is a negative regulator of the activation response of dendritic cells (DCs), T cells and B cells. HPK1-IN-29 enhances the body's anti-tumor immunity. HPK1-IN-29 has the potential for the research of immune-related diseases, especially tumor (extracted from patent WO2021175270A1, compound 38).
  • HY-115463
    EB-3D

    		AMPK Apoptosis Cancer
    EB-3D is a potent and selective choline kinase α (ChoKα) inhibitor, with an IC50 of 1 μM for ChoKα1. EB-3D exerts effects on ChoKα expression, AMPK activation, apoptosis, endoplasmic reticulum stress and lipid metabolism. EB-3D exhibits a potent antiproliferative activity in a panel of T-leukemia cell lines. Anti-cancer activity.
  • HY-41793
    3'-O-(t-Butyldimethylsilyl)-2'-deoxy-2'-fluorouridine

    2'-Deoxy-3'-O-[(1,1-dimethylethyl)dimethylsilyl]-2'-fluorouridine

    		 Nucleoside Antimetabolite/Analog Cancer
    3'-O-(t-Butyldimethylsilyl)-2'-deoxy-2'-fluorouridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc.
  • HY-B0078A
    Dacarbazine citrate

    Imidazole Carboxamide citrate

    		 Apoptosis Antibiotic Cancer
    Dacarbazine citrate is a cell cycle nonspecific antineoplastic alkylating agent. Dacarbazine citrate inhibits T and B lymphoblastic response, with IC50 values of 50 and 10 μg/mL, respectively. Dacarbazine Citrate can be used for the research of apoptosis and various cancers such as metastatic malignant melanoma.
  • HY-11011
    A-770041

    		Src Inflammation/Immunology
    A-770041 is a selective and orally active Src-family Lck inhibitor. A-770041 inhibits Lck with an IC50 value of 147 nM with the presence of 1 mM ATP. A-770041 shows 300-fold selective to Lck over Fyn, the other Src family kinase involved in T-cell signaling. A-770041 can be used for the research of acute rejection.
  • HY-150213
    ODN BW001

    		CDK Inflammation/Immunology
    ODN BW001 is an oligodeoxynucleotide (ODN). ODN BW001 plays a regulatory role in the proliferation and activation of osteoblast.
  • HY-150725
    ODN 1585

    		IFNAR TNF Receptor Cancer Infection Inflammation/Immunology
    ODN 1585 is a potent inducer of IFN and TNFα production. ODN 1585 is a potent stimulator of NK (natural killer) function. ODN 1585 increases CD8+ T-cell function, including the CD8+ T cell-mediated production of IFN-γ. ODN 1585 induces regression of established melanomas in mice. ODN 1585 can confer complete protection against malaria in mice. ODN 1585 can be used for acute myelogenous leukemia (AML) and malaria research. ODN 1585 can be used as a vaccine adjuvant.
  • HY-143305
    PD-1/PD-L1-IN-25

    		PD-1/PD-L1 Cancer
    PD-1/PD-L1-IN-25 (compound D2) is an inhibitor of PD-1/PD-L1 interaction with an IC50 value of 16.17 nM. PD-1/PD-L1-IN-25 activates the antitumor immunity of T cells efficiently in PBMCs. PD-1/PD-L1-IN-25 can be used for the research of cancer.
  • HY-151464
    SHP2/HDAC-IN-1

    		SHP2 Phosphatase HDAC Cancer Inflammation/Immunology
    SHP2/HDAC-IN-1 is a dual allosteric SHP2/HDAC inhibitor with IC50 values of 20.4 nM (SHP2) and 25.3 nM (HDAC1) respectively. SHP2/HDAC-IN-1 triggers efficient antitumor immunity by activating T cells, enhancing the antigen presentation function and promoting cytokine secretion. SHP2/HDAC-IN-1 can be used in the research of cancer immunoresearch.
  • HY-N10295
    Flavipin

    		Aryl Hydrocarbon Receptor Inflammation/Immunology
    Flavipin is an aryl hydrocarbon receptor (Ahr) agonist that induces the expression of Ahr downstream genes in mouse CD4 + T cells and CD11b + macrophages. Flavipin inhibits the stabilizing function of Arid5a on Il23a 3′UTR, a newly identified target mRNA. Flavipin exhibits the DPPH free radical scavenging ability with IC50 value of 7.2 μM, and has potent α-glucosidase inhibition with IC50 value of 33.8 μM.
  • HY-150736
    ODN 20844

    		Toll-like Receptor (TLR) Infection Inflammation/Immunology
    ODN 20844, a guanine-modified inhibitory oligonucleotide (INH-ODN), is a TLR7 and TLR9 (Toll-like receptor) inhibitor, and its parent is INH-ODN 2088. ODN 20844 disrupts TLR7- and TLR9-mediated immune cell immune responses. ODN 20844 sequence: 5'-TCCTGGCGc7GGGAAGT-3'.
  • HY-150215
    ODN 105870

    		Toll-like Receptor (TLR) Inflammation/Immunology
    ODN 105870, a G-modified inhibitory oligonucleotide (INH-ODN), is a selective TLR7 inhibitor. ODN 105870 can be uesd for inflammatory immune responses research.
  • HY-150216
    ODN 105871

    		Toll-like Receptor (TLR) Inflammation/Immunology
    ODN 105871, a G-modified inhibitory oligonucleotide (INH-ODN), is a selective TLR7 inhibitor. ODN 105871 can be uesd for inflammatory immune responses research.
  • HY-P99687
    Latikafusp

    AMG 256

    		 PD-1/PD-L1 Cancer
    Latikafusp (AMG 256) is a bifunctional fusion protein comprising a PD-1-targeting antibody and IL-21 mutein designed to deliver IL-21 pathway stimulation to PD-1+ cells. Latikafusp is designed to prime and extend the activity of cytotoxic and memory T cells and induce anti-tumor immunity. Latikafusp has the potential for solid tumors research.
  • HY-108764
    Mipomersen sodium

    ISIS 301012

    		 Others Metabolic Disease
    Mipomersen (sodium) is a second-generation 20-base phosphorothioate ASO targeted to human apoB-100.
  • HY-145728
    Alicaforsen

    ISIS-2302

    		 Integrin Inflammation/Immunology
    Alicaforsen is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
  • HY-147410
    Ulefnersen

    ION-363

    		 Others Neurological Disease
    Ulefnersen is a RNA-binding protein fused-in sarcoma (FUS) synthesis reducer. Ulefnersen can be used in Amyotrophic Lateral Sclerosis (ALS) research.
  • HY-W107464
    G6PDi-1

    		PDI Metabolic Disease Inflammation/Immunology
    G6PDi-1 is a reversible and non-competitive glucose-6-phosphate dehydrogenase (G6PD) inhibitor with an IC50 of 0.07 μM. G6PDi-1 depletes NADPH most strongly in lymphocytes. G6PDi-1 markedly decreases inflammatory cytokine production in T cells.
  • HY-120785
    SR1555

    		ROR Inflammation/Immunology
    SR1555 is a specific retinoic acid receptor-related orphan nuclear receptor γ (RORγ) inverse agonist with an IC50 value of 1 μM. SR1555 not only inhibits TH17 cell development and function but also increases the frequency of T regulatory cells, as well as inhibits the expression of IL-17. SR1555 can be used for researching autoimmune diseases.
  • HY-153220
    NX-2127

    		Btk Cancer
    NX-2127 is an orally and potent BTK inhibitor, inducing degradation of the mutated BTK C481S in cells. NX-2127 inhibits proliferation of BTK C481S mutant TMD8 cells, more effectively than Ibrutinib (HY-10997). NX-2127 catalyzes the degradation of Ikaros (IKZF1) and Aiolos (IKZF3) with of 25 nM and 54 nM, respectively. NX-2127 stimulates T cell activation and increases IL-2 production in primary human T Cells.
  • HY-147252
    Bezeparsen

    		Ser/Thr Protease Metabolic Disease
    Bezeparsen is a PCSK9 synthesis inhibitor.
  • HY-101092
    QS-21

    Stimulon

    		 NOD-like Receptor (NLR) Inflammation/Immunology Cancer
    QS-21, an immunostimulatory saponin, could be used as a potent vaccine adjuvant. QS-21 stimulates Th2 humoral and Th1 cell-mediated immune responses through action on antigen presenting cells (APCs) and T cells. QS-21 can activate the NLRP3 inflammasome with subsequent release of caspase-1 dependent cytokines, IL-1β and IL-18.
  • HY-145239
    PD-1/PD-L1-IN-13

    		PD-1/PD-L1 Cancer
    PD-1/PD-L1-IN-13 (Compound 43) is a potent immune checkpoint PD-1/PD-L1 inhibitor with an IC50 value of 10.2 nM. PD-1/PD-L1-IN-13 promots CD8 + T cell activation and delays the tumor growth in the Hepa1-6 syngeneic mouse model.
  • HY-143230
    Custirsen

    OGX-011

    		 Apoptosis Cancer
    Custirsen is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.
  • HY-113962
    7α,25-Dihydroxycholesterol

    7α,25-OHC

    		 EBI2/GPR183 Endogenous Metabolite Inflammation/Immunology
    7α, 25-dihydroxycholesterol (7α,25-OHC) is a potent and selective agonist and endogenous ligand of the orphan GPCR receptor EBI2 (GPR183). 7α, 25-dihydroxycholesterol is highly potent at activating EBI2 (EC50=140 pM; Kd=450 pM). 7α, 25-dihydroxycholesterol can serve as a chemokine directing migration of B cells, T cells and dendritic cells.
  • HY-144649
    PD-1/PD-L1-IN-24

    		PD-1/PD-L1 Cancer
    PD-1/PD-L1-IN-24 is a highly potent PD-1/PD-L1 inhibitor with IC50 value of 1.57 nM. PD-1/PD-L1-IN-24 can restore T-cell function at the cellular level by significantly elevating the IFN-γ level. PD-1/PD-L1-IN-24 has low toxicity on the PBMCs.
  • HY-131183
    PROTAC PD-1/PD-L1 degrader-1

    		PROTACs PD-1/PD-L1 Inflammation/Immunology
    PROTAC PD-1/PD-L1 degrader-1, a PD-1/PD-L1 PROTAC based on Cereblon E3 ligand, inhibits PD-1/PD-L1 interaction with an IC50 of 39.2 nM. PROTAC PD-1/PD-L1 degrader-1 significantly restores the immunity repressed in a co-culture model of Hep3B/OS-8/hPD-L1 and CD3 T cells. PROTAC PD-1/PD-L1 degrader-1 moderately reduces the protein levels of PD-L1 in a lysosome-dependent manner.
  • HY-N1724
    Concanamycin A

    Antibiotic X 4357B; Folimycin; X 4357B

    		 Proton Pump Bacterial Antibiotic Cancer Infection Inflammation/Immunology
    Concanamycin A (Folimycin; Antibiotic X 4357B) is a macrolide antibiotic, a vacuolar type H +-ATPase (V-ATPase) inhibitor. Concanamycin A is also an inhibitor of lysosomal acidification, can be used to T cell-mediated inflammation research -.
  • HY-150742
    ODN 2336

    		Toll-like Receptor (TLR) Inflammation/Immunology
    ODN 2336 is a A-Class CpG ODN (oligodeoxynucleotides), is a potent TLR9 agonist. ODN 2336 induces the production of IFN-α. ODN 2336 up-regulates the expression of IP-10 mRNA and IL-18 mRNA. ODN 2336 can be used as adjuvant of vaccines.
  • HY-148511
    Vidutolimod

    CMP-001

    		 Toll-like Receptor (TLR)
    Vidutolimod (CMP-001) is a CpG-A oligodeoxynucleotide. Vidutolimod is a Toll-like receptor 9 (TLR9) agonist, which activates plasmacytoid dendritic cells (pDCs) and triggers interferon alpha (IFNα) release, leading to a cascade of anti-tumor immune effects.
  • HY-P99252
    Itolizumab

    Anti-Human CD6 Recombinant Antibody

    		 CD6 Infection Inflammation/Immunology
    Itolizumab (Anti-Human CD6 Recombinant Antibody) is a humanized recombinant anti-CD6 monoclonal antibody (MAb) targeting the extracellular SRCR distal domain 1 of CD6. Itolizumab reduces T-cell proliferation and inhibits the production of pro-inflammatory cytokines, such as INF-γ, TNFα and IL-6. Itolizumab can be used in the research of psoriasis, rheumatoid arthritis (RA), COVID-19.
  • HY-148089
    Eplontersen

    		Transthyretin (TTR) Neurological Disease
    Eplontersen is a triantennary N-acetyl galactosamine (GalNAc3-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases.
  • HY-146231
    SS47

    		PROTACs MAP4K Cancer Inflammation/Immunology
    SS47, a PROTAC-based HPK1 degrader, exerts proteasome-mediated HPK1 degradation. The degradation of HPK1 via SS47 also significantly enhances the?in?vivo?antitumor efficacy of BCMA CAR-T cell research. HPK1, an?immunosuppressive?regulatory kinase, is a promising target for cancer immunotherapies.
  • HY-18341A
    L-Thyroxine sodium salt pentahydrate

    Sodium levothyroxine pentahydrate

    		 Thyroid Hormone Receptor Endogenous Metabolite Endocrinology Cancer
    L-Thyroxine sodium salt pentahydrate (Levothyroxine; T4) is a synthetic hormone for the research of hypothyroidism. DIO enzymes convert biologically active thyroid hormone (Triiodothyronine,T3) from L-Thyroxine (T4).
  • HY-121638
    CU-3

    		Apoptosis DGK Cancer Inflammation/Immunology
    CU-3 is the racemate of (5Z,2E)-CU-3. (5Z,2E)-CU-3 is a potent and selective inhibitor against the α-isozyme of DGK with an IC50 value of 0.6 μM, competitively inhibits the affinity of DGKα for ATP with a Km value of 0.48 mM. (5Z,2E)-CU-3 targets the catalytic region, but not the regulatory region of DGKα. (5Z,2E)-CU-3 has antitumoral and proimmunogenic effects, enhances the apoptosis of cancer cells and the activation of T cells.
  • HY-P99904
    Siplizumab

    MEDI-507

    		 CD2 Inflammation/Immunology
    Siplizumab (MEDI-507) is a humanized IgG1 monoclonal antibody against CD2. Siplizumab depletes T cells, decreases T cell activation, inhibites T cell proliferation and enriches naïve and bona fide regulatory T cells.
  • HY-P1698
    Reltecimod

    AB-103

    		 Bacterial CD28 Infection Inflammation/Immunology
    Reltecimod (AB-103) is a T-cell-specific surface glycoprotein CD28 (TP44) antagonist. Reltecimod has beneficial effects against different bacterial infections, their exotoxins and endotoxins, and ionizing radiation. Reltecimod modulates the inflammatory response by targeting and attenuating the critical CD28/B7-2 co-stimulatory pathway, without inhibiting it. Reltecimod can be used to research necrotizing soft-tissue infections (NSTIs).
  • HY-145726
    ISIS 104838

    		TNF Receptor Inflammation/Immunology
    ISIS?104838?is an antisense oligonucleotide agent that reduces the production of tumor necrosis factor (TNF-alpha),?a substance that contributes to joint pain and swelling in rheumatoid arthritis.
  • HY-15815
    Bromosporine

    		Epigenetic Reader Domain Apoptosis CDK HIV Cancer
    Bromosporine is a potent BET inhibitor with an IC50 value of 2.1 μM for PCAF. Bromosporine can arrest cell cycle and induce apoptosis in cancer cells. Bromosporine exhibits excellent antitumor activity in xenograft mice model when combined with 5-FU (HY-90006). Bromosporine can increase CDK9 T-loop phosphorylation in HIV-1 latency models, resulting the protection of reactivate HIV-1 replication from latency. Bromosporine can be used to research colorectal cancer, acute myeloid leukemia (AML) and AIDS.
  • HY-145725A
    Baliforsen

    IONIS 598769; BIIB 065; ISIS-DMPK-2.5Rx

    		 Others Others
    Baliforsen is an antisense oligonucleotide (16 nucleotides) designed to target myotonic dystrophy protein kinase (DMPK) mRNA and research myotonic dystrophy.
  • HY-12607
    ML251

    		Parasite Infection
    ML251, a potent nanomolar T. brucei and T. cruzi phosphofructokinase (PFK) inhibitor, inhibits T. brucei PFK (IC50=0.37 μM) and T. cruzi PFK (IC50=0.13 μM). ML251 can be used for the research of parasite.
  • HY-145725
    Baliforsen sodium

    IONIS 598769 sodium

    		 Others Others
    Baliforsen (sodium) is an antisense oligonucleotide (16 nucleotides) designed to target myotonic dystrophy protein kinase (DMPK) mRNA and research myotonic dystrophy.
  • HY-N4053
    Heraclenin

    		Nuclear Factor of activated T Cells (NFAT) Inflammation/Immunology
    Heraclenin, a natural furanocoumarin, significantly inhibits T cell receptor-mediated proliferation in human primary T cells in a concentration-dependent manner by targeting nuclear factor of activated T-cells (NFAT).
  • HY-18341S2
    L-Thyroxine-13C6

    		Thyroid Hormone Receptor Endogenous Metabolite
    L-Thyroxine- 13C6 is the 13C labeled L-Thyroxine[1]. L-Thyroxine (Levothyroxine;T4) is a synthetic hormone for the research of hypothyroidism. DIO enzymes convert biologically active thyroid hormone (Triiodothyronine,T3) from L-Thyroxine (T4)[2].
  • HY-113903
    (+)-Isopulegol

    		Parasite Infection
    (+)-Isopulegol is a terpenoid found in Mentha canadensis L. (+)-Isopulegol shows phagostimulatory activity towards adults of S. granarius and T. confusum. (+)-Isopulegol is a feeding attractant for adults of T. confusum and T. granarium larvae.
  • HY-N1529
    Gomisin M1

    (±)-Gomisin M1

    		 HIV Infection
    Gomisin M1 ((±)-Gomisin M1) is a potent anti-HIV agent with an EC50 of <0.65 μM.
  • HY-112371
    (S)-CR8

    		CDK Cancer
    (S)-CR8 is the S-isomer of CR8. (S)-CR8 is a potent and selective CDK inhibitor with IC50s of 0.060, 0.080, 0.11, 0.12, and 0.15 μM for CDK2/cyclin E, CDK2/cyclin A, CDK9/cyclin T, CDK5/p25, and CDK1/cyclin B, respectively. (S)-CR8 reduces SH-SY5Y cells survival (IC50 0.40 μM).
  • HY-147267
    Evazarsen

    ISIS-757456

    		 Others Endocrinology
    Evazarsen is an angiotensinogen synthesis inhibitor and possesses antihypertensive properties.
  • HY-112823A
    Almonertinib mesylate

    HS-10296 mesylate

    		 EGFR Cancer
    Almonertinib (HS-10296) mesylate is an orally available, irreversible, third-generation EGFR tyrosine kinase inhibitor with high selectivity for EGFR-sensitizing and T790M resistance mutations. Almonertinib mesylate shows great inhibitory activity against T790M, T790M/L858R and T790M/Del19 (IC50: 0.37, 0.29 and 0.21 nM, respectively), and is less effective against wild type (3.39 nM). Almonertinib mesylate is used for the research of the non-small cell lung cancer.
  • HY-112823
    Almonertinib

    HS-10296

    		 EGFR Cancer
    Almonertinib (HS-10296) is an orally available, irreversible, third-generation EGFR tyrosine kinase inhibitor with high selectivity for EGFR-sensitizing and T790M resistance mutations. Almonertinib shows great inhibitory activity against T790M, T790M/L858R and T790M/Del19 (IC50: 0.37, 0.29 and 0.21 nM, respectively), and is less effective against wild type (3.39 nM). Almonertinib is used for the research of the non-small cell lung cancer.
  • HY-112823B
    Almonertinib hydrochloride

    HS-10296 hydrochloride

    		 EGFR Cancer
    Almonertinib (HS-10296) hydrochloride is an orally available, irreversible, third-generation EGFR tyrosine kinase inhibitor with high selectivity for EGFR-sensitizing and T790M resistance mutations. Almonertinib hydrochloride shows great inhibitory activity against T790M, T790M/L858R and T790M/Del19 (IC50: 0.37, 0.29 and 0.21 nM, respectively), and is less effective against wild type (3.39 nM). Almonertinib hydrochloride is used for the research of the non-small cell lung cancer.
  • HY-P3736
    Myelopeptide-2

    MP-2

    		 Interleukin Related Cancer
    Myelopeptide-2 is a peptide originally isolated from the supernatant of porcine bone marrow cell cultures, can restore mitogenic reactivity of human T lymphocytes inhibited by HL-60 leukemia cells or measles virus conditions. Myelopeptide-2 also recover depressed interleukin-2 (IL-2) synthesis and interleukin-2 receptor (IL-2R) expression. Myelopeptide-2 involves in immunity homeostasis, is perspective to be applied in antitumor and antivirus research.
  • HY-W032013
    1-Octanol

    Octanol

    		 Calcium Channel Endogenous Metabolite Metabolic Disease Neurological Disease
    1-Octanol (Octanol), a saturated fatty alcohol, is a T-type calcium channels (T-channels) inhibitor with an IC50 of 4 μM for native T-currents. 1-Octanol is a highly attractive biofuel with diesel-like properties.
  • HY-124756
    SBI-425

    		Phosphatase Cardiovascular Disease
    SBI-425 is an orally active and potent TNAP (tissue-nonspecific alkaline phosphatase) inhibitor (IC50=16 nM). SBI-425 inhibits TNAP in the vasculature, improving cardiovascular parameters and survival.
  • HY-13701
    Nelarabine

    506U78; GW 506U78; Nelzarabine

    		 Nucleoside Antimetabolite/Analog Apoptosis Cancer
    Nelarabine (506U78) is a nucleoside analogue and can be used for the research of T cell acute lymphoblastic leukemia (T-ALL).
  • HY-113636
    Kazinol A

    		Others Cancer
    Kazinol A induces cytotoxic effects in human bladder cancer cells, including the cisplatin-resistant T24R2.
  • HY-145812
    CRK12-IN-1

    		Parasite Infection
    CRK12-IN-1 is a potent CRK12 inhibitor. CRK12-IN-1 is extremely potent against T.b. brucei and rapidly cytocidal, as well as equally potent against T. congolense and T. vivax (EC50 of 1.3 and 18 nM, respectively).
  • HY-12972
    Mavelertinib

    PF-06747775

    		 EGFR Cancer
    Mavelertinib is a selective, orally available and irreversible EGFR tyrosine kinase inhibitor (EGFR TKI), with IC50s of 5, 4, 12 and 3 nM for Del, L858R, and double mutants T790M/L858R and T790M/Del, respectively. Mavelertinib can be used for the research of non-small-cell lung cancer (NSCLC).
  • HY-N6583
    Licoflavonol

    		Bacterial Infection
    Licoflavonol, a minor flavone from the roots of Glycyrrhiza uralensis, is an inhibitor of the Salmonella type III secretion system (T3SS).
  • HY-145402
    CDK7-IN-7

    		CDK Cancer
    CDK7-IN-7 is a potent and selective CDK7 kinase inhibitor with an IC50 of <50 nM (Patent CN112661745A, compound T-01).
  • HY-136427
    KRM-III

    		Nuclear Factor of activated T Cells (NFAT) Inflammation/Immunology
    KRM-III is a potent and orally active T-cell antigen receptor (TCR) inhibitor. KRM-III inhibits TCR- and phorbol myristate acetate/ionomycin-induced activation of nuclear factor of activated T cells (NFAT) and T-cell proliferation with an IC50 of ~5 μM. Anti-inflammatory activity.
  • HY-110113
    CTA056

    		Btk Cancer
    CTA056 is an ITK (IL-2-inducible T-cell kinase) inhibitor with an IC50 of 0.1 μM. CTA056 selectively targets malignant T cells and modulates oncomirs. CTA056 induces apoptosis and is a potential therapeutic agent for the research of T-cell leukemia and lymphoma.
  • HY-N4010
    Iriflophenone

    		Others Cancer
    Iriflophenone, isolated from Aquilaria sinensis, stimulates MCF-7 and T-47D human breast cancer cells proliferation.
  • HY-146782
    EGFR-IN-49

    		EGFR Cancer
    EGFR-IN-49 is a potent and selective EGFR inhibitor with IC50s of 65.0 nM and 13.6 nM for EGFR T790M and EGFR T790M/L858R, respectively. EGFR-IN-49 induces late apoptosis in a dose-dependent manner.
  • HY-111356
    IIIM-290

    		CDK Cancer
    IIIM-290 is a potent and oral CDK inhibitor with IC50s of 90 and 94 nM for CDK2/A and CDK9/T1.
  • HY-P99383
    Volagidemab

    REMD-477; AMG-477

    		 GCGR Metabolic Disease
    Volagidemab is an antagonistic glucagon receptor (GCGR) monoclonal antibody (mAb). Volagidemab can be used in the research of type 1 diabetes (T1D).
  • HY-144672
    A2A receptor antagonist 2

    		Adenosine Receptor Cancer Inflammation/Immunology
    A2A receptor antagonist 2 (Compound 57) is a potent, highly selective adenosine A2A receptor (A2AR) antagonist with an IC50 of 8.3 nM.
  • HY-P99457
    Balstilimab

    AGEN2034

    		 PD-1/PD-L1 Inflammation/Immunology
    Balstilimab (AGEN2034) is a fully human monoclonal IgG4 antibody against PD-1.
  • HY-142512
    EGFR-IN-24

    		EGFR Cancer
    EGFR-IN-24, a potent EGFR inhibitor, shows inhibition against EGFR(del19/T790M/C797S) and EGFR(L858R/T790M/C797S), respectively.
  • HY-N11038
    Drynachromoside A

