1. Search Result
Search Result
Results for "

chronic

" in MCE Product Catalog:

451

Inhibitors & Agonists

14

Screening Libraries

18

Peptides

21

Inhibitory Antibodies

32

Natural
Products

1

Recombinant Proteins

56

Isotope-Labeled Compounds

Cat. No. Product Name Target Research Areas
  • HY-152036
    SIAIS100

    PROTACs Bcr-Abl Cancer
    SIAIS100 is a potent BCR-ABL PROTAC degrader with an DC50 value of 2.7 nM. SIAIS100 can be used to research chronic myeloid leukemia (CML).
  • HY-B0944
    Pidotimod

    Bacterial Inflammation/Immunology
    Pidotimod is an orally active dipeptide immunostimulant with immunomodulatory properties on the adaptive and the innate immune responses. Pidotimod increases macrophage activity and humoral immune functions. Pidotimod can be used for the research of chronic bronchitis, chronic obstructive pulmonary disease (COPD), bronchiectasis, and chronic idiopathic urticaria,et al.
  • HY-121851
    Revaprazan

    SB 641257

    Proton Pump Inflammation/Immunology
    Revaprazan (SB 641257) is a reversible proton pump inhibitor with significant anti-inflammatory effects. Revaprazan can be used for chronic gastric inflammation research.
  • HY-109170
    Eliapixant

    BAY 1817080

    P2X Receptor Inflammation/Immunology
    Eliapixant (BAY 1817080) is a potent and selective antagonist of P2X3 receptor, with an IC50 of 8 nM. Eliapixant can be used for the research of refractory chronic cough.
  • HY-W018791
    Bifendate

    DDB

    HBV Infection
    Bifendate (DDB) is a synthetic intermediate of Schisandrin C with anti-HBV efficacy in research of chronic hepatitis B.
  • HY-121513
    Torcitabine

    2'-Deoxy-L-cytidine; L-dC

    HBV Infection
    Torcitabine (2'-Deoxy-L-cytidine) is an antiviral agent. Torcitabine has the potential for chronic hepatitis B virus infection treatment.
  • HY-B2077
    Enviomycin

    Tuberactinomycin N

    Bacterial Antibiotic Infection
    Enviomycin (Tuberactinomycin N) is a antibacterial antibiotic. Enviomycin has been used to research chronic cavitary pulmonary tuberculosis.
  • HY-D0205A
    Carbocisteine

    S-(Carboxymethyl)-L-cysteine

    Enterovirus Infection Inflammation/Immunology
    Carbocisteine, a mucolytic agent, can be used for the research of chronic obstructive pulmonary disease (COPD).
  • HY-13995A
    Sevelamer hydrochloride

    FXR Autophagy Others
    Sevelamer hydrochloride is an orally active and phosphate binding agent used for research of hyperphosphatemia with chronic kidney disease. Sevelamer hydrochloride consists of polyallylamine that is crosslinked with epichlorohydrin.
  • HY-128901
    F 13714 fumarate

    F 14679 fumarate

    5-HT Receptor Neurological Disease
    F13714 fumarate, a selective 5-HT1A receptor biased agonist, shows antidepressant-like properties after a single administration in the mouse model of chronic mild stress.
  • HY-100657
    meta-Fexofenadine

    meta-MDL-16455; meta-Terfenadine carboxylate

    Others Inflammation/Immunology
    meta-Fexofenadine (meta-MDL-16455) is an impurity of Fexofenadine. Fexofenadine, a H1R antagonist, is an anti-allergic agent used in seasonal allergic rhinitis and chronic idiopathic urticarial.
  • HY-144745
    HSR1304

    NF-κB Cancer
    HSR1304 (Compound 5d) is a potent inhibitor of NFκB. The multifunctional transcription factor, nuclear factor-κB (NF-κB), is broadly involved in multiple human diseases, such as cancer and chronic inflammation. HSR1304 has the potential for the research of cancer diseases.
  • HY-120441
    CAY10590

    GK115

    Phospholipase Prostaglandin Receptor Inflammation/Immunology
    CAY10590 (GK115) is an inhibitor of secreted phospholipase A2 (sPLA2) and can be used for the research of chronic inflammatory kidney diseases.
  • HY-15545
    AZD-4818

    CCR Endocrinology Inflammation/Immunology Neurological Disease
    AZD-4818 is a potent antagonist of chemokine CCR1. AZD-4818 can be used for researching chronic obstructive pulmonary disease (COPD) .
  • HY-N10664
    Piperlactam S

    Others Cancer Infection Inflammation/Immunology
    Piperlactam S is an active compound. Piperlactam S can be isolated from Piper kadsura. Piperlactam S can be used for the research of chronic inflammation.
  • HY-144401
    DS-3801b

    Motilin Receptor Metabolic Disease
    DS-3801b is a potent and non-macrolide agonist of GPR38. DS-3801b is expected to be novel gastrointestinal prokinetic agents for the research of functional gastrointestinal disorders such as gastroparesis and chronic constipation.
  • HY-B0629
    Mometasone