    		Others Others
    Drynachromoside A is a chromone glycoside. Drynachromoside A has biochemical effects on the osteoblastic (MC3T3-E1 cells) proliferation activities.
  • HY-N6729
    HT-2 Toxin

    		Others Metabolic Disease
    HT-2 Toxin is an active, deacetylated metabolite of the T-2 toxin. HT-2 toxin inhibits protein synthesis and cell proliferation in plants.
  • HY-113204
    N-Oleoyl glycine

    		Endogenous Metabolite Cannabinoid Receptor Akt Metabolic Disease
    N-Oleoyl glycine is a lipoamino acid, which stimulates adipogenesis associated with activation of CB1 receptor and Akt signaling pathway in 3T3-L1 adipocyte.
  • HY-12420
    JNJ-47117096 hydrochloride

    MELK-T1 hydrochloride

    		 MELK FLT3 Cancer
    JNJ-47117096 hydrochloride is potent and selective MELK inhibitor, with an IC50 of 23 nM, also effectively inhibits Flt3, with an IC50 of 18 nM.
  • HY-145362
    S1P1 agonist 4

    		LPL Receptor Others
    S1P1 agonist 4 has a better profile in both potency (EC50 < 0.05 mg/kg) and predicted human half-life (t1/2 ∼ 5 days).
  • HY-B0172AS
    Isoallolithocholic acid-d2

    3β-Hydroxy-5α-cholanic acid-d2

    		 Isotope-Labeled Compounds Endogenous Metabolite Apoptosis Autophagy Neurological Disease
    Isoallolithocholic acid-d2 is the deuterium labeled Isoallolithocholic acid (HY-B0172A). Isoallolithocholic acid is a T cell regulator and enhances regulatory T cells (Tregs) differentiation[1][2].
  • HY-N6626
    Pyraclostrobin

    		Fungal Bacterial Infection Metabolic Disease
    Pyraclostrobin is a strobilurin fungicide that inhibits mitochondrial complex III of fungal and mammalian cells. Pyraclostrobin induces triglyceride accumulation and triglyceride accumulation in 3T3-L1 cells.
  • HY-15772A
    Osimertinib mesylate

    AZD-9291 mesylate; Mereletinib mesylate

    		 EGFR Cancer
    Osimertinib mesylate (AZD9291 mesylate) is a covalent, orally active, irreversible, and mutant-selective EGFR inhibitor with an apparent IC50 of 12 nM against L858R and 1 nM against L858R/T790M. Osimertinib overcomes T790M-mediated resistance to EGFR inhibitors in lung cancer.
  • HY-P99011
    Cibisatamab

    		CD3 Cancer
    Cibisatamab (CEA-TCB), a T cell bispecific antibody, binds Carcino-Embryonic Antigen (CEA) on cancer cells and CD3 on T cells. Cibisatamab (CEA-TCB) triggers T cell killing of cancer cell lines expressing moderate to high levels of CEA at the cell surface. Cibisatamab (CEA-TCB) can be used for colorectal cancer research.
  • HY-P99798
    Pacanalotamab

    AMG 420; BI-836909

    		 CD3 Cancer
    Pacanalotamab (AMG 420; BI-836909) is a bispecific T-cell engager (BiTE) targeting to BCMA and CD3ɛ. BCMA refers to B cell maturation antigen, as Pacanalotamab redirecting T cells to BCMA expressing cells on the cell surface. Pacanalotamab conducts T-cell redirected lysis of human multiple myeloma (MM) cell lines.
  • HY-142519
    EGFR-IN-27

    		EGFR Cancer
    EGFR-IN-27 is a potent EGFR inhibitor with IC50s of <50 nM for EGFR Del, L858R, Del/T790M, L858R/T790M, Del/T790M/C797S, and L858R/T790M/C797S, respectively (WO2021249324A1, compound 511).
  • HY-139920
    Oritinib

    SH-1028

    		 EGFR Cancer
    Oritinib (SH-1028), an irreversible third-generation EGFR TKI, overcomes T790M-mediated resistance in non-small cell lung cancer. Oritinib (SH-1028), a mutant-selective inhibitor of EGFR kinase activity, inhibits EGFR WT, EGFR L858R, EGFR L861Q, EGFR L858R/T790M, EGFR d746-750 and EGFR d746-750/T790M kinases, with IC50s of 18, 0.7, 4, 0.1, 1.4 and 0.89 nM, respectively.
  • HY-115869
    RMC-4529

    		mTOR Cancer
    RMC-4529 has an IC50 value of 1.0 nM against p-4E-BP1-(T37/46) in mTOR kinase cellular assay.
  • HY-151121
    Anticancer agent 80

    		Others Cancer
    Anticancer agent 80 (Compound 3c) is an anticancer agent. Anticancer agent 80 exhibits the dark cytotoxicity against T47-D with IC50 of 10.14 µM.
  • HY-12461
    WS6

    		Others Inflammation/Immunology
    WS6 is a novel small molecule that promotes β cell proliferation in rodent and human primary islets with EC50 of 0.28 uM(R7T1 cell viability).
  • HY-141582
    Ceramide 3

    N-Stearoyl phytosphingosine

    		 Biochemical Assay Reagents Others
    C18 Phytoceramide (t18:0/18:0) (Cer(t18:0/18:0)) is a bioactive sphingolipid found in the stratum corneum of Saccharomyces cerevisiae, wheat grain, and mammalian epidermis. Cer(t18:0/18:0) consists of a phytosphingosine backbone amine linked to a C18 fatty acid chain. Cer(t18:0/18:0) has the function of regulating apoptosis, cell differentiation, proliferation of smooth muscle cells and inhibition of mitochondrial respiratory chain. It also suppresses the expression of allergic cytokines IL-4, TNF-α, and transcription factors c-Jun and NF-κB in histone-stimulated mouse skin tissue. Formulations containing cer(t18:0/18:0) have been used as skin protectants in cosmetics as they reduce water loss and prevent epidermal dehydration and irritation.
  • HY-W032013S
    1-Octanol-d17

    Octanol-d17

    		 Calcium Channel Endogenous Metabolite
    1-Octanol-d17 is the deuterium labeled 1-Octanol[1]. 1-Octanol (Octanol), a saturated fatty alcohol, is a T-type calcium channels (T-channels) inhibitor with an IC50 of 4 μM for native T-currents[2]. 1-Octanol is a highly attractive biofuel with diesel-like properties[3].
  • HY-W032013S1
    1-Octanol-d2

    Octanol-d2

    		 Calcium Channel Endogenous Metabolite
    1-Octanol-d2 is the deuterium labeled 1-Octanol[1]. 1-Octanol (Octanol), a saturated fatty alcohol, is a T-type calcium channels (T-channels) inhibitor with an IC50 of 4 μM for native T-currents[2]. 1-Octanol is a highly attractive biofuel with diesel-like properties[3].
  • HY-146136
    EGFR-IN-56

    		EGFR Apoptosis Cancer
    EGFR-IN-56 (Compound 13a) is a potent EGFR inhibitor with IC50 values of 541.7 nM and 132.1 nM against EGFR T790M and EGFR T790M/L858R, respectively. EGFR-IN-56 blocks cancer cells in G2/M phase and induce into late apoptosis.
  • HY-79256
    MMAF-OMe

    Monomethyl auristatin F methyl ester

    		 ADC Cytotoxin Cancer
    MMAF-Ome, an antitubulin agent, is also an ADC cytotoxin. MMAF-Ome inhibits several tumor cell lines with IC50s of 0.056 nM, 0.166 nM, 0.183 nM, and 0.449 nM for MDAMB435/5T4, MDAMB361DYT2, MDAMB468, and Raji (5T4 -) cell lines, respectively.
  • HY-15772
    Osimertinib

    AZD-9291; Mereletinib

    		 EGFR Cancer
    Osimertinib (AZD9291) is a covalent, orally active, irreversible, and mutant-selective EGFR inhibitor with an apparent IC50 of 12 nM against L858R and 1 nM against L858R/T790M, respectively. Osimertinib overcomes T790M-mediated resistance to EGFR inhibitors in lung cancer.
  • HY-B0768A
    Lomerizine dihydrochloride

    KB-2796

    		 Calcium Channel Neurological Disease
    Lomerizine dihydrochloride is an antagonist of L- and T-type voltagegated calcium channels.
  • HY-N2373
    Palmaturbine

    		Others Cancer
    Palmaturbine is isolated from T. sinensis.
  • HY-12026
    WZ4002

    		EGFR Cancer
    WZ4002 is a mutant selective EGFR inhibitor with IC50s of 2, 8, 3 and 2 nM for EGFR L858R, EGFR L858R/T790M, EGFR E746_A750 and EGFR E746_A750/T790M, respectively.
  • HY-N2373A
    Palmaturbine hydroxide

    		Others Others
    Palmaturbine hydroxide is isolated from T. sinensis.
  • HY-N0899
    Wilforine

    		Others Cardiovascular Disease
    Wilforine is a sesquiterpene pyridine alkaloid; important bioactive compound in T.
  • HY-19947
    PF-06291874

    Glucagon receptor antagonists-4

    		 GCGR Metabolic Disease
    PF-06291874 is a highly potent, non-peptide and orally active glucagon receptor antagonist. PF-06291874 is under the study for type 2 diabetes mellitus (T2DM).
  • HY-114566
    SPV106

    		Histone Acetyltransferase Metabolic Disease
    SPV106 is histone acetylase (HAT) and GCN5-related N-acetyltransferases (GNAT) activator. SPV106 can be used for the research of type 2 diabetes (T2D).
  • HY-137433
    Befotertinib

    D-0316

    		 EGFR Cancer
    Befotertinib (D-0316) is the third-generation EGFR tyrosine kinase inhibitor. Befotertinib can be used for the research of EGFR T790M-positive non-small cell lung cancer (NSCLC).
  • HY-N4119
    Neoeriocitrin

    		Cholinesterase (ChE) Neurological Disease
    Neoeriocitrin, isolated from Drynaria Rhizome, shows activity on proliferation and osteogenic differentiation in MC3T3-E1. Neoeriocitrin is a potent acetylcholinesterase (AChE) inhibitor.
  • HY-N3026
    Soyasaponin Ab

    		PPAR Metabolic Disease
    Soyasaponin Ab is a soyasaponin that exerts an anti-obesity effect in 3T3-L1 adipocytes through downregulation of peroxisome proliferator-activated receptor γ (PPARγ).
  • HY-N3027
    Soyasaponin Aa

    		PPAR Metabolic Disease
    Soyasaponin Aa is a soyasaponin that exerts an anti-obesity effect in 3T3-L1 adipocytes through downregulation of peroxisome proliferator-activated receptor γ (PPARγ).
  • HY-12001
    WZ-3146

    		EGFR Cancer
    WZ3146 is a mutant selective EGFR inhibitor with IC50s of 2, 2, 5, 14 and 66 nM for EGFR L858R, EGFR L858R/T790M, EGFR E746_A750, EGFR E746_A750/T790M and EGFR, respectively.
  • HY-15772S
    Osimertinib-d6

    AZD-9291-d6; Mereletinib-d6

    		 EGFR Cancer
    Osimertinib-d6 is a deuterium labeled osimertinib. Osimertinib is a covalent, orally active, irreversible, and mutant-selective EGFR inhibitor with an apparent IC50 of 12 nM against L858R and 1 nM against L858R/T790M. Osimertinib overcomes T790M-mediated resistance to EGFR inhibitors in lung cancer[1].
  • HY-103465
    FFN511

    		Monoamine Transporter Others
    FFN511 is a potent fluorescent false neurotransmitters (FFNs) that targets neuronal vesicular monoamine transporter 2 (VMA T2). FFN511 inhibits serotonin binding to VMA T2-containing membranes with an IC50 of 1 µM. FFN511 directly images the dynamics of release during exocytosis, can be used to label dopamine terminals in live cortical-striatalacute slices.
  • HY-145289
    Antitumor agent-37

    		Apoptosis Cancer
    Antitumor agent-37 possesses potent anti-proliferative and anti-metastasis activities. Antitumor agent-37 induces serious DNA damage and further leads to high expression of γ-H2AX and p53. Antitumor agent-37 promotes apoptosis of tumor cells through mitochondrial apoptotic pathway Bcl-2/Bax/caspase3. Antitumor agent-37 significantly improves immune response through restraining the expression of PD-L1 to increase CD3+ and CD8+ T infiltrating cells in tumor tissues.
  • HY-145288
    Antitumor agent-36

    		Apoptosis Cancer
    Antitumor agent-36 possesses potent anti-proliferative and anti-metastasis activities. Antitumor agent-36 induces serious DNA damage and further leads to high expression of γ-H2AX and p53. Antitumor agent-36 promotes apoptosis of tumor cells through mitochondrial apoptotic pathway Bcl-2/Bax/caspase3. Antitumor agent-36 significantly improves immune response through restraining the expression of PD-L1 to increase CD3+ and CD8+ T infiltrating cells in tumor tissues.
  • HY-145722A
    Apatorsen

    OGX-427

    		 HSP Cancer
    Apatorsen is an antisense oligonucleotide designed to bind to Hsp27 mRNA, resulting in the inhibition of the production of Hsp27 protein.
  • HY-152144
    EGFR-IN-75

    		EGFR Cancer
    EGFR-IN-75 is an EGFR WT and EGFR T790M inhibitor with IC50 values of 0.28 μM and 5.02 μM, respectively. EGFR-IN-75 shows anticancer and antioxidant activity.
  • HY-P2455
    LLO (91-99)

    Listeriolysin O (91-99)

    		 Bacterial Inflammation/Immunology
    LLO (91-99) (Listeriolysin O (91-99)), an exotoxin, is a class I MHC-restricted T-cell epitopes of listeriolysin (LLO). LLO (91-99) is an essential antigen for induction of T-cell mediated immunity in vivo.
  • HY-N4253
    Kudinoside D

    		Others Metabolic Disease
    Kudinoside D is a main natural component of triterpenoid saponin derived from Ilex kudingcha. Kudinoside D suppresses adipogenesis through modulation of the AMPK pathway in 3T3-L1 adipocytes.
  • HY-114191B
    SSTR5 antagonist 2 hydrochloride

    		Somatostatin Receptor Endocrinology Metabolic Disease
    SSTR5 antagonist 2 hydrochloride is a highly potent, oral active and selective somatostatin (receptor) subtype 5 (SSTR5) antagonist and has potential for the research of type 2 diabetes mellitus (T2DM).
  • HY-139091
    FEMA 4774

    		Others Others
    FEMA 4774 is a positive allosteric modulator of taste receptors T1R2 and T1R3, two subunits of the human sweet taste receptor. FEMA 4774 is also used as a sucrose sweetness enhancer.
  • HY-P9901
    Ipilimumab

    MDX-010; BMS-734016

    		 CTLA-4 Cancer
    Ipilimumab is a fully human monoclonal antibody IgG1κ that blocks the inhibitory receptor cytotoxic T lymphocyte antigen 4 (CTLA-4) on T cells. Ipilimumab can be used in unresectable or metastatic melanoma (MM) studies.
  • HY-153456
    Hedgehog IN-2

    		Hedgehog Cancer
    Hedgehog IN-2 (Compound 20) is an inhibitor of Hedgehog pathway with an IC50 value less than 0.003 μM in C3H10T1/2 cells.
  • HY-15553A
    Mibefradil dihydrochloride

    Ro 40-5967 dihydrochloride

    		 Calcium Channel Cardiovascular Disease
    Mibefradil dihydrochloride (Ro 40-5967 dihydrochloride) is a calcium channel blocker with moderate selectivity for T-type Ca 2+ channels (IC50s of 2.7 μM and 18.6 μM for T-type and L-type currents, respectively).
  • HY-149164
    BTB09089

    		Others Inflammation/Immunology Neurological Disease
    BTB09089 is a T cell death-associated gene 8 (TDAG8/GPR65) specific agonist. BTB09089 increases TDAG8 expression and regulates the cytokine production of T cells and macrophages.
  • HY-P99199
    Foralumab

    NI-0401

    		 CD3 Inflammation/Immunology
    Foralumab (NI-0401) is a potent, orally active humanized monoclonal antibody targeting the CD3. Foralumab modulates immune responses by human cells in NSG mice that were reconstituted with human hematopoietic stem cells.
  • HY-147217
    Bepirovirsen

    ISIS 505358

    		 HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
  • HY-P99945
    Revdofilimab

    ABBV-368

    		 Orexin Receptor (OX Receptor) Cancer Inflammation/Immunology
    Revdofilimab (ABBV-368) is a human IgG1 agonist monoclonal antibody against OX40. Among them, OX40 is a member of the TNF receptor superfamily expressed on activated and memory T cell subsets and T regulatory cells.
  • HY-153113
    Rongliflozin

    DJT1116PG

    		 SGLT Endocrinology
    Rongliflozin (DJT1116PG) is a selective and orally active inhibitor of sodium-glucose co-transporter-2 (SGLT-2). Rongliflozin can be used for the research of type 2 diabetes mellitus (T2DM).
  • HY-15553
    Mibefradil

    Ro 40-5967

    		 Calcium Channel Cardiovascular Disease
    Mibefradil (Ro 40-5967) is a calcium channel blocker with moderate selectivity for T-type Ca 2+ channels displaying IC50s of 2.7 μM and 18.6 μM for T-type and L-type currents, respectively.
  • HY-145498
    HDMAPP triammonium

    		TNF Receptor Inflammation/Immunology
    HDMAPP triammonium is a potent phosphoantigen in the ammonium form and the pyrophosphate form of (E)-HDMAPP. HDMAPP is also a potent activator of γδ T cells and can induce T cell stimulation in vitro (EC50=0.39 nM, TNF-α).
  • HY-141891
    M435-1279

    		E1/E2/E3 Enzyme Cancer
    M435-1279 is a UBE2T inhibitor. M435-1279 inhibits the Wnt/β-catenin signaling pathway hyperactivation through blocking UBE2T-mediated degradation of RACK1.
  • HY-144073
    HPK1-IN-21

    		MAP4K Cancer
    HPK1-IN-21 is a potent inhibitor of HPK1 kinase inhibitor (Ki=0.8 nM). HPK1-IN-21 also has orally active.
  • HY-P3741
    [Ala9,10, Lys11,12] Glycogen Synthase (1-12)

    		PKC Neurological Disease
    [Ala9,10, Lys11,12] Glycogen Synthase (1-12) is a selective substrate for phosphorylation by protein kinase C (PKC). [Ala9,10, Lys11,12] Glycogen Synthase (1-12) can be used to determine the activity of protein kinase C.
  • HY-108813
    Belatacept

    BMS 224818; LEA 29Y

    		 Others Inflammation/Immunology
    Belatacept (BMS 224818) is a selective T-cell costimulation blocker. Belatacept binds to CD 80/86 ligands and thereby inhibits the CD-28-mediated T-cell costimulation. Belatacept can be used in the research of Immunosuppression in organ transplants.
  • HY-146693
    CJJ300

    		TGF-β Receptor Cancer
    CJJ300 is a transforming growth factor-β (TGF-β) inhibitor with an IC50 of 5.3 µM. CJJ300 inhibits TGF-β signaling by disrupting the formation of the TGF-β-TβR-I-TβR-II signaling complex.
  • HY-114191
    SSTR5 antagonist 2

    		Somatostatin Receptor Metabolic Disease Endocrinology
    SSTR5 antagonist 2 (compound 10) is a highly potent, oral active and selective somatostatin (receptor) subtype 5 (SSTR5) antagonist and has potential for the research of treat type 2 diabetes mellitus (T2DM).
  • HY-114191A
    SSTR5 antagonist 2 TFA

    		Somatostatin Receptor Metabolic Disease Endocrinology
    SSTR5 Antagonist 1 (compound 10) is a highly potent, oral active and selective somatostatin (receptor) subtype 5 (SSTR5) antagonist and has potential for the research of treat type 2 diabetes mellitus (T2DM).
  • HY-151120
    Anticancer agent 79

    		Others Cancer
    Anticancer agent 79 (compound 3d) shows good anti-breast cancer activity. Anticancer agent 79 shows good cytotoxic activity in T47-D cells, with an IC50 of 13.64 ± 0.26 μM.
  • HY-120597
    SAK3

    		Calcium Channel Neurological Disease
    SAK3 is a potent T-type voltage-gated Ca 2+ channels (T-VGCCs) enhancer. SAK3 enhances Cav3.1 and Cav3.3 T-type Ca 2+ channel currents. Acute SAK3 administration improves memory deficits in olfactory-bulbectomized mice. SAK3 inhibits amyloid β plaque formation in APP-KI mice by activating the proteasome activity.
  • HY-P99623
    Flotetuzumab

    MGD006; S80880

    		 CD3 Cancer
    Flotetuzumab (MGD006; S80880) is an investigational CD123/CD3 bispecific dual-affinity retargeting antibody (DART) molecule. Flotetuzumab reactivates T cells by simultaneously binding to CD123 in target cells and CD3 in effector T cells, leading to T-cell-mediated cytotoxicity in target cells. Flotetuzumab shows inhibitory effect on a mouse model of patient-derived xenograft (PDX) in acute myeloid leukemia (AML).
  • HY-125881
    ASP1126

    		LPL Receptor Inflammation/Immunology
    ASP1126 is a selective and orally active sphingosine-1-phosphate (S1P) agonist, with EC50 values of 7.12 nM, 517 nM for hS1P1 and hS1P3, respectively. ASP1126 decreases the number of peripheral lymphocytes, naive T cells, central memory T cells and effector memory T cells in the peripheral blood. ASP1126 has the potential to be applied in clinical transplantation with improved safety profile.
  • HY-101261
    ATPA

    		iGluR Neurological Disease
    ATPA is a selective glutamate receptor GluR5 activator with EC50s of 0.66, 9.5, 1.4, 23, 32, 18, and 14 μM for GluR5wt, GluR5(S741M), GluR5(S721T), GluR5(S721T, S741M), GluR5(S741A), GluR5(S741L), and GluR5(S741V), respectively.
  • HY-143445
    EGFR-IN-48

    		EGFR Cancer
    EGFR-IN-48 is a potent and orally active EGFR inhibitor with IC50s of 0.193 nM, 0.251 nM, 10.4 nM for EGFR d19/TM/CS, EGFR LR/TM/CS, EGFR WT, respectively. EGFR-IN-48 inhibits the proliferation of BaF3 EGFR del19/T790M/C797S and PC-9 EGFR del19/T790M/C797S cells with IC50s of 1.526, 66.7 nM, respectively.
  • HY-15729
    Rociletinib

    CO-1686; AVL-301; CNX-419

    		 EGFR Cancer
    Rociletinib (CO-1686) is an orally delivered kinase inhibitor that specifically targets the mutant forms of EGFR including T790M, and the Ki values for EGFRL858R/T790M and EGFRWT are 21.5 nM and 303.3 nM, respectively.
  • HY-50722
    NNC 55-0396

    NNC 55-0396 dihydrochloride

    		 Calcium Channel Neurological Disease Cardiovascular Disease
    NNC 55-0396 is a highly selective T-type calcium channel blocker with an IC50 value of 6.8 μM for Cav3.1 T-type channels. NNC 55-0396 can be used for the research of neurological disease research.
  • HY-N10583
    Motuporin

    		Others Others
    Motuporin is a cyclic peptide. Motuporin was initially isolated from T. swinhoei.
  • HY-125664
    Lucialdehyde B

    		Antibiotic Cancer
    Lucialdehyde B is a tetracyclic triterpene isolated from the substrates of Ganoderma lucidum with antiviral and cytotoxic activities. Lucialdehyde B has cytotoxic effects against Lewis lung cancer (LLC), T-47D, Sarcoma 180 and Meth-A tumor cell lines.
  • HY-117103
    AMG131

    INT131

    		 PPAR Metabolic Disease
    AMG131 (INT131), a potent and highly selective PPARγ partial agonist, binds to PPARγ and displaces Rosiglitazone with a Ki of ~10 nM. AMG131 can be used for research of type-2 diabetes mellitus (T2DM).
  • HY-125443
    Lucialdehyde A

    		Others Cancer
    Lucialdehydes A is a lanostante-type triterpene aldehydes, isolated from the fruiting bodies of Ganoderma lucidum. Lucialdehydes A shows cytotoxic effects on tumor cells, including Lewis lung carcinoma (LLC), T-47D, Sarcoma 180, and Meth-A tumor cell lines.
  • HY-P1034
    DAPTA

    D-Ala-peptide T-amide; Adaptavir

    		 CCR HIV Infection Endocrinology
    DAPTA is a synthetic peptide, functions as a viral entry inhibitor by targeting selectively CCR5, and shows potent anti-HIV activities.
  • HY-142517
    EGFR-IN-25

    		EGFR Cancer
    EGFR-IN-25 is a potent EGFR inhibitor with IC50s of 9 nM and 60 nM for BaF3 cells (EGFR DEL19/T790M/C797S) and A431 cells (WT), respectively.
  • HY-15164A
    Icotinib

    BPI-2009

    		 EGFR Cancer
    Icotinib (BPI-2009) is a potent and specific EGFR inhibitor with an IC50 of 5 nM; also inhibits mutant EGFR L858R, EGFR L858R/T790M, EGFR T790M and EGFR L861Q.
  • HY-15729A
    Rociletinib hydrobromide

    CO-1686 hydrobromide; AVL-301 hydrobromide; CNX-419 hydrobromide

    		 EGFR Cancer
    Rociletinib hydrobromide (CO-1686 hydrobromide) is an orally delivered kinase inhibitor that specifically targets the mutant forms of EGFR including T790M, and the Ki values for EGFRL858R/T790M and EGFRWT are 21.5 nM and 303.3 nM, respectively.
  • HY-100866B
    F1324 acetate

    		Bcl-2 Family Cancer
    F1324 acetate is a potent, high affinity peptidic inhibitor of B cell lymphoma 6 (BCL6), with an IC50 of 1 nM. F1324 acetate exhibits binding t1/2 value of 441 s and has strong inhibition activity against BCL6 PPI.
  • HY-15164
    Icotinib Hydrochloride

    BPI-2009H

    		 EGFR Cancer
    Icotinib Hydrochloride (BPI-2009) is a potent and specific EGFR inhibitor with an IC50 of 5 nM; also inhibits mutant EGFR L858R, EGFR L858R/T790M, EGFR T790M and EGFR L861Q.
  • HY-100866
    F1324

    		Bcl-2 Family Cancer
    F1324 is a potent, high affinity peptidic inhibitor of B cell lymphoma 6 (BCL6) with an IC50 of 1 nM. F1324 exhibits binding t1/2 value of 441 s and has strong inhibition activity against BCL6 PPI.
  • HY-122959
    Kihadanin B

    		Akt PPAR Metabolic Disease
    Kihadanin B is a citrus limonoid that can be purified from the peels of immature Citrus unshiu. Kihadanin B suppresses adipogenesis through repression of the Akt-FOXO1-PPARγ axis in 3T3-L1 adipocytes.
  • HY-P99350
    Gresonitamab

    AMG 910; Anti-Human CD3xClaudin18 2

    		 CD3 Cancer
    Gresonitamab (AMG 910) is a half-life extended (HLE) bispecific T-cell engager (BiTE) antibody targets CD3-positive T cells and CLDN18.2-expressing tumor cells. Gresonitamab can be used for the research of adenocarcinoma.
  • HY-N3037
    3-O-Acetyl-α-boswellic acid

    α-Boswellic acid acetate

    		 Others Inflammation/Immunology
    3-O-Acetyl-α-boswellic acid suppresses T cell function.
  • HY-W040329
    2'-Deoxyadenosine

    		Endogenous Metabolite Others
    2'-Deoxyadenosine is a nucleoside adenosine derivative, pairing with deoxythymidine (T) in double-stranded DNA.
  • HY-144266
    Glucosylceramide synthase-IN-1

    		Glucosylceramide Synthase (GCS) Metabolic Disease Neurological Disease
    Glucosylceramide synthase-IN-1 (T-036) a potent, brain-penetrant and orally active glucosylceramide synthase (GCS) inhibitor with IC50s of 31 nM and 51 nM for human GCS and mouse GCS, respectively. Glucosylceramide synthase-IN-1 can be used for Gaucher's disease research.
  • HY-12066
    GSK1292263

    		GPR119 Metabolic Disease Inflammation/Immunology
    GSK-1292263 is an orally available GPR119 agonist with pEC50s of 6.9 and 6.7 for human and rat GPR119, respectively. GSK-1292263 can be used for the research of type 2 diabetes mellitus (T2DM).
  • HY-130254
    Src Inhibitor 3

    		Src Cancer Inflammation/Immunology
    Src Inhibitor 3 is a potent, orally active c-terminal Src kinase (CSK) with IC50 values below 3 nM and 4 nM in CSK HTRF and Caliper assay, respectively. Src Inhibitor 3 shows the ability to increase T cell proliferation induced by T cell receptor signaling.
  • HY-19985
    PF-06459988

    		EGFR Cancer
    PF-06459988 is an orally activity, irreversible and mutant-selective inhibitor of EGFR mutant forms. PF-06459988 demonstrates high potency and specificity to the T790M-containing double mutant EGFRs. PF-06459988 can be used for the research of cancer.
  • HY-100866A
    F1324 TFA

    		Bcl-2 Family Cancer
    F1324 TFA is a potent, high affinity peptidic inhibitor of B cell lymphoma 6 (BCL6), with an IC50 of 1 nM. F1324 TFA exhibits binding t1/2 value of 441 s and has strong inhibition activity against BCL6 PPI.
  • HY-142680
    EGFR-IN-23

    		EGFR Cancer
    EGFR-IN-23 is a potent EGFR TKI (tyrosine kinase inhibitor) with an IC50 of 8.05 nM for BaF3/EGFR-DEL19/T790M/C797S cell (WO2021244502A1, compound 8).
  • HY-151506
    Phospholipid PL1

    		Liposome Cancer
    Phospholipid PL1 is a phospholipid-derived nanoparticle, can deliver costimulatory receptor mRNA (CD137 or OX40) to T cells. Phospholipid PL1 could induce the activation of various immune cells, including T cells and dendritic cells (DCs) in order to boost antitumor immunity.
  • HY-144340
    Antitumor agent-43

    		DNA/RNA Synthesis Apoptosis Cancer
    Antitumor agent-43 (Compound 4B) is a potent antitumor agent, with an IC50of 0.5 µM for (T-24 cell). Antitumor agent-43 (Compound 4B) induces cell cycle arrest at G2/M phase.
  • HY-128781
    Glucagon receptor antagonists-5

    		GCGR Metabolic Disease
    Glucagon receptor antagonists-5 (compound 13K) is a potent and orally bioavailable indazole-based glucagon receptor antagonist (Ki=32 nM). Glucagon receptor antagonists-5 has potential for the treatment of type 2 diabetes mellitus (T2DM).
  • HY-136522
    S2116

    		Histone Demethylase Apoptosis Cancer
    S2116, a N-alkylated tranylcypromine (TCP) derivative, is a potent lysine-specific demethylase 1 (LSD1) inhibitor. S2116 increases H3K9 methylation and reciprocal H3K27 deacetylation at super-enhancer regions. S2116 induces apoptosis in TCP-resistant T-cell acute lymphoblastic leukemia (T-ALL) cells by repressing transcription of the NOTCH3 and TAL1 genes. S2116 significantly retardes the growth of T-ALL cells in xenotransplanted mice.
  • HY-N7969
    Odoriflavene

    		Others Others
    Odoriflavene is a phenolic compound found in the root heartwood of Dalbergia odorifera T. Chen (Leguminosae).
  • HY-12502B
    Efonidipine hydrochloride

    NZ-105 hydrochloride

    		 Calcium Channel Cardiovascular Disease
    Efonidipine Hcl (NZ-105) is a dual T-type and L-type calcium channel blocker (CCB).
  • HY-12502
    Efonidipine

    NZ-105; (±)-Efonidipine

    		 Calcium Channel Cardiovascular Disease
    Efonidipine(NZ-105) is a dual T-type and L-type calcium channel blocker (CCB).
  • HY-101096
    Suvecaltamide

    MK-8998

    		 Calcium Channel Neurological Disease
    Suvecaltamide (MK-8998; compound 33) is a potent and selective inhibitor of the T-type calcium channel.
  • HY-16027
    Acyline

    		GnRH Receptor Endocrinology
    Acyline, a GnRH peptide analogue, is a GnRH antagonist that inhibits gonadotropin and testosterone (T) levels.
  • HY-19721
    ABT-639

    		Calcium Channel Neurological Disease
    ABT-639 is a novel, peripherally acting, selective T-type Ca 2+ channel blocker.
  • HY-101616
    ABT-639 hydrochloride

    		Calcium Channel Neurological Disease
    ABT-639 hydrochloride is a novel, peripherally acting, selective T-type Ca 2+ channel blocker.
  • HY-150543
    Steroid sulfatase-IN-3

    		Others Cancer
    Steroid sulfatase-IN-3 (compound 1q) is a potent STS (Steroid sulfatase) inhibitor, with an IC50 of 25.8 nM. Steroid sulfatase-IN-3 shows antiproliferative activity against T-47D estrogen-dependent breast cancer cells, with an IC50 of 1.04 µM.
  • HY-146049
    Antitrypanosomal agent 4

    		Parasite Infection
    Antitrypanosomal agent 4 (compound 19) is a potent and blood-brain barrier permeable antitrypanosomal agent. Antitrypanosomal agent 4 has good activity against Trypanosoma cruzi (T. cruzi) and Trypanosoma brucei brucei (T. b. brucei) with IC50s of 1.2 μM and 70 nM, respectively.
  • HY-134950
    (E)-C-HDMAPP ammonium

    		TNF Receptor Inflammation/Immunology
    (E)-C-HDMAPP ammonium, is a potent phosphoantigen in ammonium form as well as a pyrophosphonate form of (E)-HDMAPP. (E)-C-HDMAPP is also an effective activator of γδ-T cells, induces T-cell stimulatory responses in vitro (EC50=0.91 nM for TNF-α release).
  • HY-N7690
    3,5,7,3′,4′-Pentamethoxyflavone

    		Others Metabolic Disease
    3,5,7,3′,4′-Pentamethoxyflavone is a polymethoxyflavonoid that can be extracted from Kaempferia parviflora. 3,5,7,3′,4′-Pentamethoxyflavone can induce adipogenesis on 3T3-L1 preadipocytes by regulating transcription factors at an early stage of differentiation.
  • HY-100429
    CAN508

    		CDK Cancer
    CAN508 is a potent, ATP-competitive CDK9/cyclin T1 inhibitor with an IC50 of 0.35 μM. CAN508 exhibits a 38-fold selectivity for CDK9/cyclin T over other CDK/cyclin complexes. Antitumor activity.
  • HY-129769
    CMLD012073

    		Eukaryotic Initiation Factor (eIF) Cancer
    CMLD012073 is an amidino-rocaglates and is a potent eukaryotic initiation factor 4A (eIF4A) inhibitor. CMLD012073 inhibits the growth of NIH/3T3 cells with an IC50 of 10 nM. CMLD012073 inhibits eukaryotic translation initiation by modifying the behavior of the RNA helicase (eIF4A).
  • HY-N1985
    Acetylastragaloside I

    		Parasite Infection
    Acetylastragaloside I is a glycoside that can be isolated from the roots of Astragalus baibutensis. Acetylastragaloside I is the first cycloartane-type triterpene with remarkable trypanocidal activity with IC50 values of 9.5 and 5.0 μg/mL for T. brucei rhodesiense and T. cruzi, respectively. Acetylastragaloside I can be used for the research of trypanosome infection.
  • HY-N10842
    6-Formyllimetin

    		Others Others
    6-Formyllimetin is a natural product isolated from the root bark of T. asiatica LAM.
  • HY-44178
    Diethyl butylmalonate

    		Bacterial Infection
    Diethyl butylmalonate exhibits toxicity to T. pyriformis, with a log(IGC50 -1) of 0.557.
  • HY-16027A
    Acyline TFA

    		GnRH Receptor Endocrinology
    Acyline TFA, a GnRH peptide analogue, is a GnRH antagonist that inhibits gonadotropin and testosterone (T) levels.
  • HY-150684
    GXH-II-052

    		Epigenetic Reader Domain Cancer
    GXH-II-052 is a potent bivalent bromodomain and extraterminal domain (BET) inhibitor. GXH-II-052 shows binding potential for BRD4-1, BRD4-2, BRD4-T, BRDT-1, BRDT-2, BRDT-T with Kd values of 28, 9.1, 4.8, 0.6, 8.4, 2.6 nM, respectively. GXH-II-052 shows antiproliferative activity. GXH-II-052 decreases the expression of c-Myc.
  • HY-125486
    Reversin 121

    		P-glycoprotein Cancer
    Reversin 121 is a P-glycoprotein inhibitor. Reversin 121 increases the ATPase activity of MDR1. Reversin 121 reverses P-glycoprotein-mediated multidrug resistance. Reversin 121 can be used in the research of cancers.
  • HY-P99280
    Bimekizumab

    Anti-Human IL17A/IL-17F Recombinant Antibody

    		 Interleukin Related Inflammation/Immunology
    Bimekizumab (Anti-Human IL17A/IL-17F Recombinant Antibody) is a humanised monoclonal antibody, can selectively neutralises IL-17A and IL-17F. Both of them are pro-osteogenic with respect to human periosteum-derived cell (hPDC) differentiation. Thus Bimekizumab blocks the inflammation-driven osteogenic differentiation.
  • HY-145889
    LC kinetic stabilizer-1

    		Others Others
    LC kinetic stabilizer-1 (compound 21) is a potent and selective amyloidogenic immunoglobulin light chain kinetic stabilizer with EC50s of 140 and 74.1 nM for WIL-FL * and WIL-FL * T46L/F49Y, respectively. WIL-FL is an amyloidogenic FL LC dimer.
  • HY-153008
    BCR-ABL-IN-7

    		Bcr-Abl Cancer
    BCR-ABL-IN-7 (compound 4) is a WT and T315I mutant ABL kinases inhibitor. BCR-ABL-IN-7 effectively inhibits activities of WT and T315I mutant ABL kinases. BCR-ABL-IN-7 can be used for the research of chronic myeloid leukemia (CML) research.
  • HY-110094
    BIMU 8

    		5-HT Receptor Neurological Disease
    BIMU 8 is a potent and selective 5-HT4 agonist with EC50s of 18 nM, 77 nM, and 540 nM for wild type 5HT4 receptor, T3.36A, and W6.48A mutant 5-HT4 receptors.
  • HY-133556
    IQZ23

    		AMPK Metabolic Disease
    IQZ23 inhibits adipocyte differentiation via AMPK pathway activation. IQZ23 exerts a high efficacy in decreasing the triglyceride level (EC50=0.033 μM) in 3T3-L1 adipocytes. IQZ23 could be used for the research of obesity and related metabolic disorders.
  • HY-128947
    CL2 Linker

    		ADC Linker Cancer
    CL2 Linker is a cleavableADC linker. CL2-SN-38 and CL2A-SN-38 are equivalent in agent substitution (~6), cell binding (Kd ~1.2 nM), cytotoxicity (IC50 ~2.2 nM), and serum stability in vitro (t1/2 ~20 hours).
  • HY-10346
    AV-412

    MP412

    		 EGFR Cancer
    AV-412 (MP412) is an EGFR inhibitor with IC50s of 0.75, 0.5, 0.79, 2.3, 19 nM for EGFR, EGFR L858R, EGFR T790M, EGFR L858R/T790M and ErbB2, respectively.
  • HY-107994A
    Aminoxyacetic acid

    Carboxymethoxylamine; Aminooxyacetate

    		 GABA Receptor Cancer
    Aminooxyacetic acid (Carboxymethoxylamine) is a malate-aspartate shuttle (MAS) inhibitor. Aminooxyacetic acid also inhibits the GABA degradating enzyme GABA-T.
  • HY-12502A
    Efonidipine hydrochloride monoethanolate

    NZ-105 hydrochloride monoethanolate

    		 Calcium Channel Cardiovascular Disease
    Efonidipine hydrochloride monoethanolate (NZ-105 hydrochloride monoethanolate) is a dual T-type and L-type calcium channel blocker (CCB).
  • HY-13897
    CNX-2006

    		EGFR Cancer
    CNX-2006 is a mutant-selective and irreversible EGFR inhibitor with an IC50 below 20 nM for EGFR T790M.
  • HY-N3775
    Dodoviscin I

    		Others Metabolic Disease
    Dodoviscin I is an adipogenesis agent that increases triglyceride content in 3T3L1 mouse fibroblasts.
  • HY-150683
    NC-III-49-1

    		Epigenetic Reader Domain Cancer
    NC-III-49-1 is a potent bivalent bromodomain and extraterminal domain (BET) inhibitor. NC-III-49-1 shows binding potential for BRD4-1, BRD4-2, BRD4-T, BRDT-1, BRDT-2, BRDT-T with Kd values of 0.095, 0.32, 0.29, 0.089, 5.5, 0.058 nM, respectively. NC-III-49-1 shows antiproliferative activity. NC-III-49-1 decreases the expression of c-Myc.
  • HY-134903
    (32-Carbonyl)-RMC-5552

    		mTOR Cancer
    (32-Carbonyl)-RMC-5552 is a potent mTOR inhibitor. (32-Carbonyl)-RMC-5552 inhibits mTORC1 and mTORC2 substrate (p-P70S6K-(T389), p-4E-BP1-(T37/36), AND p-AKT1/2/3-(S473)) phosphorylation with pIC50s of > 9, >9 and between 8 and 9, respectively (patent WO2019212990A1, example 2).
  • HY-136523
    S2157

    		Histone Demethylase Apoptosis Cancer
    S2157, a N-alkylated tranylcypromine (TCP) derivative, is a potent lysine-specific demethylase 1 (LSD1) inhibitor. S2157 increases H3K9 methylation and reciprocal H3K27 deacetylation at super-enhancer regions. S2157 induces apoptosis in TCP-resistant T-cell acute lymphoblastic leukemia (T-ALL) cells by repressing transcription of the NOTCH3 and TAL1 genes. S2157 efficiently pass through the blood-brain barrier and can almost completely eradicate CNS leukemia in mice transplanted with T-ALL cells.
  • HY-150610
    EGFR-IN-69

    		EGFR Cancer
    EGFR-IN-69 (compound 17g) is a potent EGFR inhibitor, with IC50 values of 4.3, 6.6 and 25.6 nM against EGFR L858R/T790M/C797S, EGFR L858R/T790M, and EGFR 19del/T790M/C797S, respectively. EGFR-IN-69 can be used for non-small-cell-lung-cancer (NSCLC) research.
  • HY-N6729S2
    HT-2 Toxin-13C22

    		Isotope-Labeled Compounds Metabolic Disease
    HT-2 Toxin- 13C22 is 13C-labeled HT-2 Toxin (HY-N6729). HT-2 Toxin is an active, deacetylated metabolite of the T-2 toxin. HT-2 toxin inhibits protein synthesis and cell proliferation in plants.
  • HY-P99253
    Mogamulizumab

    KW-0761

    		 CCR Cancer Inflammation/Immunology
    Mogamulizumab (KW-0761) is a defucosylated humanized recombinant anti-CCR4 monoclonal antibody (MAb). Mogamulizumab can eliminate tumor cells by antibody-dependent cellular cytotoxicity (ADCC). Mogamulizumab can be used in the research of cancers, adult T-cell leukemia/lymphoma (ATLL), cutaneous T-cell lymphoma (CTCL).
  • HY-16219
    Gadoxetate Disodium

    Gd-EOB-DTPA Disodium; ZK 139834

    		 Biochemical Assay Reagents Cancer
    Gadoxetate Disodium (Gd-EOB-DTPA Disodium) is a contrast agent in magnetic resonance imaging (MRI) of the hepatobiliary system, which accumulates in normal, functioning hepatocytes. Gadoxetate Disodium (Gd-EOB-DTPA Disodium) is used to evaluate focal liver lesions, such as hepatocellular carcinoma or liver metastasis on T1-weighted imaging.
  • HY-146054
    CXCR4 modulator-2

    		CXCR Inflammation/Immunology
    CXCR4 modulator-2 (compound Z7R) is a highly potent CXCR4 modulator with an IC50 value of 1.25 nM. CXCR4 modulator-2 has acceptable stability (t1/2 = 77.1 min) in mouse serum and exhibits anti-inflammatory activity in mouse edema model.
  • HY-13801
    Fexinidazole

    HOE 239

    		 Parasite Infection
    Fexinidazole (HOE 239) is an orally active, potent nitroimidazole antitrypanosomal agent. Fexinidazole shows trypanocidal activity against T. brucei subspecies and strains with IC50s of 0.7-3.3 μM (0.2-0.9 μg/ml). Fexinidazol has the potential for human sleeping sickness (HAT) caused by infection with T. brucei.
  • HY-15103
    AH3960

    		Androgen Receptor Thyroid Hormone Receptor Cancer
    AH3960 (compound 16c) is an antagonist of androgen receptor. AH3960 binds wild as well as T877 mutant type androgen receptors. AH3960 selectively inhibits T877 with an IC50 value of 0.82 μM. AH3960 also serves as an agonist of parathyroid hormone receptor-1 (PTHR1).
  • HY-129492
    GNF4877

    		DYRK GSK-3 Metabolic Disease
    GNF4877 is a potent DYRK1A and GSK3β inhibitor with IC50s of 6 nM and 16 nM, respectively, which leads to blockade of nuclear factor of activated T-cells (NFATc) nuclear export and increased β-cell proliferation (EC50 of 0.66 μM for mouse β (R7T1) cells).
  • HY-100213
    EAI045

    		EGFR Cancer
    EAI045 is an allosteric and the fourth-generation inhibitor of mutant EGFR with IC50s of 1.9, 0.019, 0.19 and 0.002 μM for EGFR, EGFR L858R, EGFR T790M and EGFR L858R/T790M at 10 μM ATP, respectively.
  • HY-150539
    IAB15

    		Calcium Channel Neurological Disease
    IAB15 is a potent T-type calcium channel inhibitor. IAB15 can be used for epilepsy research.
  • HY-107994
    Aminooxyacetic acid hemihydrochloride

    Carboxymethoxylamine hemihydrochloride; Aminooxyacetate hemihydrochloride

    		 GABA Receptor Cancer
    Aminooxyacetic acid (Carboxymethoxylamine) hemihydrochloride is a malate-aspartate shuttle (MAS) inhibitor which also inhibits the GABA degradating enzyme GABA-T.
  • HY-120546
    Ulixacaltamide

    Z944

    		 Calcium Channel Neurological Disease
    Ulixacaltamide (Z944) is an orally active T-type calcium channel antagonist that rescues impairments in crossmodal and visual recognition memory.
  • HY-115756
    4-Maleimidosalicylic acid

    		Others Others
    4-Maleimidosalicylic acid is a polar maleimide, and does not suppress IL-2 production in JURKAT T cells.
  • HY-112125A
    KRN2 bromide

    		Nuclear Factor of activated T Cells (NFAT) Inflammation/Immunology
    KRN2 (bromide) is a selective inhibitor of nuclear factor of activated T cells (NFAT5), with an IC50 of 0.1 μM.
  • HY-115971
    Anti-Trypanosoma cruzi agent-1

    		Parasite Infection Inflammation/Immunology
    Anti-Trypanosoma cruzi agent-1 (Compd E5) posseses anti-T. gondii activity.
  • HY-10346A
    AV-412 free base

    MP-412 free base

    		 EGFR Cancer
    AV-412 free base (MP-412 free base) is an EGFR inhibitor with IC50s of 0.75, 0.5, 0.79, 2.3, 19 nM for EGFR, EGFR L858R, EGFR T790M, EGFR L858R/T790M and ErbB2, respectively.
  • HY-10985
    Marizomib

    Salinosporamide A; NPI-0052

    		 Proteasome Cancer
    Marizomib (Salinosporamide A) is a second-generation, irreversible, brain-penetrant, pan-proteasome inhibitor. Marizomib inhibits the CT-L (β5), CT-T-laspase-like (C-L, β1) and trypsin-like (T-L, β2) activities of the 20S proteasome (IC50=3.5, 28, and 430 nM, respectively).
  • HY-151207
    Anticancer agent 81

    		Apoptosis ADC Cytotoxin Cancer
    Anticancer agent 81 (Compound 37b3) is an anticancer agent and can induce tumor cell cycle arrest and apoptosis. Anticancer agent 81 can be used as a payload to conjugate with Trastuzumab (HY-P9907) to obtain the antibody–agent conjugate (ADC) T-PBA. T-PBA maintained its mode of target and internalization ability of Trastuzumab.
  • HY-P99601
    Cevostamab

    BFCR 4350A; RG 6160; RO 7187797

    		 CD3 Cancer Neurological Disease
    Cevostamab (BFCR4350A; RG6160; RO7187797) is a humanized IgG1-based BsAb that targets membrane-proximal extracellular domain of FcRH5 on multiple myeloma (MM) cells as well as CD3 on T cells. Moreover, Cevostamab facilitates efficient synapse formation, improves killing activity of T cells against MM tumor cells.
  • HY-140156
    Methylamino-PEG4-Boc

    Methylamino-PEG4-t-butyl ester

    		 PROTAC Linkers Cancer
    Methylamino-PEG4-Boc is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140616
    DNP-PEG6-Boc

    DNP-PEG6-t-butyl ester

    		 PROTAC Linkers Cancer
    DNP-PEG6-Boc is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-149824
    EGFR T790M/L858R-IN-2

    		EGFR Apoptosis Cancer
    EGFRT790M/L858R-IN-2 is a potent and selective EGFRT790M/L858R inhibitor with IC50 values of 3.5, 1290 nM for EGFRT790M/L858R, EGFR WT, respectively. EGFRT790M/L858R-IN-2 decreases the expression of p-EGFR, P-AKT, P-ERK1/2. EGFRT790M/L858R-IN-2 induces Apoptosis and cell cycle arrest in the G1 phase. EGFRT790M/L858R-IN-2 shows anti-cancer activity.
  • HY-140154
    Methylamino-PEG1-Boc

    Methylamino-PEG1-t-butyl ester

    		 PROTAC Linkers Cancer
    Methylamino-PEG1-Boc is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140155
    Methylamino-PEG2-Boc

    Methylamino-PEG2-t-butyl ester

    		 PROTAC Linkers Cancer
    Methylamino-PEG2-Boc is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-149916
    A2AR-antagonist-1

    		Adenosine Receptor Cancer
    A2AR-antagonist-1 (compound 38) is an orally active adenosine A2A receptor (A2AR) antagonist (IC50=29 nM). A2AR-antagonist-1 exhibits anti-tumor activity and mouse liver microsomal metabolic stability (t1/2=86.1 min). A2AR-antagonist-1 is also a T cells activator, via inhibiting immunosuppressive molecules (LAG-3 and TIM-3) and enhancing effector molecules (GZMB, IFNG, and IL-2).
  • HY-128860
    Mutated EGFR-IN-2

    		EGFR Cancer
    Mutated EGFR-IN-2 (compound 91) is a mutant-selective EGFR inhibitor extracted from patent WO2017036263A1, which potently inhibits single-mutant EGFR (T790M) and double-mutant EGFR (including L858R/T790M (IC50=＜1nM) and ex19del/T790M), and can suppress activity of single gain-of-function mutant EGFR (including L858R and ex19del) as well. Mutated EGFR-IN-2 shows anti-tumor antivity.
  • HY-111446
    EPAC 5376753

    		Ras Cancer Metabolic Disease Cardiovascular Disease
    EPAC 5376753 is an allosterically inhibitor of Epac which inhibits Epac1 with an IC50 of 4 µM in Swiss 3T3 cells.
  • HY-12083
    PPY-A

    		Bcr-Abl Cancer
    PPY-A is a potent T315I mutant and wild-type Abl kinases inhibitor with IC50s of 9 and 20 nM, respectively. PPY-A inhibits Ba⁄F3 cells transformed with wild-type Abl and Abl T315I mutantl with IC50s of 390 and 180 nM, respectively. PPY-A can be used for the research of chronic myeloid leukemia (CML).
  • HY-111415
    EGFR-IN-5

    		EGFR Cancer
    EGFR-IN-5 is a EGFR inhibitor with IC50s of 10.4, 1.1, 34, 7.2 nM for EGFR, EGFR L858R, EGFR L858R/T790M, and EGFR L858R/T790M/C797S, respectively.
  • HY-130608
    Mutated EGFR-IN-3

    		EGFR Cancer
    Mutated EGFR-IN-3 (compound 3) is a potent, ATP-competitive and highly selective allosteric dibenzodiazepinone inhibitor of the EGFR(L858R/T790M) and EGFR(L858R/T790M/C797S) mutants with IC50 values of 12 nM and 13 nM, respectively.
  • HY-150233
    Cys-McMMAF

    		Microtubule/Tubulin Cancer
    Cys-McMMAF is the released payload of AlMcMMAF, an anti-5T4 humanized A1 antibody conjugated to the microtubule disrupting MMAF (HY-15579) via a maleimidocaproyl linker. Cys-McMMAF has antitumor efficacy in two tumor mouse models (H1975 and MDA-MB-361-DYT2 models).
  • HY-114440
    Belapectin

    GR-MD-02

    		 Galectin Apoptosis Cancer
    Belapectin (GR-MD-02) is a Galectin-3 (Gal-3) inhibitor. Belapectin drives tumor-induced immunosuppression by inducing T cell Apoptosis. Belapectin promotes tumor regression and improves survival of tumor-bearing mice through a CD8+ T cell-dependent mechanism. Belapectin binds to Gal-3 with affinity Ki of 2.8 μM.
  • HY-146472
    EGFR-IN-52

    		EGFR Apoptosis Cancer
    EGFR-IN-52 (Compound 4) is a potent EGFR inhibitor with IC50 values of 0.358, 86.02 and 432.67 µM against EGFR, EGFR L858R-TK and EGFR T790M-TK, respectively. EGFR-IN-52 shows cytotoxic activity against cancer cell lines and induces apoptosis.
  • HY-149920
    Anticancer agent 98

    		Microtubule/Tubulin Cancer
    Anticancer agent 98 (compound 12k) is a microtubule/tubulin-polymerization inhibitor (Kd=16.9 μM). Anticancer agent 98 exerts antiproliferative potency against tumor cells, exhibits anti-angiogenesis effect in vitro. Anticancer agent 98 exhibits good human and mouse liver microsomes stability with both t1/2>300 min.
  • HY-N7661
    4β-Hydroxywithanolide E

    		PPAR Metabolic Disease
    4β-Hydroxywithanolide E, isolated from Physalis peruviana L., inhibits adipocyte differentiation of 3T3-L1 cells through modulation of mitotic clonal expansion. 4β-Hydroxywithanolide E is an adipogenesis inhibitor and inhibits PPARγ, C/EBPα, and the adipocyte-specific molecule aP2 mRNA expression.
  • HY-P99033
    Mosunetuzumab

    BTCT-4465A

    		 CD20 Cancer Inflammation/Immunology
    Mosunetuzumab (BTCT-4465A) is a humanized, immunoglobulin G1-based bispecific antibody targeting CD20 (B cells) and CD3 (T cells). Mosunetuzumab redirects T cells to engage and eliminate malignant B cells and can be used for the research of relapsed or refractory (R/R) B-cell non-Hodgkin lymphomas (B-NHLs).
  • HY-146471
    EGFR-IN-51

    		EGFR Apoptosis Cancer
    EGFR-IN-51 (Compound 6) is a potent EGFR inhibitor with IC50 values of 0.493, 102.60 and 461.63 µM against EGFR, EGFR L858R-TK and EGFR T790M-TK, respectively. EGFR-IN-51 shows cytotoxic activity against cancer cell lines and induces apoptosis.
  • HY-P99679
    Izuralimab

    		PD-1/PD-L1 Cancer Inflammation/Immunology
    Izuralimab is a bispecific IgG1 antibody targeting inducible T-cell costimulator (ICOS/CD278) and PD-1.
  • HY-147311
    NSC622608

    		PD-1/PD-L1 Inflammation/Immunology
    NSC622608 is a V-domain Ig suppressor of T-cell activation (VISTA) ligand with an IC50 value of 4.8 μM.
  • HY-W004282
    Undecanoic acid

    Undecanoate; Hendecanoic acid

    		 Fungal Endogenous Metabolite Infection
    Undecanoic acid (Undecanoate) is a monocarboxylic acid with antimycotic property, which inhibits the production of exocellular keratinase, lipase and the biosynthesis of several phospholipids in T. rubrum.
  • HY-N9737
    (−)-Acutumine

    		Others Neurological Disease
    (−)-Acutumine is a tetracyclic chloroalkaloid that exhibits selective cytotoxicity to cultured human T cells and memory-enhancing properties in the Wistar rat model.
  • HY-113338
    8-Hydroxyguanine

    		Endogenous Metabolite Others
    8-Hydroxyguanine is a major pre-mutagenic lesion generated from reactive oxygen species. It causes G-T and A-C substitutions.
  • HY-123450
    S116836

    		Bcr-Abl Apoptosis PDGFR Cancer
    S116836, a potent, orally active BCR-ABL tyrosine kinase inhibitor, blocks both wild-type as well as T315I Bcr-Abl. S116836 arrests the cells in the G0/G1 phase of cell cycle, induces apoptosis, increases ROS production, and decreases GSH production in BaF3/WT and BaF3/T315I cells. S116836 also inhibits SRC, LYN, HCK, LCK and BLK, and receptor tyrosine kinases such as FLT3, TIE2, KIT, PDGFR-β. Antitumor activies.
  • HY-P99742
    Mitazalimab

    ADC-1013; JNJ-64457107

    		 TNF Receptor Cancer
    Mitazalimab (ADC-1013; JNJ-64457107) is FcγR-dependent CD40 agonist with tumor-directed activity. Mitazalimab activates antigen-presenting cells, e.g. dendritic cells (DC), to initiate tumor-reactive T cells. Therefore, Mitazalimab induces tumor-specific T cells to infiltrate and kill tumors. Mitazalimab remodels the tumor-infiltrating myeloid microenvironment.
  • HY-144676
    pan-HER-IN-1

    		EGFR Apoptosis Cancer
    pan-HER-IN-1 (Compound C5) is an irreversible, orally active pan-HER inhibitor with IC50 values of 0.38, 1.6, 2.2 and 3.5 nM against EGFR, HER4, EGFR T790M/L858R and HER2, respectively. pan-HER-IN-1 induces apoptosis and shows antitumor activities.
  • HY-19713
    LJI308

    		Ribosomal S6 Kinase (RSK) YB-1 Cancer
    LJI308 is a potent pan-ribosomal S6 kinase (RSK) inhibitor, with IC50s of 6 nM, 4 nM, and 13 nM for RSK1, RSK2, and RSK3, respectively. LJI308 inhibits the phosphorylation of RSK (T359/S363) and YB-1 (S102) after irradiation, treatment with EGF, and in cells expressing a KRAS mutation.
  • HY-19834
    Fenebrutinib

    GDC-0853

    		 Btk Cancer
    Fenebrutinib (GDC-0853) is a potent, selective, orally available, and noncovalent bruton's tyrosine kinase (Btk) inhibitor with Kis of 0.91 nM, 1.6, 1.3, 12.6, and 3.4 nM for WT Btk, and the C481S, C481R, T474I, T474M mutants. Fenebrutinib has the potential for rheumatoid arthritis and systemic lupus erythematosus research.
  • HY-151451
    Cav 3.2 inhibitor 2

    		Calcium Channel Neurological Disease
    Cav 3.2 inhibitor 2 is a Cav3.2 T-type Ca 2+ channels inhibitor with an IC50 of 0.09339 μM under -80mV holding potential. Cav 3.2 inhibitor 2 potently suppresses T-channel-dependent somatic and visceral pain in mice. Cav 3.2 inhibitor 2 can be used for the research of intractable pain.
  • HY-144677
    pan-HER-IN-2

    		EGFR Apoptosis Cancer
    pan-HER-IN-2 (Compound C6) is a reversible, orally active pan-HER inhibitor with IC50 values of 0.72, 2.0, 8.2 and 75.1 nM against EGFR, HER4, EGFR T790M/L858R and HER2, respectively. pan-HER-IN-2 induces apoptosis and shows antitumor activities.
  • HY-129767
    CMLD012612

    		Eukaryotic Initiation Factor (eIF) Cancer
    CMLD012612 is an amidino-rocaglate containing a hydroxamate group and is a potent eukaryotic initiation factor 4A (eIF4A) inhibitor. CMLD012612 inhibits cell translation and is cytotoxic to NIH/3T3 cells with an IC50 value of 2 nM. CMLD012612 inhibits eukaryotic translation initiation by modifying the behavior of the RNA helicase (eIF4A) and possesses potent anti-neoplastic activity.
  • HY-P99633
    Garivulimab

    BGB-A333

    		 PD-1/PD-L1 Apoptosis Cancer
    Garivulimab (BGB-A333) is a humanized IgG1-variant monoclonal antibody that specifically targets and binds to PD-L1. Garivulimab selectively blocks the interaction of PD-L1 and PD-1. Garivulimab has antitumor activity.
  • HY-103317
    NAADP

    		Others Inflammation/Immunology
    NAADP, a nucleotide, is a Ca 2+-mobilizing second messenger. NAADP is essential for initiation of Ca 2+ signaling.
  • HY-150203
    GLPG3970

    		Salt-inducible Kinase (SIK) Inflammation/Immunology
    GLPG3970 (compound 88) is a first-in-class SIK2/SIK3 inhibitor. GLPG3970 can be used for the research of inflammation and autoimmune disease.
  • HY-101939
    RP-001

    		LPL Receptor Neurological Disease
    RP-001 is a picomolar short-acting S1P1 (EDG1) selective agonist, with an EC50 of 9 pM. RP-00 induces internalization and polyubiquitination of S1P1. RP-001 has little activity on S1P2-S1P4 and only moderate affinity for S1P5.
  • HY-P0323
    GP(33-41)

    		Arenavirus Infection
    GP(33-41), a 9-aa-long peptide, is the optimal sequence of the GP1 epitope of lymphocytic choriomeningitis virus, and can upregulate H-2D b molecules at the RMA-S (Db Kb) cell surface with a SC50 of 344 nM.
  • HY-138542
    RO0270608

    		Integrin Inflammation/Immunology
    RO0270608, the active metabolite of R411, is a dual alpha4beta1-alpha4beta7 (α4β1/α4β7) integrin antagonist. Antiinflammatory activity.
  • HY-P0323A
    GP(33-41) TFA

    		Arenavirus Infection
    GP(33-41) TFA, a 9-aa-long peptide, is the optimal sequence of the GP1 epitope of lymphocytic choriomeningitis virus. GP(33-41) TFA can upregulate H-2D b molecules at the RMA-S (Db Kb) cell surface with a SC50 of 344 nM.
  • HY-101939A
    RP-001 hydrochloride

    		LPL Receptor Neurological Disease
    RP-001 hydrochloride is a picomolar short-acting S1P1 (EDG1) selective agonist, with an EC50 of 9 pM. RP-00 hydrochloride induces internalization and polyubiquitination of S1P1. RP-001 hydrochloride has little activity on S1P2-S1P4 and only moderate affinity for S1P5.
  • HY-P99908
    Efineptakin alfa

    NT-17

    		 Interleukin Related Cancer
    Efineptakin alfa (NT-17) is a long-acting recombinant human IL-7. Efineptakin alfa supports the proliferation and survival CD4 + and CD8 + cells in both human and mice. Efineptakin alfa can be used for glioblastoma research.
  • HY-13833
    Endochin

    		Parasite Infection
    Endochin is an antimalarial agent. Endochin inhibits T.gondii with an IC50 of 0.003 nM. Endochin is also active against experimental toxoplasmosis.
  • HY-100731
    Cyclosporin

    		Others Inflammation/Immunology
    Cyclosporin is a cyclic decapeptide that could be isolated form the soil fungi Tolypocladium inflatum. Cyclosporin is an immunosuppressant thought to bind to cyclophilin in T-lymphocytes.
  • HY-N4215
    11(α)-Methoxysaikosaponin F

    		Others Inflammation/Immunology
    11(α)-Methoxysaikosaponin F is a triterpenoid saponin isolated from Bupleurum marginatum Wall.ex DC(ZYCH) which is a promising therapeutic for liver fibrosis. 11(α)-Methoxysaikosaponin F has an IC50 of 387.7 nM with viability of hepatic stellate cells-T6 (HSCs-T6). Triterpenoid saponins have numerous targets, important network positions, and strong inhibitory activity.
  • HY-101489A
    GZD856 formic

    		PDGFR Bcr-Abl Apoptosis Cancer
    GZD856 formic is a potent and orally active PDGFRα/β inhibitor, with IC50s of 68.6 and 136.6 nM, respectively. GZD856 formic is also a Bcr-Abl T315I inhibitor, with IC50s of 19.9 and 15.4 nM for native Bcr-Abl and the T315I mutant. GZD856 formic has antitumor activity.
  • HY-101489
    GZD856

    		PDGFR Bcr-Abl Apoptosis Cancer
    GZD856 formic is a potent and orally active PDGFRα/β inhibitor, with IC50s of 68.6 and 136.6 nM, respectively. GZD856 formic is also a Bcr-Abl T315I inhibitor, with IC50s of 19.9 and 15.4 nM for native Bcr-Abl and the T315I mutant. GZD856 formic has antitumor activity.
  • HY-P2231
    Cotadutide

    MEDI0382

    		 GCGR Metabolic Disease
    Cotadutide (MEDI0382) is a potent dual agonist of glucagon-like peptide-1 (GLP-1) and GCGR with EC50 values of 6.9 pM and 10.2 pM, respectively. Cotadutide exhibits ability to facilitate both weight loss and glycaemic control, and alleviate fibrosis. Cotadutide can be used in the research of obesity and type 2 diabetes (T2D).
  • HY-P2231A
    Cotadutide acetate

    MEDI0382 acetate

    		 GCGR Metabolic Disease
    Cotadutide (MEDI0382) acetate is a potent dual agonist of glucagon-like peptide-1 (GLP-1) and GCGR with EC50 values of 6.9 pM and 10.2 pM, respectively. Cotadutide acetate exhibits ability to facilitate both weight loss and glycaemic control, and alleviate fibrosis. Cotadutide acetate can be used in the research of obesity and type 2 diabetes (T2D).
  • HY-14174
    MRK-560

    		γ-secretase Cancer Neurological Disease
    MRK-560 is an orally active, brain barrier-penetrating γ-Secretase inhibitor, can potently reduces Aβ peptide in rat brain and cerebrospinal fluid. MRK-560 also decreases mutant NOTCH1 processing by selectively inhibiting PSEN1. MRK-560 can be used in studies of Alzheimer's disease and T-cell acute lymphoblastic leukaemia (T-ALL).
  • HY-137460
    Vodobatinib

    K0706

    		 Bcr-Abl Cancer
    Vodobatinib (K0706) is a potent, third generation and orally active Bcr-Abl1 tyrosine kinase inhibitor with an IC50 of 7 nM. Vodobatinib exhibits activity against most BCR-ABL1 point mutants, and has no activity against BCR-ABL1T315I. Vodobatinib can be used for chronic myeloid leukemia (CML) research.
  • HY-144267
    Glucosylceramide synthase-IN-2

    		Glucosylceramide Synthase (GCS) Metabolic Disease Neurological Disease
    Glucosylceramide synthase-IN-2 (compound T-690) is a potent, brain-penetrant and orally active glucosylceramide synthase (GCS) inhibitor with IC50s of 15 nM and 190 nM for human GCS and mouse GCS, respectively.Glucosylceramide synthase-IN-2 exhibits noncompetitive type inhibition with C8-ceramide and UDP-glucose.Glucosylceramide synthase-IN-2 can be used for Gaucher's disease research.
  • HY-N7907
    Myricetin-3-O-β-D-xylopyranosyl-(1→2)-β-D-glucopyranoside

    		Others Metabolic Disease
    Myricetin-3-O-β-D-xylopyranosyl-(1→2)-β-D-glucopyranoside is a natural product that can be obtained from sphaerophysa salsula. Myricetin-3-O-β-D-xylopyranosyl-(1→2)-β-D-glucopyranoside inhibits triglyceride (TG) accumulation in 3T3-L1 adipocytes.
  • HY-138072
    EMI1

    		EGFR Cancer
    EMI1 is an EGFR ex19del/T790M/C797S and EGFR L858R/T790M/C797S inhibitor. EMI1 can be used for the research of mutant EGFR-associated, drug-resistant non-small-cell lung cancer (NSCLC).
  • HY-106934
    Peldesine

    BCX 34

    		 Nucleoside Antimetabolite/Analog HIV Cancer Infection Inflammation/Immunology
    Peldesine (BCX 34) is a potent, competitive, reversible and orally active purine nucleoside phosphorylase (PNP) inhibitor with IC50s of 36 nM, 5 nM, and 32 nM for human, rat, and mouse red blood cell (RBC) PNP, respectively. Peldesine is also a T-cell proliferation inhibitor with an IC50 of 800 nM. Peldesine has the potential for cutaneous T-cell lymphoma, psoriasis and HIV infection research.
  • HY-106934A
    Peldesine dihydrochloride

    BCX 34 dihydrochloride

    		 Nucleoside Antimetabolite/Analog HIV Cancer Infection Inflammation/Immunology
    Peldesine (BCX 34) dihydrochloride is a potent, competitive, reversible and orally active purine nucleoside phosphorylase (PNP) inhibitor with IC50s of 36 nM, 5 nM, and 32 nM for human, rat, and mouse red blood cell (RBC) PNP, respectively. Peldesine dihydrochloride is also a T-cell proliferation inhibitor with an IC50 of 800 nM. Peldesine dihydrochloride has the potential for cutaneous T-cell lymphoma, psoriasis and HIV infection research.
  • HY-N7798
    Pennogenin

    		Reactive Oxygen Species Inflammation/Immunology
    Pennogenin is a bioactive component which can be isolated from T. govanianum rhizomes. Pennogenin exhibits significant in vitro inhibitory effect on release of ROS.
  • HY-B1378
    Ethosuximide

    		Calcium Channel Neurological Disease Cancer
    Ethosuximide, a widely prescribed anti-epileptic agent, improves the phenotypes of multiple neurodegenerative disease models and blocks the low voltage activated T-type calcium channel.
  • HY-146087
    Autophagy inducer 4

    		Autophagy Cancer
    Autophagy inducer 4 is a Magnolol-based Mannich base derivatives, which can be used as an anticancer agent. Autophagy inducer 4 suppresses cancer cells via inducing autophagy. Autophagy inducer 4 has 76-fold improvement in cytotoxicity against T47D cells compared with Magnolol. Autophagy inducer 4 also possesses suppressive effects on migration of T47D and Hela cancer cells.
  • HY-19835
    LY2922470

    		Free Fatty Acid Receptor Metabolic Disease
    LY2922470 is a potent, selective and orally available agonist of the G protein-coupled receptor 40 (GPR40), with EC50s of 7 nM, 1 nM and 3 nM for human GPR40, mouse GPR40 and rat GPR40, respectively. LY2922470 reduces glucose levels along with significant increases in insulin and GLP-1, is potential for the treatment of type 2 diabetes mellitus (T2DM).
  • HY-142682
    SCP1-IN-1

    		Others Cancer Neurological Disease
    SCP1-IN-1 (compound SH T-62) is a potent and selective covalent inhibitor against SCP1. SCP1-IN-1 promotes REST degradation and reduces transcriptional activity. A high level of REST protein drives the tumor growth in some glioblastoma cells. SCP1-IN-1 has the potential for the research of glioblastoma whose growth is driven by REST transcription activity.
  • HY-115681
    (2R/S)-6-PNG

    6-Prenylnaringenin; (±)-6-Prenylnaringenin

    		 Calcium Channel Neurological Disease
    (2R/S)-6-PNG (6-Prenylnaringenin) is a potent and reversible Cav3.2 T-type Ca 2+ channels (T-channels) blocker. (2R/S)-6-PNG can penetrate the blood-brain barrier (BBB). (2R/S)-6-PNG suppresses neuropathic and visceral pain in mice.
  • HY-142683
    SCP1-IN-2

    		Others Cancer Neurological Disease
    SCP1-IN-2 (Compound SH T-65) is a potent and selective covalent inhibitor against SCP1. SCP1-IN-2 promotes REST degradation and reduces transcriptional activity. A high level of REST protein drives the tumor growth in some glioblastoma cells. SCP1-IN-2 has the potential for the research of glioblastoma whose growth is driven by REST transcription activity.
  • HY-123636
    UPCDC-30245

    		p97 Cancer
    UPCDC-30245 is an allosteric p97 inhibitor with an IC50 of approximately 27 nM. UPCDC-30245 inhibits the p97 mutant N660K similar to wild type (WT; IC50=300 nM) and shows 3-fold resistance for p97 mutant T688A. UPCDC-30245 can be used in the research of cancer.
  • HY-146594
    NLRP3-IN-8

    		NOD-like Receptor (NLR) Inflammation/Immunology
    NLRP3-IN-8 (compound 27) is an orally active, directly binding NLRP3 inflammasome inhibitor with an IC50 value of 1.23 μM against IL-1 β. NLRP3-IN-8 has good metabolic stability to liver microsomes (t1/2 = 138.63 min), and has almost no toxicity (against L02: IC50 > 100 μM).
  • HY-137478A
    KB-0742 dihydrochloride

    		CDK Cancer
    KB-0742 dihydrochloride is a potent, selective and orally active CDK9 inhibitor with an IC50 of 6 nM for CDK9/cyclin T1. KB-0742 dihydrochloride is selective for CDK9/cyclin T1 with >50-fold selectivity over other CDK kinases. KB-0742 dihydrochloride has potent anti-tumor activity.
  • HY-123418
    PKUMDL-WQ-2201

    		Phosphoglycerate Dehydrogenase (PHGDH) Cancer
    PKUMDL-WQ-2201 is a PHGDH non-NAD+-competing allosteric inhibitor (IC50=35.7 μM). PKUMDL-WQ-2201 also inhibits PHGDH mutants with IC50s of 69 μM (T59A) and >300 μM (T56AK57A), respectively. PKUMDL-WQ-2201 inhibits de novo serine synthesis in cancer cells, and reduces tumor growth.
  • HY-113618A
    RO2959 hydrochloride

    		CRAC Channel Interleukin Related Cardiovascular Disease
    RO2959 hydrochloride is a potent and selective CRAC channel inhibitor with an IC50 of 402 nM. RO2959 hydrochloride is a potent blocker of store operated calcium entry (SOCE) mediated by Orai1/Stim1 channels with an IC50 of 25 nM. RO2959 hydrochloride is also a potent inhibitor of human IL-2 production, and potently blocks T cell receptor triggered gene expression and T cell functional pathways.
  • HY-143400
    HSP70-IN-3

    		HSP Hedgehog Cancer
    HSP70-IN-3 is a potent HSP70 inhibitor (IC50s of 1.1 and 1.9 μM in ASZ001 and C3H10T1/2, respectively). HSP70-IN-3 has anti-Hh (Hedgehog signaling) activity and anti-proliferative activity and reduces expression of the oncogenic transcription factor GLI1.
  • HY-132810
    Bevurogant

    BI 730357

    		 ROR Inflammation/Immunology
    Bevurogant (BI 730357) is a retinoid-related orphan receptor-gamma t (RORγt) antagonist. Bevurogant can be used for the research of chronic inflammatory diseases.
  • HY-150541
    IAA65

    		Calcium Channel Neurological Disease
    IAA65 is a potent T-type calcium channel inhibitor with a IC50 value of 18.9 µM. IAA65 can be used for epilepsy research.
  • HY-P0119A
    Lixisenatide acetate

    		GCGR Metabolic Disease
    Lixisenatide acetate is a glucagon-like peptide-1 (GLP-1) receptor agonist that can be used in the treatment of type 2 diabetes mellitus (T2DM).
  • HY-P0119
    Lixisenatide

    		GCGR Metabolic Disease
    Lixisenatide is a glucagon-like peptide-1 (GLP-1) receptor agonist that can be used in the treatment of type 2 diabetes mellitus (T2DM).
  • HY-111815A
    N4-Acetylcytidine triphosphate sodium

    ac4CTP sodium

    		 Endogenous Metabolite Others
    N4-Acetylcytidine triphosphate sodium is efficiently used as a substrate in T7 Polymerase-catalyzed in vitro transcription and it can be incorporated into multiple templates.
  • HY-111815
    N4-Acetylcytidine triphosphate

    ac4CTP

    		 Endogenous Metabolite Metabolic Disease
    N4-Acetylcytidine triphosphate is efficiently used as a substrate in T7 Polymerase-catalyzed in vitro transcription and can be incorporated into multiple templates.
  • HY-104026B
    L-Kynurenine sulfate

    		Endogenous Metabolite Aryl Hydrocarbon Receptor Inflammation/Immunology
    L-Kynurenine sulfate, an aryl hydrocarbon receptor (AHR) agonist that activates AHR-directed, naive T cell polarization to the anti-inflammatory Treg phenotype.
  • HY-143201
    DS20362725

    		Estrogen Receptor/ERR Metabolic Disease
    DS20362725 is an estrogen-related receptor α (ERRα) agonist. DS20362725 inhibits the binding between receptor-interacting protein 140 (RIP140) corepressor peptide (10 nM) and GST-ERRα ligand-binding domain (LBD; 1.2 μM) with an IC50 value of 0.6 μM. DS20362725 can be used for the research of metabolic disorders, including type 2 diabetes mellitus (T2DM).
  • HY-145446
    SGC-SMARCA-BRDVIII

    		Epigenetic Reader Domain Metabolic Disease
    SGC-SMARCA-BRDVIII is a potent and selective inhibitor of SMARCA2/4 and PB1(5), with Kds of 35 nM, 36 nM, and 13 nM, respectively. SGC-SMARCA-BRDVIII also inhibits PB1(2) and PB1(3), with Kds of 3.7 and 2.0 μM, respectively. SGC-SMARCA-BRDVIII can block adipogenesis of 3T3-L1 murine fibroblasts.
  • HY-132205
    DS45500853

    		Estrogen Receptor/ERR Metabolic Disease
    DS45500853 is an estrogen-related receptor α (ERRα) agonist. DS45500853 inhibits the binding between receptor-interacting protein 140 (RIP140) corepressor peptide (10 nM) and GST-ERRα ligand-binding domain (LBD; 1.2 μM) with an IC50 value of 0.80 μM. DS45500853 can be used for the research of metabolic disorders, including type 2 diabetes mellitus (T2DM).
  • HY-145879
    Nrf2 activator-2

    		Keap1-Nrf2 Cancer
    Nrf2 activator-2 (compound O15), a Osthole derivative, is a potent Nrf2 agonist with an EC50 of 2.9 μM in 293 T cells. Nrf2 activator-2 effectively inhibits the interaction between Keap1 and Nrf2, thus showing the activation effect on Nrf2. Nrf2 activator-2 shows a marked decrease in the level of ubiquitinated Nrf2 in cells.
  • HY-113618B
    RO2959 monohydrochloride

    		CRAC Channel Interleukin Related Cardiovascular Disease
    RO2959 monohydrochloride is a potent and selective CRAC channel inhibitor with an IC50 of 402 nM. RO2959 monohydrochloride is a potent blocker of store operated calcium entry (SOCE) mediated by Orai1/Stim1 channels with an IC50 of 25 nM. RO2959 monohydrochloride is also a potent inhibitor of human IL-2 production, and potently blocks T cell receptor triggered gene expression and T cell functional pathways.
  • HY-144120
    αGalCer-RBD

    		SARS-CoV Infection
    αGalCer-RBD is a self-adjuvanting lipoprotein conjugate. αGalCer-RBD induces potent immunity against SARS-CoV-2 and its variants of concern. αGalCer-RBD conjugate induces RBD-specific, cytokine-producing T cell development. αGalCer-RBD has great potential to be an effective COVID-19 vaccine candidate. α-Galactosylceramide (αGalCer) is a potent invariant natural killer T cell (iNKT) agonist. RBD: receptor-binding domain
  • HY-18667
    LTV-1

    		Phosphatase Inflammation/Immunology
    LTV-1 is a potent lymphoid tyrosine phosphatase (LYP) inhibitor in T cells with an IC50 of 508 nM. LTV-1 has the potential for autoimmunity treatment.
  • HY-100365
    Remetinostat

    SHP-141

    		 HDAC Cancer
    Remetinostat (SHP-141) is a hydroxamic acid-based inhibitor of histone deacetylase enzymes (HDAC) which is under development for the treatment of cutaneous T-cell lymphoma.
  • HY-P1736
    Influenza HA (126-138)

    		Influenza Virus Infection
    Influenza HA (126-138) is a influenza virus hemagglutinin (HA) peptide comprising amino acids 126-138, induces thymic and peripheral T-cell apoptosis.
  • HY-114388
    QM385

    		Others Inflammation/Immunology
    QM385 is a potent sepiapterin reductase (SPR) inhibitor with an IC50 of 1.49 nM, which blocks T-cell proliferation and autoimmunity at nanomolar potency and with good oral bioavailability.
  • HY-P3747
    Hemagglutinin (48-68)

    		Influenza Virus Infection
    Hemagglutinin (48-68) is the 48-68 fragment of influenza virus hemagglutinin. Hemagglutinin (48-68) can induce proliferation of the peptide specific T-cell clones.
  • HY-140032
    Alkyne-ethyl-PEG1-Boc

    Alkyne-ethyl-PEG1-t-butyl ester

    		 PROTAC Linkers Cancer
    Alkyne-ethyl-PEG1-Boc is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-135898
    DGK-IN-1

    		DGK Cancer Inflammation/Immunology
    DGK-IN-1 is a T cell activator extracted from patent WO2020006018A1, example 25. DGK-IN-1 can be used for tumor immunity.
  • HY-128726
    ITK inhibitor 2

    		Itk Inflammation/Immunology
    ITK inhibitor 2 is a interleukin-2-inducible T-cell kinase (ITK) inhibitor extracted from patent WO2011065402A1, compound 4, with an IC50 of 2 nM.
  • HY-W278021
    BTA-1

    		Others Others
    BTA-1 is an uncharged derivative of thioflavin-T. BTA-1 has high affinity for Aβ fibrils and shows very good brain entry and clearance.
  • HY-B1548
    Benznidazol

    Ro 07-1051; Ro 71051

    		 Parasite Antibiotic Infection
    Benznidazol (Ro 07-1051) is an antiparasitic medication, with an IC50 of 20.35 μM for Colombian T. cruzi strains, and has been used in the treatment of Chagas disease.
  • HY-128589
    CHMFL-KIT-033

    		c-Kit Cancer
    CHMFL-KIT-033 is a potent and selective inhibitor of c-KIT T670I mutant for gastrointestinal stromal tumors (GISTs), with an IC50 of 0.045 μM.
  • HY-100891
    CD80-IN-3

    		CD28 Inflammation/Immunology
    CD80-IN-3, a potent CD80 inhibitor, inhibits CD80/CD28 interaction with an EC50 of 630 nM and a Kd of 125 nM.
  • HY-151460
    GCN2-IN-7

    		Others Cancer
    GCN2-IN-7 (compound 39) is an orally active and selective general control nonderepressible 2 (GCN2) inhibitor (IC50=5 nM). GCN2-IN-7 shows anti-tumor activity in vivo.
  • HY-P99408
    Oxelumab

    R 4930; huMAb OX 40L; Ro 49-89991

    		 Interleukin Related Inflammation/Immunology
    Oxelumab (R 4930) is a human monoclonal antibody against the OX40 ligand (OX40L). Oxelumab can be used for the research of asthma.
  • HY-119217
    AZ084

    		CCR Inflammation/Immunology Endocrinology
    AZ084 is a potent, selective, allosteric and oral active CCR8 allosteric antagonist, with a Ki of 0.9 nM. Has potential to treat asthma. AZ084 restrains the formation of the immunologically tolerant pre-metastatic niche (PMN) and tumor cells metastasis in lung by downregulating Treg differentiation. AZ084 can be used in studies of asthma and cancer.
  • HY-151435
    CCR6 antagonist 1

    		CCR Inflammation/Immunology
    CCR6 antagonist 1 is a CCR6 antagonist that inhibits the CCL20/CCR6 axis. CCR6 antagonist 1 can be used in the research of autoimmune-mediated inflammatory diseases, such as inflammatory bowel diseases (IBDs).
  • HY-15558
    Hoechst 33258

    bisBenzimide H 33258; H 33258

    		 Fluorescent Dye Cancer
    Hoechst 33258 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-124623
    DNDI-8219

    		Parasite Infection
    DNDI-8219 (compound 58) is a potent selective and orally active trypanocidal agent, possessing inhibitory activity against Trypanosoma cruzi (T.?cruzi) with an IC50 of 0.4 μM. DNDI-8219 has low cytotoxicity (L6 cells IC50 > 100 μM). DNDI-8219 can effectively cure chronic T.?cruzi infection and markedly reduce parasite burdens in mouse model. DNDI-8219 has good solubility, metabolic stability and safety.
  • HY-15629
    HOE 32020

    		DNA Stain Others
    HOE 32020 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-15625
    Hoechst 33258 analog 3

    		DNA Stain Others
    Hoechst 33258 analog 3 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-15559
    Hoechst 33342

    bisBenzimide H 33342; HOE 33342

    		 Autophagy Others
    Hoechst 33342 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-146398
    AMPK activator 6

    		AMPK Metabolic Disease
    AMPK activator 6 (Compound GC) reduces lipid content and activates the AMPK pathway in HepG2 and 3T3-L1 cells. AMPK activator 6 significantly suppresses the increase in triglyceride (TG) , total cholesterol (TC), low-density lipoprotein-C (LDL-C), and other biochemical indices in blood serum. AMPK activator 6 can be used for the research of non-alcoholic fatty liver disease (NAFLD) and metabolic syndrome.
  • HY-15562
    HOE 32021

    		Fluorescent Dye Others
    HOE 32021 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-15561
    HOE-S 785026

    meta-Hoechst

    		 Fluorescent Dye Cancer
    HOE-S 785026 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-15559A
    Hoechst 33342 trihydrochloride

    bisBenzimide H 33342 trihydrochloride; HOE 33342 trihydrochloride

    		 Autophagy Others
    Hoechst 33342 trihydrochloride is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-135982
    GPR81 agonist 1

    		Others Metabolic Disease
    GPR81 agonist 1 is a potent and highly selective GPR81 agonist, with EC50s of 58 nM and 50 nM for human and mouse GPR81, respectively. GPR81 agonist 1 inhibits lipolysis in differentiated 3T3-L1 adipocytes. GPR81 agonist 1 suppresses lipolysis in mice without cutaneous flushing. GPR81 agonist 1 displays remarkable selectivity for GPR81 over GPR109a.
  • HY-15619
    Hoechst S 769121

    Nuclear yellow

    		 Fluorescent Dye Others
    Hoechst S 769121 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-101982
    Lys-SMCC-DM1

    Lys-Nε-MCC-DM1

    		 Drug-Linker Conjugates for ADC Cancer
    Lys-SMCC-DM1 (Lys-Nε-MCC-DM1) is a agent-linker conjugates for ADC that can inhibit tubulin polymerization. Lys-SMCC-DM1 is the active metabolite of T-DM1. T-DM1 is a HER2-targeting ADC with a tubulin polymerization inhibitor DM1. Lys-SMCC-DM1 can be used in the research of breast cancer.
  • HY-15560
    Hoechst 34580

    HOE 34580

    		 Amyloid-β Neurological Disease
    Hoechst 34580 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-126675A
    AS2863619

    		CDK STAT Inflammation/Immunology
    AS2863619 enables conversion of antigen-specific effector/memory T cells into Foxp3 + regulatory T (Treg) cells for the treatment of various immunological diseases. AS2863619 is a potent, orally active cyclin-dependent kinase 8 (CDK8) and CDK19 inhibitor with IC50s of 0.61 nM and 4.28 nM, respectively. STAT5 activation enhanced by AS2863619 inhibition of CDK8/19, which consequently activates the Foxp3 gene.
  • HY-15630A
    Hoechst 33342 analog 2 trihydrochloride

    		Fluorescent Dye Others
    Hoechst 33342 analog 2 trihydrochloride is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-146710
    RET-IN-16

    		RET Cancer
    RET-IN-16 is a potent and selective RET inhibitor with IC50s of 3.98 nM, 8.42 nM, 15.05 nM, 7.86 nM, 5.43 nM and 8.86 nM for RET(WT), RET(M918T), RET(V804L), RET(V804M), RET-CCDC6 and RET-KIF5B, respectively. RET-IN-16 has anticancer effects.
  • HY-N0930B
    Galegine hydrochloride

    		AMPK Bacterial Infection Metabolic Disease
    Galegine hydrochloride, a guanidine derivative, contributes to weight loss in mice. Guanidine hydrochloride is the compound derived from G. officinalis, which gave rise to the biguanides, metformin and phenformin. Galegine hydrochloride activates AMPK in 3T3-L1 adipocytes and L6 myotubes, as well as in the H4IIE rat hepatoma and HEK293 human kidney cell lines. Galegine hydrochloride has antibacterial activity, with minimum inhibitory concentration of 4 mg/L against Staphylococcus aureus strains.
  • HY-15630
    Hoechst 33342 analog 2

    		Fluorescent Dye Cancer
    Hoechst 33342 analog 2 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-15563
    HOE 33187

    		Fluorescent Dye Others
    HOE 33187 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-15631
    Hoechst 33258 analog 6

    		Fluorescent Dye Others
    Hoechst 33258 analog 6 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-15558A
    Hoechst 33258 trihydrochloride

    bisBenzimide H 33258 trihydrochloride; H 33258 trihydrochloride

    		 Fluorescent Dye Cancer
    Hoechst 33258 trihydrochloride is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-15561B
    HOE-S 785026 trihydrochloride

    meta-Hoechst trihydrochloride

    		 Fluorescent Dye Others
    HOE-S 785026 trihydrochloride is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-15560B
    Hoechst 34580 tetrahydrochloride

    HOE 34580 tetrahydrochloride

    		 Amyloid-β Neurological Disease
    Hoechst 34580 tetrahydrochloride is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-15626
    ortho-iodoHoechst 33258

    		Fluorescent Dye Others
    ortho-iodoHoechst 33258 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-15627
    Hoechst 33342 analog

    		Fluorescent Dye Others
    Hoechst 33342 analog is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-15627A
    Hoechst 33342 analog trihydrochloride

    		Fluorescent Dye DNA Stain Others
    Hoechst 33342 analog trihydrochloride is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-119222
    GSK256073

    		GPR109A Metabolic Disease
    GSK256073 is a potent, selective and orally active GPR109A agonist and a long-lasting and non-flushing HCA2 full agonist with a pEC50 of 7.5 (human HCA2). GSK256073 acutely improves glucose homeostasis via inhibition of lipolysis and has the potential for the study of type 2 diabetes mellitus (T2DM)and dyslipidemia. GPR109A: G-protein coupled receptor 109A; HCA2: hydroxy-carboxylic acid receptor 2
  • HY-19617A
    EGFR-IN-1 hydrochloride

    		EGFR Cancer
    EGFR-IN-1 hydrochloride is an orally active and irreversible L858R/T790M mutant selective EGFR inhibitor. EGFR-IN-1 hydrochloride potently inhibits Gefitinib-resistant EGFR L858R, T790M with 100-fold selectivity over wild-type EGFR. EGFR-IN-1 hydrochloride displays strong antiproliferative activity against the H1975 cells and the first line mutant HCC827 cells. Antitumor activity.
  • HY-15623
    Hoechst 33258 analog

    		DNA Stain Others
    Hoechst 33258 analog is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-15622
    meta-iodoHoechst 33258

    		DNA Stain Cancer
    meta-iodoHoechst 33258 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-15628
    Hoechst 33258 analog 5

    		DNA Stain Others
    Hoechst 33258 analog 5 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-14572
    PR-104A

    SN 27858

    		 DNA Alkylator/Crosslinker Drug Metabolite Cancer
    PR-104A (SN 27858) is the alcohol metabolite of phosphate proagent PR-104. PR-104A is a hypoxia-selective DNA cross-linking agent/DNA-damaging agent and cytotoxin. Antitumor Activity. PR-104A is metabolized under hypoxia by the 1-electron NADPH:cytochrome P450 oxidoreductase. PR-104A can be used for the research of relapsed/refractory T-lineage acute lymphoblastic leukemia (T-ALL).
  • HY-147860
    EGFR-IN-61

    		EGFR Cancer
    EGFR-IN-61 (compound 22a) is a potent EGFR kinase inhibitor, with IC50 values of 42 nM (L858R/T790 M), 137 nM (L858R/T790 M/C797S), and 743 nM (WT), respectively. EGFR-IN-61 shows antiproliferative activity against A549 and H1975 cell lines, with IC50 values of 2.14 and 1.82 μM, respectively.
  • HY-15624
    Hoechst 33258 analog 2

    		DNA Stain Cancer
    Hoechst 33258 analog 2 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-15632
    para-iodoHoechst 33258

    		Fluorescent Dye Others
    para-iodoHoechst 33258 is a marker dye in Hoechst series. Hoechst is A live nuclear marker dye. Hoechst binds to the grooves in the DNA double strand, which tends to be A/ T-rich DNA strand. Although it binds to all nucleic acids, the A/ T-rich double strand DNA significantly enhances fluorescence intensity Therefore,Hoechst dye can be used for living cell labeling. The fluorescence intensity of Hoechst dye increases with the increase of pH of solution. Storage: Keep away from light.
  • HY-101450
    PF-6274484

    		EGFR Cancer
    PF-6274484 is a potent EGFR inhibitor with Kis of 0.14 nM and 0.18 nM for EGFR-L858R/T790M and WT EGFR, respectively. PF-6274484 inhibits EGFR-L858R/T790M autophosphorylation in H1975 tumor cells and EGFR WT in A549 tumor cells with IC50s of 6.6 and 5.8 nM, respectively.
  • HY-147179
    INX-SM-56

    		ADC Cytotoxin Inflammation/Immunology
    INX-SM-56 is a cytotoxin that can be used for the synthesis of anti-VISTA antibody agent conjugate. VISTA: V-region Immunoglobulin-containing Suppressor of T cell Activation.
  • HY-P99420
    Acazicolcept

    ALPN-101

    		 CD28 Inflammation/Immunology
    Acazicolcept (ALPN-101), an Fc fusion protein, is a dual inducible T cell costimulator (ICOS)/CD28 antagonist. Acazicolcept has anti-inflammatory activities.
  • HY-113313S2
    Aldosterone-d4

    		Endogenous Metabolite Cardiovascular Disease
    Aldosterone-d4 is the deuterium labeled Aldosterone. Aldosterone is the primary mineralocorticoid. Aldosterone is a steroid hormone, and it is synthesized and secreted in response to renin-angiotensin system activation (RAS) or high dietary potassium by t
  • HY-112723
    Apinocaltamide

    ACT-709478

    		 Calcium Channel Neurological Disease
    Apinocaltamide (ACT-709478) is a potent, selective, orally active, and brain penetrating T-type calcium channel blocker. ACT-709478 is used in the research of generalized epilepsies.
  • HY-N11465
    (25R)-Spirost-4-ene-3,6,12-trione

    		Others Others
    (25R)-Spirost-4-ene-3,6,12-trione is a natural product, that can be isolated from T. terrestris L.
  • HY-130997
    17-GMB-APA-GA

    		HSP ADC Cytotoxin Cancer Infection
    17-GMB-APA-GA is an ADC Cytotoxin. 17-GMB-APA-GA is a potent HSP90 inhibitor and used for latent T. gondii infection research.
  • HY-N8826
    1,7-Diphenyl-4-hepten-3-one

    		Others Infection Inflammation/Immunology
    1,7-Diphenyl-4-hepten-3-one, isolated from Alpinia officinarum, possess bioactivities against some pests, such as T. castaneum.
  • HY-44178S
    Diethyl butylmalonate-D9

    		Bacterial Infection
    Diethyl butylmalonate-d9 is the deuterium labeled Diethyl butylmalonate[1]. Diethyl butylmalonate exhibits toxicity to T. pyriformis, with a log(IGC50-1) of 0.557[2].
  • HY-P0120
    Dulaglutide

    LY2189265

    		 GCGR Metabolic Disease
    Dulaglutide (LY2189265) is a glucagon-like peptide-1 (GLP-1) receptor agonist. Dulaglutide can be uesd for the research of type 2 diabetes (T2D) .
  • HY-18819
    BCR-ABL-IN-2

    		Bcr-Abl Cancer
    BCR-ABL-IN-2 is an inhibitor of BCR-ABL1 tyrosine kinase, with IC50s of 57 nM, 773 nm for ABL1 native and ABL1 T315I, respectively.
  • HY-N11173
    cis-Melilotoside

    		Others Metabolic Disease
    cis-Melilotoside, an o-Coumaric acid derivative, shows potent antioxidant activity. cis-Melilotoside has antiprotozoal activity moderately against T. cruzi with an IC50 of 78.2 ug/mL.
  • HY-N1924
    Crassicauline A

    Crassicaulin A

    		 Others Neurological Disease
    Crassicauline A (Crassicaulin A) is a bioactive alkaloid found in roots of Aconitum carmichaeli. Crassicauline A (Crassicaulin A) possesses feeding deterrent activity against T. castaneum adults with an EC50 of 1134.5 ppm.
  • HY-119480
    Megazol

    		Bacterial Infection
    Megazol is an orally active antibacterial agent. Megazol has effective inhibitory against T. b. brueei with an EC50 of 0.01 μg/mL. Megazol can be used for the research of protozoan infections.
  • HY-P1430
    11R-VIVIT

    		Nuclear Factor of activated T Cells (NFAT) Metabolic Disease
    11R-VIVIT is a cell-permeable nuclear factor of activated T cells (NFAT) inhibitor. 11R-VIVIT can be used for the research of podocyte and diabetic nephropathy.
  • HY-10339
    KW-2449

    		FLT3 FGFR Bcr-Abl Aurora Kinase Apoptosis Cancer
    KW-2449 is a multi-targeted kinase inhibitor of FLT3, ABL, ABL T315I and Aurora kinase with IC50s of 6.6, 14, 4 and 48 nM, respectively.
  • HY-14622
    Necrostatin 2

    		RIP kinase Cancer
    Necrostatin 2 is a potent necroptosis inhibitor. EC50 for inhibition of necroptosis in FADD-deficient Jurkat T cells treated with TNF-α is 0.05 μM. Necrostatin 2 is also a RIPK1 inhibitor.
  • HY-150506
    SPR7

    		Parasite Infection
    SPR7 (compound 7) is a potent and selective rhodesain inhibitor, with a Ki of 0.51 nM. SPR7 shows antiparasitic activity against T. b. brucei, with an EC50 of 1.65 μM.
  • HY-16936
    JH-II-127

    		LRRK2 Neurological Disease
    JH-II-127 is an orally active, highly potent, selective and brain-permeable LRRK2 inhibitor, with IC50s of 6, 2 and 48 nM for wild-type LRRK2 and LRRK2-G2019S and mutant LRRK2-A2016T. JH-II-127 inhibits Ser935 phosphorylation in all tissues of mice, including the brain. JH-II-127 can be used in the study of parkinson's syndrome.
  • HY-111310
    ML351

    		Lipoxygenase Metabolic Disease Neurological Disease
    ML351 is a potent and highly specific 15-LOX-1 inhibitor with an IC50 of 200 nM. ML351 shows excellent selectivity (>250-fold) versus the related isozymes, 5-LOX, platelet 12-LOX, 15-LOX-2, ovine COX-1, and human COX-2. ML351 prevents dysglycemia and reduces β-cell oxidative stress in nonobese diabetic mouse model of T1D.
  • HY-135805
    JBJ-04-125-02

    		EGFR Cancer
    JBJ-04-125-02 is a potent, mutant-selective, allosteric and orally active EGFR inhibitor with an IC50 of 0.26 nM for EGFR L858R/T790M. JBJ-04-125-02 can inhibit cancer cell proliferation and EGFR L858R/T790M/C797S signaling. JBJ-04-125-02 has anti-tumor activities.
  • HY-126675
    AS2863619 free base

    		CDK STAT Inflammation/Immunology
    AS2863619 free base enables conversion of antigen-specific effector/memory T cells into Foxp3 + regulatory T (Treg) cells for the treatment of various immunological diseases. AS2863619 free base is a potent, orally active cyclin-dependent kinase 8 (CDK8) and CDK19 inhibitor with IC50s of 0.61 nM and 4.28 nM, respectively. STAT5 activation enhanced by AS2863619 free base inhibition of CDK8/19, which consequently activates the Foxp3 gene.
  • HY-19617B
    EGFR-IN-1 TFA

    		EGFR Cancer
    EGFR-IN-1 TFA is an orally active and irreversible L858R/T790M mutant selective EGFR inhibitor. EGFR-IN-1 TFA potently inhibits Gefitinib-resistant EGFR L858R, T790M with 100-fold selectivity over wild-type EGFR. EGFR-IN-1 TFA displays strong antiproliferative activity against the H1975 cells and the first line mutant HCC827 cells. Antitumor activity.
  • HY-19617
    EGFR-IN-1

    		EGFR Cancer
    EGFR-IN-1 (compound 24) is an orally active and irreversible L858R/T790M mutant selective EGFR inhibitor. EGFR-IN-1 potently inhibits Gefitinib-resistant EGFR L858R, T790M with 100-fold selectivity over wild-type EGFR. EGFR-IN-1 displays strong antiproliferative activity against the H1975 cells and the first line mutant HCC827 cells. Antitumor activity.
  • HY-N0457
    Chicoric acid

    Cichoric acid; Dicaffeoyltartaric acid

    		 Reactive Oxygen Species Apoptosis Metabolic Disease Inflammation/Immunology
    Chicoric acid (Cichoric acid), an orally active dicaffeyltartaric acid, induces reactive oxygen species (ROS) generation. Chicoric acid inhibits cell viability and induces mitochondria-dependent apoptosis in 3T3-L1 preadipocytes through ROS-mediated PI3K/Akt and MAPK signaling pathways. Chicoric acid increases glucose uptake, improves insulin resistance, and attenuates glucosamine-induced inflammation. Chicoric acid has antidiabetic properties and antioxidant, anti-inflammatory effects.
  • HY-112256
    ACP-105

    		Androgen Receptor Inflammation/Immunology
    ACP-105 is an orally available, selective amd potent androgen receptor modulator (SARM), with pEC50s of 9.0 and 9.3 for AR wild type and T877A mutant, respectively.
  • HY-P99760
    Nurulimab

    BCD-145

    		 CTLA-4 Cancer
    Nurulimab (BCD-145) is an anti-cytotoxic T lymphocyte antigen-4 (anti-CTLA-4) humanized monoclonal antibody. Nurulimab can be can be used in research of melanoma.
  • HY-141864
    ITK/TRKA-IN-1

    		Itk Inflammation/Immunology
    ITK/TRKA-IN-1 is a dual inhibitor of IL-2-inducible T-cell kinase (ITK) and tropomyosin receptor kinase A (TRKA) with an IC50 value of 1.0 nM and 96 % inhibition, respectively.
  • HY-147003
    MMV687807

    		Parasite Infection
    MMV687807 is an anthelmintic agent which has a good activity against Toxoplasma gondii (T. gondii) with an IC50 value of 0.15 μM and a CC50 value of 1.69 μM.
  • HY-W004282S2
    Undecanoic acid-d2

    Undecanoate-d2; Hendecanoic acid-d2

    		 Fungal Endogenous Metabolite
    Undecanoic acid-d2 is the deuterium labeled Undecanoic acid. Undecanoic acid (Undecanoate) is a monocarboxylic acid with antimycotic property, which inhibits the production of exocellular keratinase, lipase and the biosynthesis of several phospholipids in T. rubrum[1].
  • HY-P99484
    Botensilimab

    AGEN 1181

    		 CTLA-4 Cancer
    Botensilimab (AGEN 1181), a humanized anti-cytotoxic T-lymphocyte antigen 4 (CTLA-4) monoclonal antibody, is an innate and adaptive immune activator. Botensilimab can be used for the research of cancer.
  • HY-78869
    Mutated EGFR-IN-1

    Osimertinib analog

    		 EGFR Cancer
    Mutated EGFR-IN-1 (Osimertinib analog) is a useful intermediate for the inhibitors design for mutated EGFR, such as L858R EGFR, Exonl9 deletion activating mutant and T790M resistance mutant.
  • HY-W004282S1
    Undecanoic acid-d3

    Undecanoate-d3; Hendecanoic acid-d3

    		 Fungal Endogenous Metabolite
    Undecanoic acid-d3 is the deuterium labeled Undecanoic acid. Undecanoic acid (Undecanoate) is a monocarboxylic acid with antimycotic property, which inhibits the production of exocellular keratinase, lipase and the biosynthesis of several phospholipids in T. rubrum[1].
  • HY-W004282S
    Undecanoic acid-d21

    Undecanoate-d21; Hendecanoic acid-d21

    		 Fungal Endogenous Metabolite Cancer
    Undecanoic acid-d21 is the deuterium labeled Undecanoic acid. Undecanoic acid (Undecanoate) is a monocarboxylic acid with antimycotic property, which inhibits the production of exocellular keratinase, lipase and the biosynthesis of several phospholipids in T. rubrum[1].
  • HY-P99040
    Onvatilimab

    JNJ-61610588

    		 PD-1/PD-L1 Cancer
    Onvatilimab (JNJ-61610588) is a human IgG1κ anti-VISTA (V-domain Ig Suppressor of T-cell Activation) monoclonal antibody. Onvatilimab has an anti-tumor activity.
  • HY-152157
    HIV-1 inhibitor-52

    		HIV Infection
    HIV-1 inhibitor-52 is a potent broad-spectrum HIV-1 activity inhibitor with EC50s of 1.6 nM-6.4 nM for WT HIV-1, HIV-1 V370A, HIV-1 ΔV370, HIV-1 V362I/V370A, HIV-1 T332S/V362I/prR41G, HIV-1 A326T/V362I/V370A, HIV-1 R361K/V362I/L363M.
  • HY-19816
    Avitinib

    Abivertinib; AC0010

    		 EGFR Btk Cancer
    Avitinib (AC0010) is an irreversible, mutant-selective EGFR inhibitor that effectively inhibits EGFR T790M resistance mutations in non-small cell lung cancer (NSCLC). Abivertinib is also a novel BTK inhibitor.
  • HY-W030796A
    Lactisole

    		Others Metabolic Disease
    Lactisole is a canonical antagonist of sweet taste receptor, selectively targeting to T1R3 subunit, a glucose-sensing receptor. Lactisole inhibits insulin secretion induced by glucose in mouse islets.
  • HY-108317
    ABL127

    		Others Cancer
    ABL127 is a selective and covalent inhibitor of protein methylesterase 1 (PME-1) with IC50s of 6.4 nM and 4.2 nM in HEK293T and MDA-MB-231 cells, respectively.
  • HY-N6681
    15-Acetoxyscirpenol

    		Caspase Bacterial Apoptosis Antibiotic Infection
    15-acetoxyscirpenol, one of acetoxyscirpenol moiety mycotoxins (ASMs), strongly induces apoptosis and inhibits Jurkat T cell growth in a dose-dependent manner by activating other caspases independent of caspase-3.
  • HY-112581B
    5-Methoxyuridine 5'-triphosphate trisodium

    		Biochemical Assay Reagents Others
    5-Methoxyuridine 5'-triphosphate trisodium is a modified nucleotide triphosphate (NTP). 5-Methoxyuridine 5'-triphosphate trisodium can be added into mRNA with T7 RNA polymerase.
  • HY-12029
    WZ8040

    		EGFR Cancer
    WZ8040 is an irreversible mutated EGFR T790M inhibitor and inhibits EGFR phosphorylation. WZ8040 displays 100-fold greater activity against the mutated EGFR than the normal.
  • HY-126193
    JS-K

    		NO Synthase Apoptosis Cancer
    JS-K is a NO donor that reacts with glutathione to generate NO at physiological pH. JS-K inhibits proliferation, induces apoptosis, and disrupts the cell cycle of Jurkat T acute lymphoblastic leukemia cells.
  • HY-15217
    CHR-6494

    		Haspin Kinase Cancer
    CHR-6494 is a potent inhibitor of haspin, with an IC50 of 2 nM. CHR-6494 inhibits histone H3T3 phosphorylation. CHR-6494 can be used in the research of cancer.
  • HY-P99038
    Odronextamab

    		CD20 Cancer Inflammation/Immunology
    Odronextamab is a hinge-stabilised, fully human IgG4-based CD20 × CD3 bispecific antibody that binds CD3 on T cells and CD20 on B cells.
  • HY-P1430A
    11R-VIVIT TFA

    		Nuclear Factor of activated T Cells (NFAT) Metabolic Disease
    11R-VIVIT TFA is a cell-permeable nuclear factor of activated T cells (NFAT) inhibitor. 11R-VIVIT TFA can be used for the research of podocyte and diabetic nephropathy.
  • HY-P99717
    Lulizumab pegol

    BMS-931699

    		 CD28 Inflammation/Immunology
    Lulizumab pegol (BMS-931699) is an anti-CD28 antibody antagonist. Lulizumab pegol effectively inhibits T-cell proliferation and it can be used for the reseach of kidney transplantation and autoimmunity disease.
  • HY-118047
    CI 972 anhydrous

    		Nucleoside Antimetabolite/Analog Inflammation/Immunology
    CI 972 anhydrous is a potent, orally active, and competitive inhibitor of purine nucleoside phosphorylase (PNP) (Ki=0.83 μM) under development as a T cell-selective immunosuppressive agent.
  • HY-112125
    KRN2

    		Nuclear Factor of activated T Cells (NFAT) Inflammation/Immunology
    KRN2 is a selective inhibitor of nuclear factor of activated T cells (NFAT5), with an IC50 of 100 nM. KRN2 has potential to treat NFAT5-mediated Chronic Arthritis.
  • HY-B1378S1
    Ethosuximide-d5

    		Isotope-Labeled Compounds Calcium Channel Neurological Disease
    Ethosuximide-d5 is deuterium labeled Ethosuximide. Ethosuximide, a widely prescribed anti-epileptic agent, improves the phenotypes of multiple neurodegenerative disease models and blocks the low voltage activated T-type calcium channel.
  • HY-N0704
    Agrimol B

    		Sirtuin PPAR Fatty Acid Synthase (FASN) c-Myc Bacterial Cancer Infection Metabolic Disease
    Agrimol B, a polyphenol, is an orally active and potent SIRT1 activator. Agrimol B shows anti-adipogenic and anticancer activity. Agrimol B shows antibacterial activity against plant pathogens. Agrimol B dramatically inhibits 3T3-L1 adipocyte differentiation by reducing PPARγ, C/EBPα, FAS, UCP-1, and apoE expression. The action of Agrimol B on the cancer cells is likely derived from its effect on c-MYC, SKP2 and p27.
  • HY-146461
    Anticancer agent 58

    		Apoptosis Caspase ROS Kinase Cancer
    Anticancer agent 58 (compound 16) has inhibitory activity against kinds of cancer cell lines, especially in A549 and T24 with IC50s of 0.6 μM and 0.7 μM, respectively. Anticancer agent 58 induces apoptosis by activating caspase 3/8/9 activity, and induces an increase of Ca 2+ and ROS in cancer cells. Anticancer agent 58 significantly decreases mitochondrial membrane potential. Anticancer agent 58 can suppress tumor growth in T24 mouse xenograft model.
  • HY-146034
    NOD1/2 antagonist-1

    		NOD-like Receptor (NLR) Cancer Inflammation/Immunology
    NOD1/2 antagonist-1 (compound 36b) is a potent NOD1/2 (nucleotide-binding oligomerization domain-like receptor 1/2) dual antagonist, with IC50 values of 1.13 (NOD1) and 0.77 μM (NOD2), respectively. NOD1/2 antagonist-1 has a acceptable T1/2 (67.6 min). NOD1/2 antagonist-1 (compound 36b) can improve the antitumor efficacy of Paclitaxel (PTX).
  • HY-11009
    CGP60474

    		CDK PKC Cancer
    CGP60474, a highly potent anti-endotoxemic agent, is a potent cyclin-dependent kinase (CDK) inhibitor (IC50 values are 26, 3, 4, 216, 10, 200 and 13 nM for CDK1/B, CDK2/E, CDK2/A, CDK4/D, CDK5/p25, CDK7/H and CDK9/T, respectively). CGP60474 is a selective and ATP-competitive PKC inhibitor.
  • HY-B0689A
    Indinavir sulfate

    MK-639; L735524

    		 HIV HIV Protease SARS-CoV Apoptosis MMP Infection Cancer
    Indinavir sulfate (MK-639) is an orally active and selective HIV-1 protease inhibitor with a Ki of 0.54 nM for PR. Indinavir sulfate exhibits anticancer activity by inhibiting the activation of MMPs-2 hydrolysis, anti-angiogenesis and inducing apoptosis. Indinavir sulfate is also a SARS-CoV 3CL pro inhibitor.
  • HY-148103
    SR12418

    		REV-ERB Inflammation/Immunology
    SR12418 is a REV-ERB-specific synthetic ligand with IC50s of 68 nM and 119 nM for REV-ERBα and REV-ERBβ, respectively. SR12418 can be used in experimental autoimmune encephalomyelitis (EAE) and colitis research.
  • HY-144497
    HE-S2

    		PD-1/PD-L1 Toll-like Receptor (TLR) Drug-Linker Conjugates for ADC Cancer Infection
    HE-S2 is an antibody-drug conjugate triggering a potent antitumor immune response. HE-S2 acts by blocking the PD-1/PD-L1 interaction and activating the Toll-like receptor 7/8 (TLR7/8) signaling pathway. HE-S2 has remarkable antitumor activity.
  • HY-148391
    23-Oxa-OSW-1

    SBF-1

    		 DNA/RNA Synthesis Cancer
    23-Oxa-OSW-1 (SBF-1), a derivative of OSW 1 (HY-101213), is a potent osterol-binding protein (OSBP) inhibitor. 23-Oxa-OSW-1 has antitumor activity.
  • HY-B0689
    Indinavir

    MK-639 free base; L-735524 free base

    		 HIV HIV Protease Apoptosis MMP SARS-CoV Inflammation/Immunology Cancer
    Indinavir (MK-639 free base) is an orally active and selective HIV-1 protease inhibitor with a Ki of 0.54 nM for PR. Indinavir exhibits anticancer activity by inhibiting the activation of MMPs-2 hydrolysis, anti-angiogenesis and inducing apoptosis. Indinavir is also a SARS-CoV 3CL pro inhibitor.
  • HY-B0689B
    Indinavir sulfate ethanolate

    MK-639 ethanolate; L735524 ethanolate

    		 Apoptosis MMP HIV HIV Protease SARS-CoV Cancer Infection
    Indinavir sulfate ethanolate (MK-639 ethanolate) is an orally active and selective HIV-1 protease inhibitor with a Ki of 0.54 nM for PR. Indinavir sulfate ethanolate exhibits anticancer activity by inhibiting the activation of MMPs-2 hydrolysis, anti-angiogenesis and inducing apoptosis. Indinavir sulfate ethanolate is also a SARS-CoV 3CL pro inhibitor.
  • HY-B0190A
    Nafamostat mesylate

    FUT-175

    		 Ser/Thr Protease Apoptosis SARS-CoV Cardiovascular Disease Cancer
    Nafamostat mesylate, a synthetic serine protease inhibitor, is an anticoagulant. Nafamostat mesylate supresses T cell auto-reactivity by decreasing granzyme activity and CTL cytolysis. Nafamostat mesylate blocks activation of SARS-CoV-2..
  • HY-B0190
    Nafamostat

    		Ser/Thr Protease Apoptosis SARS-CoV Cardiovascular Disease
    Nafamostat, a synthetic serine protease inhibitor, is an anticoagulant. Nafamostat supresses T cell auto-reactivity by decreasing granzyme activity and CTL cytolysis. Nafamostat blocks activation of SARS-CoV-2.
  • HY-128971
    LHVS

    		Cathepsin Parasite Infection Neurological Disease
    LHVS is a potent, non-selective, irreversible, cell-permeable cysteine protease and cathepsin inhibitor. LHVS decreases actin ring formation. LHVS inhibits T. gondii invasion with an IC50 of 10 μM.
  • HY-123390
    DB07107

    		Bcr-Abl Akt Cancer
    DB07107 is a potent agent resistant T315I mutant Bcr-Abl tyrosine kinase inhibitor. DB07107 is also a potent Akt1 inhibitor with an IC50 value of 360 nM.
  • HY-144721
    Antitubercular agent-11

    		Bacterial Infection
    Antitubercular agent-11 (Compound 1e) is an antitubercular agent. Antitubercular agent-11 with a bulkier electron-donating group (Bu-t) demonstrated the best MIC value of 0.060 μg/mL.
  • HY-112668
    Retagliptin phosphate

    SP2086 phosphate

    		 Dipeptidyl Peptidase Metabolic Disease
    Retagliptin phosphate (SP2086 phosphate) is a selective, competitive and orally active dipeptidyl peptidase-4 (DPP-4) inhibitor. Retagliptin phosphate can be used for type 2 diabetes mellitus (T2DM) research.
  • HY-135914
    JBJ-02-112-05

    		EGFR Cancer
    JBJ-02-112-05 is a potent, mutant-selective, allosteric and orally active EGFR inhibitor with an IC50 of 15 nM for EGFR L858R/T790M.
  • HY-153132
    mGluR3 modulator-1

    		mGluR Metabolic Disease
    mGluR3 modulator-1 (compound 3) is a mGluR3 modulator, with an EC50 of 1-10 μM in HEK293T-mGluR-Gqi5 Calcium Mobilization Assay.
  • HY-N4171
    Dihydrocucurbitacin B

    		Apoptosis Inflammation/Immunology
    Dihydrocucurbitacin B, a triterpene isolated from Cayaponia tayuya roots, inhibits nuclear factor of activated T cells (NFAT), induces cell cycle arrested in the G0 phase, and inhibits delayed type hypersensitivity.
  • HY-B0190B
    Nafamostat hydrochloride

    		Ser/Thr Protease Apoptosis SARS-CoV Cardiovascular Disease
    Nafamostat hydrochloride, a synthetic serine protease inhibitor, is an anticoagulant. Nafamostat hydrochloride supresses T cell auto-reactivity by decreasing granzyme activity and CTL cytolysis. Nafamostat hydrochloride blocks activation of SARS-CoV-2..
  • HY-13984
    Mutant EGFR inhibitor

    		EGFR Cancer
    Mutant EGFR inhibitor is a potent and selective mutant EGFR inhibitor extracted from patent WO 2013014448 A1; inhibits EGFR L858R, EGFR Exon 19 deletion and EGFR T790M.
  • HY-112668A
    Retagliptin

    SP2086

    		 Dipeptidyl Peptidase Metabolic Disease
    Retagliptin (SP2086) is a selective, competitive and orally active dipeptidyl peptidase-4 (DPP-4) inhibitor. Retagliptin can be used for type 2 diabetes mellitus (T2DM) research.
  • HY-W014700
    Glycyl-L-glutamic acid

    		Cholinesterase (ChE) Neurological Disease
    Glycyl-L-glutamic acid is a neurotrophic factor (NF) in vivo, and exerts function of maintenance of AChE content and activity. Glycyl-L-glutamic acid doesn’t act directly on AChE synthesis, and may prevent preganglionic neuronal degeneration.
  • HY-14171S
    Bexarotene-d4

    LGD1069 d4

    		 RAR/RXR Autophagy Cancer
    Bexarotene-d4 is a deuterium labeled Bexarotene (LGD1069). Bexarotene (LGD1069) is a selective retinoid X receptors (RXR) agonist for the treatment of cutaneous T-cell lymphoma[1][2][3][4][5].
  • HY-146745
    Antileishmanial agent-5

    		Parasite Inflammation/Immunology
    Antileishmanial agent-4 is a ribonucleoside analogue and acts as an antileishmanial agent. Antileishmanial agent-4 is against L.infantum and T.cruzi with EC50 values of 0.68 μM and 0.83 μM, respectively.
  • HY-148803
    Vabametkib

    		c-Met/HGFR Cancer
    Vabametkib is a potent inhibitor of hepatocyte growth factor receptor (HGFR). Vabametkib inhibits Hs746T cells proliferation and inhibits c-Met with an IC50 value of 7 nM. Vabametkib can be used as an antineoplastic agent.
  • HY-109108
    Valemetostat

    DS-3201

    		 Histone Methyltransferase Cancer
    Valemetostat (DS-3201), a first-in-class EZH1/2 dual inhibitor with IC50 values ＜10 nM. Valemetostat can be used for the research of relapsed/refractory peripheral T-cell lymphoma.
  • HY-111149A
    PS372424 hydrochloride

    		CXCR Inflammation/Immunology
    PS372424 hydrochloride, a three amino-acid fragment of CXCL10, is a specific human CXCR3 agonist with anti-inflammatory activity. PS372424 hydrochloride prevents human T-cell migration in a humanized model of arthritic inflammation.
  • HY-N7632
    5-Desmethylsinensetin

    		Bacterial Infection Inflammation/Immunology
    5-desmethylsinensetin, isolated from Artemisia princeps , possesses antiprotozoal activity. 5-desmethylsinensetin shows IC50 values of 0.4 μg/mL on T. cruzi epimastigotes and 75.1 μg/mL on trypomastigotes, respectively.
  • HY-111149
    PS372424

    		CXCR Inflammation/Immunology
    PS372424, a three amino-acid fragment of CXCL10, is a specific human CXCR3 agonist with anti-inflammatory activity. PS372424 prevents human T-cell migration in a humanized model of arthritic inflammation.
  • HY-15440A
    Fostemsavir

    BMS-663068

    		 HIV Infection
    Fostemsavir (BMS-663068) is the phosphonooxymethyl prodrug of BMS-626529. Fostemsavir (BMS-663068) is a novel attachment inhibitor that targets HIV-1 gp120 and prevents its binding to CD4 + T cells.
  • HY-N0647
    Silychristin

    		Monocarboxylate Transporter Endocrinology
    Silychristin is an abundant flavonolignan present in the fruits of Silybum marianum, with antioxidant properties. Silychristin is a potent inhibitor of the thyroid hormone transporter MCT8, and elicits a strong inhibition of T3 uptake with an IC50 of 110 nM.
  • HY-118621
    JCP174

    		Elastase Parasite Infection
    JCP174 is an inhibitor of palmitoyl protein thioesterase-1 (TgPPT1), a depalmitoylase in the parasite T. gondii. JCP174 is also an inhibitor of porcine pancreatic elastase and human leukocyte elastase.
  • HY-109108A
    Valemetostat tosylate

    DS-3201 tosylate

    		 Histone Methyltransferase Cancer
    Valemetostat (DS-3201) tosylate, a first-in-class EZH1/2 dual inhibitor with IC50 values ＜10 nM. Valemetostat tosylate can be used for the research of relapsed/refractory peripheral T-cell lymphoma.
  • HY-146071
    Antitrypanosomal agent 5

    		Parasite Infection
    Antitrypanosomal agent 5 (Compound 25)is a selective anti-trypanosomal agent with IC50s of 1 nM and 483.3 µM against T. brucei cell growth and HEK293 cells growth , respectively.
  • HY-119944
    JND3229

    		EGFR Cancer
    JND3229 is a reversible EGFR C797S inhibitor with IC50 values of 5.8, 6.8 and 30.5 nM for EGFR L858R/T790M/C797S, EGFR WT and EGFR L858R/T790M, respectively. JND3229 has good anti-proliferative activity and can effectively inhibit tumour growth in vivo. JND3229 can be used in cancer research, especially in non-small cell carcinoma.
  • HY-151450
    Cav 3.2 inhibitor 1

    		Calcium Channel Inflammation/Immunology Neurological Disease
    Cav 3.2 inhibitor 1 is a T-type calcium channel inhibitor with little binding affinity to dopamine D2 receptors. Cav 3.2 inhibitor 1 can be used for the research of somatic and visceral pain.
  • HY-B0358
    Flunarizine

    		Calcium Channel Sodium Channel Dopamine Receptor Neurological Disease
    Flunarizine is a potent dual Na +/Ca 2+ channel (T-type) blocker. Flunarizine is a D2 dopamine receptor antagonist. Flunarizine shows anticonvulsive and antimigraine activity, and peripheral vasodilator effects.
  • HY-107091
    Aspartyl-alanyl-diketopiperazine

    DA-DKP

    		 Others Inflammation/Immunology
    Aspartyl-alanyl-diketopiperazine (DA-DKP) is an immunomodulatory molecule generated by cleavage and cyclization from the N-terminus of human albumin and can modulate the inflammatory immune response through a molecular pathway implicated in T- lymphocyte anergy.
  • HY-136526
    BCR-ABL-IN-3

    		Bcr-Abl Cancer
    BCR-ABL-IN-3 is a potent and irreversible Bcr-Abl inhibitor with an IC50 of ≤100 nM for Ba/F3Bcr-Abl T3151. BCR-ABL-IN-3 has anti-cancer activity.
  • HY-B1378S
    Ethosuximide-d3

    		Isotope-Labeled Compounds Calcium Channel Neurological Disease
    Ethosuximide-d3 is the deuterium labeled Ethosuximide. Ethosuximide, a widely prescribed anti-epileptic agent, improves the phenotypes of multiple neurodegenerative disease models and blocks the low voltage activated T-type calcium channel[1][2].
  • HY-B0358A
    Flunarizine dihydrochloride

    		Calcium Channel Sodium Channel Dopamine Receptor Neurological Disease
    Flunarizine dihydrochloride is a potent dual Na +/Ca 2+ channel (T-type) blocker. Flunarizine dihydrochloride is a D2 dopamine receptor antagonist. Flunarizine dihydrochloride shows anticonvulsive and antimigraine activity, and peripheral vasodilator effects.
  • HY-N1506
    Ganodermanontriol

    		Others Cancer
    Ganodermanontriol, a sterol isolated from Ganoderma lucidum, induces anti-inflammatory activity in tert-butyl hydroperoxide (t-BHP)-damaged hepatic cells through the expression of HO-1. Ganodermanontriol exhibits hepatoprotective activity.
  • HY-119370
    CHMFL-ABL-121

    		Bcr-Abl Apoptosis Cancer
    CHMFL-ABL-121 is a highly potent type II ABL kinase inhibitor with IC50s of 2 nM and 0.2 nM against purified inactive ABL wt and T315I kinase protein, respectively.
  • HY-124416
    ML604086

    		CCR Inflammation/Immunology Endocrinology
    ML604086 is a selective CCR8 inhibitor, inhibiting CCL1 binding to CCR8 on circulating T-cells. ML604086 inhibits CCL1 mediated chemotaxis and increases in intracellular Ca 2+ concentrations.
  • HY-N7915
    Nepasaikosaponin K

    		Influenza Virus Infection
    Nepasaikosaponin K is an anti-influenza agent. Nepasaikosaponin K shows an EC50 of 17.91 μM against influenza virus A/WSN/33 (H1N1) in 239T-Gluc cells.
  • HY-112870
    Alflutinib

    Furmonertinib; AST2818

    		 EGFR Cancer
    Alflutinib is a potent inhibitor of EGFR. Alflutinib inhibits EGFR active mutations as well as the T790M acquired resistant mutation. Alflutinib has the potential for the research of cancer diseases, especially non-small cell lung cancer (NSCLC).
  • HY-N11550
    Salviandulin E

    		Parasite Infection
    Salviandulin E is a diterpenoid compound that can be isolated from Salvia leucantha CAV.. Salviandulin E shows antitrypanosomal activity against T. b. brucei GUTat 3.1 parasites with an IC50 value of 0.72 µg/mL.
  • HY-151981
    EGFR-IN-74

    		EGFR Cancer
    EGFR-IN-74 (Compound 21) is a potent EGFR inhibitor with an IC50 of 138 nM against EGFR L858R/T790M. EGFR-IN-74 induces cancer cell apoptosis.
  • HY-19910
    Acoziborole

    SCYX-7158; AN5568

    		 Parasite Infection
    Acoziborole (SCYX-7158) is an effective, safe and orally active antiprotozoal agent for the research of human african trypanosomiasis (HAT). In the T. b. brucei S427 strain, the MIC value for SCYX-7158 is 0.6 µg/mL.
  • HY-N10846
    Neotriptonoterpene

    		Others Others
    Neotriptonoterpene, a compound isolated from T. regelii, shows weak cytotoxic activity against A2780, HepG2 and MCF-7 cells with IC50 values of 65.80, 35.45 and 64.80 µM respectively.
  • HY-141432
    Cbl-b-IN-3

    		E1/E2/E3 Enzyme Cancer
    Cbl-b-IN-3 (Compound 23) is a casitas B-lineage lymphoma proto-oncogene-b (Cbl-b) inhibitor with an IC50 of < 1 nM. Cbl-b is an E3 ubiquitin ligase that negatively regulates T-cell activation.
  • HY-15553B
    Mibefradil dihydrochloride hydrate

    Ro 40-5967 dihydrochloride hydrate

    		 Calcium Channel Cardiovascular Disease
    Mibefradil dihydrochloride hydrate (Ro 40-5967 dihydrochloride hydrate) is a effectively long-acting calcium channel antagonist, used as an antihypertensive agent. Mibefradil dihydrochloride hydrate acts via a higher affinity block for low-voltage-activated (T) than for high-voltage-activated (L) calcium channels.
  • HY-153111
    EGFR/HER2-IN-9

    		EGFR Cancer
    EGFR/HER2-IN-9 (Compound 1) is an EGFR and HER2 inhibitor with IC50s of 3.2, 8.3 and 14 nM against EGFR, EGFR T790M and HER2, respectively.
  • HY-151452
    Cav 3.2 inhibitor 3

    		Calcium Channel Neurological Disease
    Cav 3.2 inhibitor 3 (Compound 4) is a potent Cav3.2 T-type Ca 2+ channel inhibitor with an IC50 of 0.1534 μM, and has little binding affinity to D2 receptors.
  • HY-N7696
    Physalin F

    		Apoptosis Inflammation/Immunology
    Physalin F is a secosteroid with potent anti-inflammatory and immunomodulatory activities. Physalin F induces apoptosis of PBMC, decreasing the spontaneous proliferation and cytokine production caused by Human T-lymphotropic virus type 1 (HTLV-1) infection.
  • HY-128900
    11-cis-Vaccenyl acetate

    		Endogenous Metabolite Others
    11-cis-Vaccenyl acetate is male-specific lipid that mediates aggregation behavior in both male and female flies, which activates a few dozen olfactory neurons located in T1 sensilla on the antenna of both male and female flies.
  • HY-108568
    15-Deoxy-Δ-12,14-prostaglandin J2

    15d-PGJ2; 15-Deoxy-Δ12,14-PGJ2

    		 PPAR Endogenous Metabolite Cancer Inflammation/Immunology Neurological Disease
    15-Deoxy-Δ-12,14-prostaglandin J2 (15d-PGJ2) is a cyclopentenone prostaglandin and a metabolite of PGD2. 15-Deoxy-Δ-12,14-prostaglandin J2 is a selective PPARγ (EC50 of 2 µM) and a covalent PPARδ agonist. 15-Deoxy-Δ-12,14-prostaglandin J2 promotes efficient differentiation of C3H10T1/2 fibroblasts to adipocytes with an EC50 of 7 μM.
  • HY-114911
    Feprazone

    DA2370; Prenazone; Zepelin

    		 COX Reactive Oxygen Species MMP Inflammation/Immunology
    Feprazone (DA2370; Prenazone), an analogue of Phenylbutazone (HY-B0230), is a nonsteroidal anti-inflammatory agent with analgesic and antipyretic activities. Feprazone acts by inhibiting the activity of cyclooxygenase (COX)-2. Feprazone ameliorates free fatty acid (FFA)-induced oxidative stress by reducing the production of mitochondrial reactive oxygen species (ROS). Feprazone can decrease the expression of MMP-2 and MMP-9. Besides, Feprazone can suppress adipogenesis and increase lipolysis in differentiating 3 T3-L1 cells. Feprazone also can be used to research atherosclerosis and obesity.
  • HY-143246
    EGFR kinase inhibitor 1

    		EGFR Apoptosis Cancer
    EGFR kinase inhibitor 1 is a potent EGFR inhibitor with IC50s of 37, 1.7, >300 nM for WT, l885R/T790M, L858R/T790M/C797S, respectively. EGFR kinase inhibitor 1 induces apoptosis and cell cycle arrest at G0/G1-phase. EGFR kinase inhibitor 1 inhibits the cell motility. EGFR kinase inhibitor 1 shows antiproliferative and anti-tumor activity.
  • HY-15504A
    RGB-286638 free base

    		CDK GSK-3 MEK JAK Cancer
    RGB-286638 is a CDK inhibitor that inhibits the kinase activity of cyclin T1-CDK9, cyclin B1-CDK1, cyclin E-CDK2, cyclin D1-CDK4, cyclin E-CDK3, and p35-CDK5 with IC50s of 1, 2, 3, 4, 5 and 5 nM, respectively; also inhibits GSK-3β, TAK1, Jak2 and MEK1, with IC50s of 3, 5, 50, and 54 nM.
  • HY-15504
    RGB-286638

    		CDK GSK-3 MEK JAK Cancer
    RGB-286638 is a CDK inhibitor that inhibits the kinase activity of cyclin T1-CDK9, cyclin B1-CDK1, cyclin E-CDK2, cyclin D1-CDK4, cyclin E-CDK3, and p35-CDK5 with IC50s of 1, 2, 3, 4, 5 and 5 nM, respectively; also inhibits GSK-3β, TAK1, Jak2 and MEK1, with IC50s of 3, 5, 50, and 54 nM.
  • HY-113042
    Prostaglandin B2

    		Endogenous Metabolite Endocrinology Cardiovascular Disease
    Prostaglandin B2 is a prostaglandin. Prostaglandin B2 is the main substance in cord blood mesenchymal stem cells, to inhibit DC-T Cell proliferation. Prostaglandin B2 also induces cutaneous vasoconstriction of the canine hind paw.
  • HY-112126
    KRN5

    		Nuclear Factor of activated T Cells (NFAT) Inflammation/Immunology
    KRN5, a derivative of KRN2, is an oral active Nuclear factor of activated T cells 5 (NFAT5) suppressor, with an IC50 of 750 nM. KRN5 has potential to treat NFAT5-mediated Chronic Arthritis.
  • HY-112058
    Distamycin A

    NSC-82150

    		 Antibiotic Apoptosis Infection
    Distamycin A (NSC-82150), an oligopeptide antibiotic, is a minor groove binder which binds to B-form DNA, preferentially at A/T rich sites.Distamycin A can change Enediyne-induced DNA cleavage sites and enhances apoptosis.
  • HY-149055
    ACT-777991

    		CXCR Inflammation/Immunology
    ACT-777991 is an orally active and selective CXCR3 antagonist. ACT-777991 has microsomes and hepatocytes stability across animal models. ACT-777991 inhibits the migration of activated T cells toward CXCL11.
  • HY-153238
    AN15368

    		Parasite Infection
    AN15368 is an orally active small-molecule precursor that can be activated by parasite carboxypeptidase to produce a compound that targets the messenger RNA processing pathway in T. cruzi. cruzi. AN15368 has the potential to prevent and research Chagas disease potential.
  • HY-P1569
    LCMV gp33-41

    		Arenavirus Inflammation/Immunology
    LCMV gp33-41, the carboxyl-extended 11-aa-long peptide, is an lymphocytic choriomeningitis virus sequence restricted by MHC class I H-2Db molecules and presented to cytotoxic T lymphocytes.
  • HY-P99354
    Bavunalimab

    Anti-Human CTLA4xLAG3

    		 CTLA-4 Cancer Inflammation/Immunology
    Bavunalimab (Anti-Human CTLA4xLAG3) is a bispecific human anti-CTLA-4/LAG-3 monoclonal antibody. Bavunalimab activates T cells in NSG mice. Bavunalimab can be used for the research of cancer.
  • HY-N7038
    Phytohemagglutinin

    PHA-M

    		 Others Inflammation/Immunology
    Phytohemagglutinin (PHA-M), the major seed lectin of the common bean, Phaseolus vulgaris, accumulates in the parenchyma cells of the cotyledons. Phytohemagglutinin is a T-cell activator. Stimulation of human mononuclear leukocytes by Phytohemagglutinin induces the expression of ChAT mRNA, and potentiated ACh synthesis.
  • HY-119339
    SX-682

    		CXCR Cancer Inflammation/Immunology Endocrinology
    SX-682 is an orally bioavailable, potent allosteric inhibitor of CXCR1 and CXCR2. SX-682 can block tumor myeloid-derived suppressor cells (MDSCs) recruitment and enhance T cell activation and antitumor immunity.
  • HY-P1078
    Huwentoxin XVI

    		Calcium Channel Neurological Disease
    Huwentoxin XVI, an analgesic, is a highly reversible and selective mammalian N-type calcium channel (IC50 of ~60 nM) antagonist from Chinese tarantula Ornithoctonus huwena. Huwentoxin XVI has no effect on voltagegated T-type calcium channels, potassium channels or sodium channels.
  • HY-144395
    HDAC6-IN-4

    		HDAC Apoptosis Cancer Inflammation/Immunology
    HDAC6-IN-4 (C10) is a potent, orally active and highly selective HDAC6 inhibitor with an IC50 value of 23 nM. HDAC6-IN-4 induces cancer cells apoptosis and shows significant antitumor efficacy, without obvious toxicity.
  • HY-145319
    FPFT-2216

    		Phosphodiesterase (PDE) Casein Kinase Molecular Glues Cancer Inflammation/Immunology
    FPFT-2216, a “molecular glue” compound, degrades phosphodiesterase 6D (PDE6D), zinc finger transcription factors Ikaros (IKZF1), Aiolos (IKZF3), and casein kinase 1α (CK1α). FPFT-2216 can be used for the research of cancer and inflammatory disease.
  • HY-12692
    DO3A tert-Butyl ester

    DO3A tert-butyl; DO3A-t-Bu-ester

    		 Others Others
    DOTA tert-Butyl ester is a benxyl derivative of the cyclic tosamide; can be nitrated directly; is more convenient to incorporate the nitro group after deprotection lithium aluminum hydride.
  • HY-140788
    Azide-PEG9-amido-C4-Boc

    5-(Azide-PEG9-ethylcarbamoyl)pentanoic t-butyl ester

    		 PROTAC Linkers Cancer
    Azide-PEG9-amido-C4-Boc is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140791
    Azide-PEG9-amido-C16-Boc

    17-(Azide-PEG9-ethylcarbamoyl)heptadecanoic t-butyl ester

    		 PROTAC Linkers Cancer
    Azide-PEG9-amido-C16-Boc is an alkyl/ether-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140787
    Azide-PEG6-amido-C16-Boc

    17-(Azide-PEG6-ethylcarbamoyl)heptadecanoic t-butyl ester

    		 PROTAC Linkers Cancer
    Azide-PEG6-amido-C16-Boc is an alkyl/ether-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140789
    Azide-PEG9-amido-C8-Boc

    9-(Azide-PEG9-ethylcarbamoyl)nonanoic t-butyl ester

    		 PROTAC Linkers Cancer
    Azide-PEG9-amido-C8-Boc is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140588
    Benzyl-N-bis(PEG3-Boc)

    N-Benzyl-N-bis(PEG3-t-butyl ester)

    		 PROTAC Linkers Cancer
    Benzyl-N-bis(PEG3-Boc) is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140201
    Amino-PEG6-amido-C16-Boc

    17-(Amino-PEG6-ethylcarbamoyl)heptadecanoic t-butyl ester

    		 PROTAC Linkers Cancer
    Amino-PEG6-amido-C16-Boc is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140202
    Amino-PEG9-amido-C16-Boc

    17-(Amino-PEG9-ethylcarbamoyl)heptadecanoic t-butyl ester

    		 PROTAC Linkers Cancer
    Amino-PEG9-amido-C16-Boc is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-140790
    Azide-PEG9-amido-C12-Boc

    13-(Azide-PEG9-ethylcarbamoyl)tridecanoic t-butyl ester

    		 PROTAC Linkers Cancer
    Azide-PEG9-amido-C12-Boc is a PEG-based PROTAC linker that can be used in the synthesis of PROTACs.
  • HY-79077
    Osimertinib dimesylate

    AZD-9291 dimesylate; Mereletinib dimesylate

    		 EGFR Cancer
    Osimertinib dimesylate (AZD-9291 dimesylate) is an irreversible and mutant selective EGFR inhibitor with IC50s of 12 and 1 nM against EGFR L858R and EGFR L858R/T790M, respectively.
  • HY-15440B
    Fostemsavir Tris

    BMS-663068 Tris

    		 HIV Infection
    Fostemsavir Tris (BMS-663068 (Tris)) is the phosphonooxymethyl proagent of BMS-626529. Fostemsavir Tris (BMS-663068 (Tris)) is a novel attachment inhibitor that targets HIV-1 gp120 and prevents its binding to CD4 + T cells.
  • HY-102052
    DCEBIO

    		Potassium Channel Inflammation/Immunology
    DCEBIO, a derivative of 1-EBIO, is an extremely potent activator of Cl - secretion in T84 colonic cells. DCEBIO stimulates Cl - secretion via the activation of hIK1 K + channels and the activation of an apical membrane Cl - conductance.
  • HY-16984
    GNE-4997

    		Itk Inflammation/Immunology
    GNE-4997 is a potent and selective interleukin-2-inducible T-cell kinase (ITK) inhibitor with a Ki of 0.09 nM, and the correlation between the basicity of solubilizing elements in GNE-4997 and off-target antiproliferative effects reduces cytotoxicity.
  • HY-114495
    Caerulomycin A

    Cerulomycin; Caerulomycin

    		 Fungal Antibiotic Infection Inflammation/Immunology
    Caerulomycin A (Cerulomycin; Caerulomycin), an antifungal compound, induces generation of T cells, enhances TGF-β-Smad3 protein signaling via suppressing interferon-γ-induced STAT1 signaling. Antifungal and antibiotic activity, and used in autoimmune diseases.
  • HY-116609
    C6 L-threo Ceramide

    		Interleukin Related Inflammation/Immunology
    C6 L-threo Ceramide is a bioactive sphingolipid and cell-permeable analog of naturally occurring ceramides. C6 L-threo Ceramide significantly inhibits IL-4 production in T cells. Anti-allergic agents.
  • HY-N11646
    Ganorbiformin B

    		Bacterial Infection
    Ganorbiformin B is a lanostane triterpenoid. Ganorbiformin B shares the same lanostane skeleton with known ganoderic acids. The C-3 epimer of ganoderic acid T exhibits potent antimycobacterial activity against Mycobacterium tuberculosis H37Ra.
  • HY-N2589
    Isosaponarin

    		TGF-β Receptor Others
    Isosaponarin is a flavone glycoside isolated from wasabi leaves. Isosaponarin increases collagen synthesis, caused by up-regulated TGF-β type II receptor (TβR-II) and prolyl 4-hydroxylase (P4H) proteins production.
  • HY-147562
    ALPK1-IN-2

    		NF-κB Cancer Inflammation/Immunology
    ALPK1-IN-2 (compound T001) is a potent ALPK1 (alpha-kinase 1) inhibitor, with an IC50 of 95 nM. ALPK1-IN-2 also inhibits NF-κB, with an IC50 of 1.31 μM.
  • HY-N7206
    5-O-Methylvisamminol

    		Others Metabolic Disease
    5-O-Methylvisamminol, a (furo) chromone identified in the extract of T. glauca, has a limited occurrence in the plant kingdom. 5-O-Methylvisamminol is useful in (chemical) phylogeny and is a possible excellent chemotaxonomic marker (family and/or subfamily level) for Apiaceae.
  • HY-139884
    EGFR-IN-18

    		EGFR Cancer
    EGFR-IN-18 potently inhibits enzymatic activity in L858R/T790M/C797S mutant EGFR (4.9 nM), with a significantly lower activity for wild-type EGFR (47 nM).
  • HY-120210
    XY018

    		ROR Cancer Inflammation/Immunology
    XY018 is a potent ROR-γ-selective antagonist. XY018 inhibits ROR-γ constitutive activity in 293T cells with high potency (EC50, 190 nM). XY018 binds to the ROR-γ hydrophobic ligand binding domain (LBD).
  • HY-P1569A
    LCMV gp33-41 TFA

    		Arenavirus Inflammation/Immunology
    LCMV gp33-41 (TFA), the carboxyl-extended 11-aa-long peptide, is an lymphocytic choriomeningitis virus sequence restricted by MHC class I H-2Db molecules and presented to cytotoxic T lymphocytes.
  • HY-149080
    Antiparasitic agent-16

    		Parasite Necroptosis Infection
    Antiparasitic agent-16, a pyridine-thiazolidinone, has anti-Trypanosoma cruzi and leishmanicidal activities. Antiparasitic agent-16 has IC50s of 1.0 μM and 0.6 μM against trypomastigote and amastigote forms of T. cruzi. Antiparasitic agent-16 has IC50s of 150.2 μM and 16.75 μM against trypomastigote and amastigote forms of L. amazonensis. Antiparasitic agent-16 induces parasite cell death through necrosis induction. Antiparasitic agent-16 induces morphological changes such as shortening, retraction and curvature of the parasite body and leakage of internal content with T. cruzi trypomastigotes.
  • HY-129550
    BI-4020

    		EGFR Cancer
    BI-4020 is a fourth-generation, orally active, and non-covalent EGFR tyrosine kinase inhibitor. BI-4020 inhibits not only the triple mutant EGFR del19 T790M C797S variant (IC50=0.2 nM in BaF3 cell lines) but also the double mutant EGFR del19 T790M and primary mutant EGFR del19 (IC50=1 nM). BI-4020 also shows activity against EGFR wt (IC50=190 nM). BI-4020 shows high kinome selectivity and good DMPK properties.
  • HY-N1957
    Gamma-Mangostin

    γ-Mangostin

    		 5-HT Receptor Metabolic Disease
    Gamma-Mangostin is a novel competitive 5-hydroxytryptamine 2A (5-HT2A) receptors antagonist, purified from the fruit hull of the medicinal plant Garcinia mangostana. Gamma-Mangostin is a inhibitor of Transthyretin (TTR) fibrillization, it binds to the thyroxine (T4)-binding sites and stabilized the TTR tetramer. Gamma-Mangostin inhibits [3 H] spiperone binding to cultured rat aortic myocytes (IC50=3.5 nM) and reduces The perfusion pressure response of rat coronary artery to 5-HT2A (IC50=0.32 µM) .
  • HY-149079
    Antiparasitic agent-15

    		Parasite Necroptosis Infection
    Antiparasitic agent-15, a pyridine-thiazolidinone, has anti-Trypanosoma cruzi and leishmanicidal activities. Antiparasitic agent-15 has IC50s of 0.9 μM and 0.64 μM against trypomastigote and amastigote forms of T. cruzi. Antiparasitic agent-15 has IC50s of 42.2 μM and 9.58 μM against trypomastigote and amastigote forms of L. amazonensis. Antiparasitic agent-15 induces parasite cell death through necrosis induction. Antiparasitic agent-15 induces morphological changes such as shortening, retraction and curvature of the parasite body and leakage of internal content with T. cruzi trypomastigotes.
  • HY-147257
    Cofrogliptin

    HSK7653

    		 Dipeptidyl Peptidase Metabolic Disease
    Cofrogliptin (HSK7653) (compound 2), a tetrahydropyran derivative, is a potent oral dipeptidyl aminopeptidase 4 (DPP-4) inhibitor with Long-acting antidiabetic efficacy. Cofrogliptin (compound 2) has a great potential for type 2 diabetes mellitus (T2DM) .
  • HY-115972
    Anti-Trypanosoma cruzi agent-2

    		Parasite Infection Inflammation/Immunology
    Anti-Trypanosoma cruzi agent-1 (Compd 3b), selective compound against NINOA trypomastigote (IC50 = 0.51 µM) and INC-5 epimastigote form (IC50 = 3.06 µM), posseses anti-T. gondii activity.
  • HY-Q40175
    Antitrypanosomal agent 9

    		Parasite Infection
    Antitrypanosomal agent 9 (compound 1) is a potent antitrypanosomal agent. Antitrypanosomal agent 9 shows inhibitory activity against T. b. brucei, with an IC50 of 1.15 μM. Antitrypanosomal agent 9 can be used for human African trypanosomiasis (HAT) research.
  • HY-138102
    SSAA09E3

    		SARS-CoV Infection
    SSAA09E3 is a SARS-CoV entry inhibitor that inhibits SARS/HIV pseudotyped virus entry with an EC50 of 9.7 μM in 293T cells and inhibits SARS-CoV infection of Vero cells with an EC50 of 0.15 μM.
  • HY-P99166
    Vudalimab

    		PD-1/PD-L1 CTLA-4 Interleukin Related Inflammation/Immunology
    Vudalimab is a potent dual PD-1 and CTLA-4 inhibitor as a fully humanized bispecific monoclonal antibody. Vudalimab targets immune checkpoint receptors PD-1 and CTLA-4 and promotes tumor-selective T-cell activation.
  • HY-12316
    20(S)-Hydroxycholesterol

    20α-Hydroxycholesterol

    		 Smo Endogenous Metabolite Cancer
    20(S)-hydroxyCholesterol (20α-Hydroxycholesterol) is an allosteric activator of the oncoprotein smoothened (Smo) that activates the hedgehog (Hh) signaling pathway with an EC50 of 3 μM in a gene transcription reporter assay using NIH3T3 cells.
  • HY-112870A
    Alflutinib mesylate

    Furmonertinib mesylate; AST2818 mesylate

    		 EGFR Cancer
    Alflutinib (Furmonertinib) mesylate is is a potent inhibitor of EGFR. Alflutinib (Furmonertinib) mesylate inhibits EGFR active mutations as well as the T790M acquired resistant mutation. Alflutinib (Furmonertinib) mesylate has the potential for the research of cancer diseases, especially non-small cell lung cancer (NSCLC).
  • HY-P1078A
    Huwentoxin XVI TFA

    		Calcium Channel Neurological Disease
    Huwentoxin XVI TFA, an analgesic, is a highly reversible and selective mammalian N-type calcium channel (IC50 of ~60 nM) antagonist from Chinese tarantula Ornithoctonus huwena. Huwentoxin XVI TFA has no effect on voltagegated T-type calcium channels, potassium channels or sodium channels.
  • HY-115481
    EphB1-IN-1

    		Others Others
    EphB1-IN-1 (Compound 1) is a potent EphB1 inhibitor with IC50s of 3.0, 15 and 220 nM against EphB1 G703C, EphB1 T697G and EphB1 WT, respectively.
  • HY-104026BS
    L-Kynurenine-13C10 sulfate

    		Aryl Hydrocarbon Receptor Endogenous Metabolite Inflammation/Immunology
    L-Kynurenine- 13C10 (sulfate) is the 13C labeled L-Kynurenine sulfate[1]. L-Kynurenine sulfate, an aryl hydrocarbon receptor (AHR)?agonist that activates AHR-directed, naive T cell polarization to the anti-inflammatory Treg phenotype[2].
  • HY-129578
    Asperphenamate

    		Autophagy Cathepsin Cancer Infection Inflammation/Immunology
    Asperphenamate, a fungal metabolite of Aspergillus flatiipes with anti-cancer effect, exhibits IC50 values of 92.3 μM, 96.5 μM and 97.9 μM in T47D, MDA-MB-231 and HL-60 cells, respectively.
  • HY-19815
    Olafertinib

    		EGFR Cancer
    Olafertinib is a third-generation EGFR TKI, with GI50 values of 5 nM (EGFR L858R/T790M), 10 nM (EGFR del19) and 689 nM (EGFR WT), respectively. Olafertinib has the potential for NSCLC research.
  • HY-N2230
    N-p-trans-Coumaroyltyramine

    		Cholinesterase (ChE) Parasite Infection Neurological Disease
    N-p-trans-Coumaroyltyramine is a cinnamoylphenethyl amide isolated from polygonum hyrcanicum, acts as an acetylcholinesterase (AChE) inhibitor with an an IC50 of 122 μM. N-p-trans-Coumaroyltyramine exhibits anti-trypanosomal activity with an IC50 of 13.3 µM for T. brucei rhodesiense.
  • HY-W010791
    Adenosine 5'-diphosphate sodium salt

    		Endogenous Metabolite Others
    Adenosine 5'-diphosphate (ADP) sodium salt is a nucleoside diphosphate, which is the product of ATP dephosphorylation by ATPases. Adenosine 5'-diphosphate sodium salt induces human platelet aggregation and inhibits stimulated adenylate cyclase by an action at P2T-purinoceptors.
  • HY-115492
    NSC668394

    		PKC Cancer
    NSC668394 is a potent ezrin (Thr567) phosphorylation inhibitor, with a Kd of 12.59 μM. NSC668394 inhibit ezrin T567 phosphorylation caused by PKCΙ primarily via their binding to ezrin. NSC668394 can be used to prevent tumor metastasis.
  • HY-P99521
    Vibecotamab

    XmAb14045

    		 CD3 Cancer
    Vibecotamab (XmAb14045) is a potent bispecific antibody against CD123 and CD3 that stimulates T cell-mediated targeted killing of CD123-expressing cells. Vibecotamab has antitumor activity and can be used in acute myeloid leukaemia studies.
  • HY-W010918
    Adenosine 5'-diphosphate

    Adenosine diphosphate; ADP

    		 Endogenous Metabolite Others
    Adenosine 5'-diphosphate (Adenosine diphosphate) is a nucleoside diphosphate. Adenosine 5'-diphosphate is the product of ATP dephosphorylation by ATPases. Adenosine 5'-diphosphate induces human platelet aggregation and inhibits stimulated adenylate cyclase by an action at P2T-purinoceptors.
  • HY-W046348
    22-(tert-Butoxy)-22-oxodocosanoic acid

    		ADC Linker PROTAC Linkers Cancer
    22-(tert-Butoxy)-22-oxodocosanoic acid is a non-cleavable?ADC linker?used in the synthesis of antibody-drug conjugates (ADCs). 22-(tert-Butoxy)-22-oxodocosanoic acid is also a alkyl chain-based PROTAC linker?that can be used in t
  • HY-123159
    AKI603

    		Aurora Kinase Cancer
    AKI603 is an inhibitor of Aurora kinase A (AurA), with an IC50 of 12.3 nM. AKI603 is developed to overcome resistance mediated by BCR-ABL-T315I mutation. AKI603 exhibits strong anti-proliferative activity in leukemic cells.
  • HY-N6734
    K-252b

    		PKC Infection
    K-252b, an indolocarbazole isolated from the actinomycete Nocardiopsis, is a PKC inhibitor. K-252b can be used to inhibit extracellular kinases of cells in culture because it can’t pass through cell membrane freely .
  • HY-10446
    Pralatrexate

    		Antifolate Apoptosis Cancer
    Pralatrexate is an antifolate and is a potent dihydrofolate reductasean (DHFR) inhibitor with a Ki of 13.4 pM. Pralatrexate is a substrate for folylpolyglutamate synthetase with improved cellular uptake and retention. Pralatrexate has antitumor activities and has the potential for relapsed/refractory T-cell lymphoma treatment.
  • HY-100214
    EAI001

    		EGFR Cancer
    EAI001 is a potent, selective mutant epidermal growth factor receptor (EGFR) allosteric inhibitor with an IC50 value of 24 nM for EGFR L858R/T790M. EAI001 can be used for research of cancer.
  • HY-N5142
    α-Terpineol

    		Bacterial Infection Inflammation/Immunology
    α-Terpineol is isolated from Eucalyptus globulus Labill, exhibits strong antimicrobial activity against periodontopathic and cariogenic bacteria. α-Terpineol possesses antifungal activity against T. mentagrophytes, and the activity might lead to irreversible cellular disruption.
  • HY-101522
    CHMFL-EGFR-202

    		EGFR BMX Kinase Btk MEK Cancer
    CHMFL-EGFR-202 is a potent, irreversible inhibitor of epidermal growth factor receptor (EGFR) mutant kinase, with IC50s of 5.3 nM and 8.3 nM for drug-resistant mutant EGFR T790M and WT EGFR kinases, respectively. CHMFL-EGFR-202 exhibits ～10-fold selectivity for EGFR L858R/T790M against the EGFR wild-type in cells. CHMFL-EGFR-202 adopts a covalent “DFG-in-C-helix-out” inactive binding conformation with EGFR, with strong antiproliferative effects against EGFR mutant-driven nonsmall-cell lung cancer (NSCLC) cell lines.
  • HY-N0226
    Epiberberine

    		Cholinesterase (ChE) Beta-secretase Metabolic Disease Neurological Disease
    Epiberberine is an alkaloid isolated from Coptis chinensis, acts as a potent AChE and BChE inhibitor, and a non-competitive BACE1 inhibitor, with IC50s of 1.07, 6.03 and 8.55 μM, respectively. Epiberberine has antioxidant activity, with peroxynitrite ONOO - scavenging effect (IC50, 16.83 μM), and can be used for the research of Alzheimer disease. Epiberberine inhibits the early stage of differentiation of 3T3-L1 preadipocytes, downregulates the Raf/MEK1/2/ERK1/2 and AMPKα/Akt pathways. Epiberberinecan be used for the research of diabetic disease.
  • HY-N0226A
    Epiberberine chloride

    		Cholinesterase (ChE) Beta-secretase Reactive Oxygen Species Metabolic Disease Neurological Disease
    Epiberberine chloride is an alkaloid isolated from Coptis chinensis, acts as a potent AChE and BChE inhibitor, and a non-competitive BACE1 inhibitor, with IC50s of 1.07, 6.03 and 8.55 μM, respectively. Epiberberine chloride has antioxidant activity, with peroxynitrite ONOO - scavenging effect (IC50, 16.83 μM), and may protect against Alzheimer disease. Epiberberine chloride inhibits the early stage of differentiation of 3T3-L1 preadipocytes, downregulates the Raf/MEK1/2/ERK1/2 and AMPKα/Akt pathways. Epiberberine has the potential effect in the research of diabetic disease.
  • HY-N6027
    Cyclosporin C

    		Fungal Bacterial Infection
    Cyclosporin C is a fungal metabolite that has been found in T. inflatum and has diverse biological activities, including antifungal, antiviral, and immunosuppressant properties. Cyclosporin C is active against isolates of B. cinerea, A. niger, and Alternaria, Mucor, and Penicillium species (MICs=0.1-5 μg/ml).
  • HY-145281
    MS98

    		PROTACs Akt Cancer
    MS98 is a potent and selective PROTAC AKT degrader. MS98 depletes cellular total AKT (T-AKT) with the DC50 value of 78 nM. MS98 binds to AKT1, AKT2, and AKT3 with Kds of 4 nM, 140 nM, and 8.1 nM, respectively.
  • HY-129529
    6-Hydroxyluteolin 7-glucoside

    		Others Inflammation/Immunology
    6-Hydroxyluteolin 7-glucoside is a flavonoid from Tanacetum parthenium and T. vulgare. 6-Hydroxyluteolin 7-glucoside inhibits the major pathways of arachidonate metabolism in leukocytes. 6-Hydroxyluteolin 7-glucoside has anti-inflammatory effect.
  • HY-P1052
    Myelin Basic Protein(87-99)

    		Others Inflammation/Immunology
    Myelin Basic Protein(87-99) is an encephalitogenic peptide that induces basic protein-specific T cell proliferation. Myelin Basic Protein(87-99) causes a Th1 polarization in peripheral blood mononuclear cells with is implicated of multiple sclerosis (MS).
  • HY-P2521
    NS2 (114-121), Influenza

    		Influenza Virus Infection Inflammation/Immunology
    NS2 (114-121), Influenza, the 114-121 fragment of influenza nonstructural protein 2 (NS2), is a influenza-derived epitope. NS2 (114-121), Influenza can be used for the research of CD8 + cytotoxic T lymphocyte (CTL) in antiviral immune responses.
  • HY-N0097A
    9-β-D-Arabinofuranosylguanine

    AraG

    		 Others Cancer
    9-β-D-Arabinofuranosylguanine is a Guanosine (HY-N0097) analog and shows high affinity for deoxyguanosine kinase (dGK) with a Km of 8.0 μM. 9-β-D-Arabinofuranosylguanine can be used for the research of T-cell lymphoblastic disease.
  • HY-139464
    Q134R

    		Nuclear Factor of activated T Cells (NFAT) Neurological Disease
    Q134R, a neuroprotective hydroxyquinoline derivative that suppresses nuclear factor of activated T cell (NFAT) signaling. Q134R can across blood-brain barrier. Q134R has the potential for Alzheimer's disease (AD) and aging-related disorders research.
  • HY-P1835
    CEF8, Influenza Virus NP (383-391)

    		Influenza Virus Inflammation/Immunology
    CEF8, Influenza Virus NP (383-391), an influenza A virus nucleoprotein containing residues 383 to 391, is the most important HLA-B *2705-restricted epitope in the nucleoprotein of influenza A viruses and is associated with escape from cytotoxic T lymphocytes-mediated immunity.
  • HY-112233
    O-304

    		AMPK Metabolic Disease Cardiovascular Disease
    O-304 is a first-in-class, orally available pan-AMPK activator, which increases AMPK activity by suppressing the dephosphorylation of pAMPK. O-304 exhibits a great potential as a agent to treat type 2 diabetes (T2D) and associated cardiovascular complications .
  • HY-137823
    4-Nitrophenyl-N-acetyl-β-D-galactosaminide

    		Endogenous Metabolite Cancer
    4-Nitrophenyl-N-acetyl-β-D-galactosaminide has inhibitory activity against GlcNAc and GalNAc with Kis of 1.15 mM and 0.51 mM, respectively. 4-Nitrophenyl-N-acetyl-β-D-galactosaminide is extracted from Trichomonas foetus (T. foetus)
  • HY-147857
    Antileishmanial agent-12

    		Parasite Infection
    Antileishmanial agent-12 (compound 5a) is a potent anti-leishmanial agent. Antileishmanial agent-12 shows antiprotozoal activity against Leishmania brazilensis, Leishmania infantum, and T. cruzi, with IC50 values of 14.9, 21.3 and 9.3 μM, respectively.
  • HY-N7819
    Pristane

    Norphytane

    		 Others Inflammation/Immunology
    Pristane (Norphytane) is a naturally occurring hydrocarbon oil found in small quantities in many plants, in various marine organisms, and as the most active component of mineral oil. Pristane is a non-antigenic adjuvant, and induces MHC class II-restricted, arthritogenic T cells in the rat.
  • HY-P1566
    MPG, HIV related

    		HIV Infection
    MPG, HIV related is 27-aa peptide, derived from both the nuclear localisation sequence of SV40 large T antigen and the fusion peptide domain of HIV-1 gp41 and is a potent delivery agent for the generalised delivery of nucleic acids and of oligonucleotides into cultured cells.
  • HY-N6857
    Armepavine

    		NF-κB Inflammation/Immunology
    Armepavine, an active compound from Nelumbo nucifera, exerts not only anti-inflammatory effects on human peripheral blood mononuclear cells, but also immunosuppressive effects on T lymphocytes and on lupus nephritic mice. Armepavine inhibits TNF-α-induced MAPK and NF-κB signaling cascades.
  • HY-P99836
    Cudarolimab

    IBI101

    		 Orexin Receptor (OX Receptor) Cancer Inflammation/Immunology
    Cudarolimab (IBI101) is a completely human anti-OX40 (CD134, a co stimulating molecule expressed by activated immune cells) antibody. Cudarolimab inhibits the binding of OX40 to its ligand OX40L. Cudarolimab has antitumor activity and can be used in cancer related research.
  • HY-146672
    ITK inhibitor 6

    		Itk Cancer
    ITK inhibitor 6 (compound 43) is a potent and selective ITK inhibitor with IC50s of 4 nM, 133 nM, 320 nM, 2360 nM, 155 nM for ITK, BTK, JAK3, EGFR, LCK, respectively. ITK inhibitor 6 inhibits phosphorylation of PLCγ1 and ERK1/2. ITK inhibitor 6 shows antiproliferative activities.
  • HY-151096
    ACT-660602

    		CXCR Inflammation/Immunology
    ACT-660602 is an orally active antagonist of chemokine receptor (CXCR3) with an IC50 value of 204 nM. ACT-660602 inhibits T-cell migration and shows efficacy in acute lung ingury model. ACT-660602 can be used for autoimmune diseases research.
  • HY-13232
    ITK antagonist

    		Itk Inflammation/Immunology
    ITK antagonist (compound 10 n) is a potent, orally active and selective ITK (Interleukin-2 inducible T-cell kinase) antagonist (IC50=1 and 20 nM in different assays). ITK antagonist inhibits insulin receptor kinase (IRK) with an IC50 of 160 nM.
  • HY-147856
    Antileishmanial agent-11

    		Parasite Infection
    Antileishmanial agent-11 (compound 4d) is a potent anti-leishmanial agent. Antileishmanial agent-11 shows antiprotozoal activity against Leishmania brazilensis, Leishmania infantum, and T. cruzi, with IC50 values of 28.3, 24.8 and 13.0 μM, respectively.
  • HY-126250
    NPD-1335

    		Phosphodiesterase (PDE) Parasite Infection Inflammation/Immunology
    NPD1335 is a Trypanosoma brucei phosphodiesterase B1 (TbrPDEB1) inhibitor with submicromolar activities against T. brucei parasites. NPD1335 displays a greatly improved cytotoxicity profile. NPD1335 increases intracellular cAMP levels and results in the distortion of the cell cycle and cell death.
  • HY-N3523
    3-O-Beta-D-Glucopyranosylplatycodigenin

    		Others Cancer
    3-O-Beta-D-Glucopyranosylplatycodigenin is an oleanane-type triterpenoid isolated from roots of Platycodon grandiflorum. 3-O-Beta-D-Glucopyranosylplatycodigenin exhibits anti-proliferative activities against HSC-T6 cell line with an IC50 of 13.36 μM.
  • HY-P99776
    Plamotamab

    XmAb-13676

    		 CD20 CD3 Cancer
    Plamotamab (XmAb-13676) is a human bispecific antibody (bsAb) that binds CD3 and CD20. Plamotamab recruits cytotoxic T cells to kill CD20 + expressing tumor cells. Plamotamab induces a mild hematologic reaction (MR), and results in tumor regression in vivo.
  • HY-139411
    White mineral oil

    		Biochemical Assay Reagents Others
    White mineral oil is the highly refined mineral oil, and is composed of saturated aliphatic and alicyclic nonpolar hydrocarbons. White mineral oil is biologically and chemically stable, and doesn’t support pathogenic bacterial growth. White mineral oil can resist moisture, extend, soften, smoothen, and lubricate.
  • HY-145282
    MS170

    		PROTACs Akt Cancer
    MS170 is a potent and selective PROTAC AKT degrader. MS170 depletes cellular total AKT (T-AKT) with the DC50 value of 32 nM. MS170 binds to AKT1, AKT2, and AKT3 with Kds of 1.3 nM, 77 nM, and 6.5 nM, respectively.
  • HY-108583
    Psora-4

    5-(4-Phenylbutoxy)psoralen

    		 Potassium Channel Inflammation/Immunology
    Psora-4 is a potent and selective inhibitor of Kv1.3 (voltage-gated potassium channels) with an EC50 of 3 nM. Psora-4 has immunosuppressive activity and inhibits proliferation of human and rat myelin-specific effector memory T cells in vitro.
  • HY-147826
    EGFR-IN-60

    		EGFR Apoptosis Cancer
    EGFR-IN-60 (Compound 7d) shows obvious inhibition of EGFR WT, EGFR T790M, EGFR L858R and JAK3 with IC50s of 83, 26, 53, and 69 nM, respectively. EGFR-IN-60 potently inhibits the growth of H1975 cells harboring EGFR T790M mutation (IC50=1.32 µM) over A431 cells overexpressing EGFR WT (IC50=4.96 µM). EGFR-IN-60 exhibits good oral absorption, potent and safe antitumor activity. EGFR-IN-60 induces cell death through apoptosis supported by increased Bax/Bcl-2 ratio.
  • HY-147862
    EGFR-IN-62

    		EGFR Apoptosis Cancer
    EGFR-IN-62 (compound 9h) is a potent and reversible EGFR kinase inhibitor, with IC50 values of 10 nM (L858R/T790 M), 29 nM (WT), and 242 nM (L858R/T790 M/C797S), respectively. EGFR-IN-62 shows antiproliferative activity against A549 and H1975 cell lines, with IC50 values of 2.53 and 1.56 μM, respectively. EGFR-IN-62 induces dose-dependent apoptosis process, G1/G0-phase arrestation, and the inhibition of motility on A549 and/or H1975 cell lines.
  • HY-N5072
    Desmethylglycitein

    4',6,7-Trihydroxyisoflavone

    		 CDK PI3K PKC Cancer
    Desmethylglycitein (4',6,7-Trihydroxyisoflavone), a metabolite of daidzein, sourced from Glycine max with antioxidant, and anti-cancer activities. Desmethylglycitein binds directly to CDK1 and CDK2 in vivo, resulting in the suppresses CDK1 and CDK2 activity. Desmethylglycitein is a direct inhibitor of protein kinase C (PKC)α, against solar UV (sUV)-induced matrix matrix metalloproteinase 1 (MMP1). Desmethylglycitein binds to PI3K in an ATP competitive manner in the cytosol, where it inhibits the activity of PI3K and downstream signaling cascades, leading to the suppression of adipogenesis in 3T3-L1 preadipocytes.
  • HY-146489
    Anti-infective agent 3

    		Bacterial Parasite Infection
    Anti-infective agent 3 (compound 3l) shows antiparasitic activity against P. falciparum and T. brucei rhodesiense, with IC50 values of 0.47 and 0.13 μM, respectively. Anti-infective agent 3 shows antimycobacterial activity against Mycobacterium smegmatis with a MIC of 4 μg/mL.
  • HY-134978A
    (+)SHIN2

    		Others Cancer
    (+)SHIN2 is a serine hydroxymethyltransferase (SHMT) inhibitor, whose target can be traced with 13C-serine. (+)SHIN2 increases survival in NOTCH1-driven mouse primary acute lymphoblastic leukemia (T-ALL) in vivo with a synergistic effect with Methotrexate (HY-14519).
  • HY-19779
    JTT 551

    		Phosphatase Metabolic Disease
    JTT 551 is selective a protein tyrosine phosphatase 1B (PTP1B) inhibitor, with Kis of 0.22 μM and 9.3 μM for PTP1B and TCPTP (T-cell protein tyrosine phosphatase), respectively; JTT 551 can be used in the research of type 2 diabetes mellitus.
  • HY-142679
    EGFR-IN-22

    		EGFR Cancer
    EGFR-IN-22 is a potent EGFR inhibitor with IC50s of 4.91 nM and 0.54 nM for wild type EGFR and EGFR L858R/T790M/C797S, respectively (CN112538072A, compound 243).
  • HY-N6615
    Aflatoxin B1

    		Bacterial Endogenous Metabolite Parasite Cancer Infection
    Aflatoxin B1 (AFB1) is a Class 1A carcinogen, which is a secondary metabolite of Aspergillus flavus and A. parasiticus. Aflatoxin B1 (AFB1) mainly induces the transversion of G-->T in the third position of codon 249 of the p53 tumor suppressor gene, resulting in mutation.
  • HY-P99802
    Pasotuxizumab

    BAY 2010112; AMG 212

    		 CD3 Cancer
    Pasotuxizumab (BAY 2010112) is a PSMA and CD3 bispecific T-cell engager (BiTE). Pasotuxizumab binds to CD3 and PSMA with KDs of 9.4 nM and 47.0 nM for human CD3 and PSMA. Pasotuxizumab can be used for research of metastatic castration-resistant prostate cancer (mCRPC).
  • HY-108741
    Plecanatide

    		Guanylate Cyclase Inflammation/Immunology
    Plecanatide, an analogue of Uroguanylin, is an orally active guanylate cyclase-C (GC-C) receptor agonist. Plecanatide activates GC-C receptors to stimulate cGMP synthesis with an EC50 of 190 nM in T84 cells assay. Plecanatide shows anti-inflammatory activity in models of murine colitis.
  • HY-146488
    Anti-infective agent 2

    		Parasite Bacterial Infection
    Anti-infective agent 2 (compound 3k) shows antiparasitic activity against P. falciparum and T. brucei rhodesiense, with IC50 values of 0.07 and 2.20 μM, respectively. Anti-infective agent 2 shows antimycobacterial activity against Mycobacterium smegmatis with a MIC of 32 μg/mL.
  • HY-N7119
    Cimicifugoside

    		Others Inflammation/Immunology
    Cimicifugoside, a triterpenoid isolated from Cimicifuga simplex, is a novel specific nucleoside transport inhibitor that displays synergistic potentiation of methotrexate cytotoxicity. Cimicifugoside shows immunosuppressive activity, which is preferentially directed toward B-cell function with larger doses being required for suppression of T-cell function.
  • HY-18959
    CWP232228

    		β-catenin Wnt Cancer
    CWP232228, a highly potent selective Wnt/β-catenin signaling inhibitor, antagonizes binding of β-catenin to T-cell factor (TCF) in the nucleus. CWP232228 suppresses tumor formation and metastasis without toxicity through the inhibition of the growth of breast and liver cancer stem cells (CSCs).
  • HY-P99056
    Utomilumab

    PF 05082566

    		 TNF Receptor Cancer Inflammation/Immunology
    Utomilumab (PF 05082566) is a fully human IgG2 mAb agonist of the T-cell costimulatory receptor 4-1BB/CD137. Utomilumab can be used for the research of relapsed/refractory follicular lymphoma (FL) and other CD20 + non-Hodgkin lymphomas (NHL).
  • HY-B0999
    Chlorindanol

    Clorindanol; 7-Chloro-4-indanol

    		 Bacterial Infection
    Chlorindanol (7-Chloro-4-indanol) is a topical antiseptic or sanitizer. Chlorindanol is rapidly lethal to vegetative bacteria, Trichophyton sp., C. albicans, E. histolytica cysts and trophozoites, T. vaginalis, and spermatozoa in vitro. Chlorindanol is klow systemic toxicity, well skin/eyes/genital mucosa tolerance and nonallergenic.
  • HY-136909
    SR33805

    		Calcium Channel Cardiovascular Disease
    SR33805 is a potent Ca 2+ channel antagonist, with EC50s of 4.1 nM and 33 nM in depolarized and polarized conditions, respectively. SR33805 blocks L-type but not T-type Ca 2+ channels. SR33805 can be used for the research of acute or chronic failing hearts.
  • HY-P99714
    Lorigerlimab

    MGD019

    		 PD-1/PD-L1 CTLA-4 Cancer
    Lorigerlimab (MGD019) is a bispecific IgG4 dual-affinity re-targeting antibody (DART). Lorigerlimab can block PD-1 and CTLA-4, and improves T-cell responses. Lorigerlimab can be used for research of metastatic castration-resistant prostate cancer (mCRPC).
  • HY-W127497
    Methyl 12-Methyltetradecanoate

    		Biochemical Assay Reagents Others
    Methyl 12-Methyltetradecanoate is a methylated fatty acid methyl ester that has been found in vermicompost of cow dung, papaya leaves, and cuticle wax of K. africana. It is a volatile compound in lipid-reducing granule tea. The levels of methyl 12-methylmyristate were reduced in T. cruzi treated with nifurtimox compared to untreated controls.
  • HY-15888
    PTC-209

    		Autophagy Cancer
    PTC-209 is a specific BMI-1 inhibitor with an IC50 of 0.5 μM in HEK293T cell line. PTC-209 irreversibly impairs colorectal cancer-initiating cells (CICs). PTC-209 shows potent anti-myeloma activity and impairs the tumor microenvironment.
  • HY-153342
    ARV-766

    		PROTACs Androgen Receptor Cancer
    ARV-766 is an orally active and potent proteolysis targeting chimera (PROTAC) protein degrader. ARV-766 degrades wild-type androgen receptor (AR) but also relevant AR LBD mutants, including the most prevalent AR L702H, H875Y, and T878A mutations.
  • HY-P99757
    Nivatrotamab

    Hu3F8-BsAb

    		 CD2 CD3 Cancer
    Nivatrotamab (Hu3F8-BsAb) is a humanized anti-GD2/CD3 bispecific antibody. Nivatrotamab is a CD3- and GD2-specific bsAb-based T-cell engager. Nivatrotamab can be used in research of neuroblastoma.
  • HY-147638
    MONIRO-1

    		Calcium Channel Neurological Disease
    MONIRO-1 is a T-type and N-type calcium channel blocker with IC50 values of 34, 3.3, 1.7 and 7.2 µM against hCav2.2, hCav3.1, hCav3.2 and hCav3.3, respectively.
  • HY-W052512
    Antitrypanosomal agent 1

    		Parasite Infection
    Antitrypanosomal agent 1 is a potent and selective trypanothione reductase (TR) inhibitor with an IC50 of 3.3 μM. Antitrypanosomal agent 1 inhibits glutathione reductase (GR) (IC50=64.8 μM) and T. brucei (EC50=1 μM). Antitrypanosomal agent 1 has anti-trypanosomal activity.
  • HY-W009245
    Bz-RS-iSer(3-Ph)-OMe

    		HIV Infection
    Bz-RS-iSer(3-Ph)-OMe (compound 2), a Taxol derivative, inhibits HSV replication cycle at low cytotoxicity, blocks mitotic divisions of Vero cells, influences M-MSV induced tumor size and affects immune response by inhibiting PHA-induced T lymphocyte proliferation.
  • HY-12753A
    Debutyldronedarone hydrochloride

    SR35021 hydrochloride

    		 Thyroid Hormone Receptor Cardiovascular Disease
    Debutyldronedarone (SR35021) hydrochloride, the main metabolite of Dronedarone, is a selective thyroid hormone receptor α1 (TRα1) inhibitor. Debutyldronedarone hydrochloride inhibits T3 binding to TRα1 and TRβ1 by 77% and 25%, respectively. Debutyldronedarone hydrochloride can be used for the research of arrhythmic.
  • HY-N7776
    7-Xylosyl-10-Deacetyltaxol B

    7-xylosyl-10-Deacetylpaclitaxel B

    		 Others Cancer
    7-Xylosyl-10-Deacetyltaxol B (7-xylosyl-10-Deacetylpaclitaxel B) is a paclitaxel derivative derived from T. cuspidate. 7-Xylosyl-10-Deacetyltaxol B has anti-tumor activity and inhibits the growth of S180 sarcoma.
  • HY-138751
    limertinib

    ASK120067

    		 EGFR Cancer
    limertinib (ASK120067) is a potent and orally active inhibitor of EGFR T790M (IC50:0.3 nM) with selectivity over EGFR WT (IC50:6.0 nM). limertinib is a third-generation EGFR-TKI for the research of non-small cell lung cancer (NSCLC).
  • HY-151195
    20S Proteasome-IN-4

    		Proteasome Parasite Infection
    20S Proteasome-IN-4 (Compound 7) is a brain-penetrant, parasite-selective, orally active 20S proteasome inhibitor with an IC50 of 6.3 nM against T. b. brucei 20S proteasome. 20S Proteasome-IN-4 can be used for the research of human African trypanosomiasis (HAT).
  • HY-10261S1
    Afatinib-d4

    BIBW 2992-d4

    		 EGFR Autophagy Cancer
    Afatinib-d4 is the deuterium labeled Afatinib. Afatinib (BIBW 2992) is an irreversible EGFR family inhibitor with IC50s of 0.5 nM, 0.4 nM, 10 nM and 14 nM for EGFRwt, EGFRL858R, EGFRL858R/T790M and HER2, respectively.
  • HY-N7777
    7-Xylosyl-10-Deacetyltaxol C

    7-Xylosyl-10-Deacetylpaclitaxel C