    Glucocorticoid Receptor Metabolic Disease
    Mometasone is an inhaled glucocorticoid. Mometasone can be used in mild asthma with a low sputum eosinophil level. Mometasone has the potential for the research of chronic hand eczema and rhinosinusitis.
  • HY-141411A
    Zevaquenabant

    (S)-MRI-1867

    Cannabinoid Receptor NO Synthase Metabolic Disease
    Zevaquenabant ((S)-MRI-1867) is a peripherally restricted, orally bioavailable dual cannabinoid CB1 receptor and inducible NOS (iNOS) antagonist. Zevaquenabant ameliorates obesity-induced chronic kidney disease (CKD).
  • HY-B0801A
    Fexofenadine hydrochloride

    MDL-16455 hydrochloride; Terfenadine carboxylate hydrochloride

    Histamine Receptor Inflammation/Immunology
    Fexofenadine (MDL-16455) hydrochloride is an orally active and nonsedative H1 receptor antagonist. Fexofenadine hydrochloride can be used in allergic rhinitis and chronic idiopathic urticarial research.
  • HY-B0801
    Fexofenadine

    MDL-16455; Terfenadine carboxylate

    Histamine Receptor Inflammation/Immunology
    Fexofenadine (MDL-16455) is an orally active and nonsedative H1 receptor antagonist. Fexofenadine can be used in allergic rhinitis and chronic idiopathic urticarial research.
  • HY-19830
    AN3199

    Phosphodiesterase (PDE) Inflammation/Immunology
    AN3199 is a PDE4 inhibitor with an IC50 of 94.5 nM. AN3199 can be used for the research of inflammation-associated diseases such as asthma and chronic obstructive pulmonary disease (COPD).
  • HY-126179
    Fenquizone

    MG-13054

    Others Cardiovascular Disease Metabolic Disease
    Fenquizone (MG-13054), a thiazide-like diuretic, exhibits chronic antihypertensive effect. Fenquizone (MG-13054) is orally acitve. Fenquizone can be used for the research of oedema and hypertension.
  • HY-132265
    SCO-267

    Free Fatty Acid Receptor Metabolic Disease
    SCO-267 is an allosteric GPR40 full agonist. SCO-267 can be used for the research of chronic diseases including diabetes.
  • HY-117411A
    Coblopasvir dihydrochloride

    KW-136 dihydrochloride

    HCV HCV Protease Infection
    Coblopasvir (KW-136) dihydrochloride is a pangenotypic non-structural protein 5A (NS5A) inhibitor. Coblopasvir dihydrochloride can be used for research of chronic hepatitis C virus infection.
  • HY-117411
    Coblopasvir

    KW-136

    HCV HCV Protease Infection Inflammation/Immunology
    Coblopasvir (KW-136) is a pangenotypic non-structural protein 5A (NS5A) inhibitor. Coblopasvir can be used for research of chronic hepatitis C virus infection.
  • HY-101277
    Vadadustat

    PG-1016548; AKB-6548

    HIF/HIF Prolyl-Hydroxylase Cardiovascular Disease
    Vadadustat (PG-1016548) is a titratable, oral hypoxia-inducible factor prolyl hydroxylase (HIF-PH) inhibitor. Vadadustat is an erythropoiesis-stimulating agent and has the potential for anemia treatment in chronic kidney disease in vivo.
  • HY-147217
    Bepirovirsen

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
  • HY-145713
    HBV-IN-19

    HBV Infection
    HBV-IN-19 inhibits hepatitis B virus (HBV) infection. Inhibiting HBsAg secretion and/or production is a strategy for the treatment of HBV infection, including chronic HBV infection.
  • HY-111547
    M1001

    HIF/HIF Prolyl-Hydroxylase Cancer
    M1001 is a weak hypoxia-inducible factor-2α (HIF-2α) agonist. M1001 can bind to the HIF-2α PAS-B domain, with a Kd of 667 nM. M1001 can be used in chronic kidney disease research.
  • HY-147132
    GluR6 antagonist-1

    iGluR Neurological Disease
    GluR6 antagonist-1 is a benzothiophene derivative, acting as a GluR6 antagonist. GluR6 antagonist-1 can be used for researching acute and chronic neurological disorders.
  • HY-145713A
    HBV-IN-19 TFA

    HBV Infection
    HBV-IN-19 TFA inhibits hepatitis B virus (HBV) infection. Inhibiting HBsAg secretion and/or production is a strategy for the treatment of HBV infection, including chronic HBV infection.
  • HY-103595
    Epirizole

    Mepirizole; DA-398

    Others Inflammation/Immunology
    Epirizole (Mepirizole) is an orally active NSAID (nonsteroidal anti-inflammatory drug). Epirizole shows anti-inflammatory activity, and can be used in chronic rheumatoid arthritis research.
  • HY-143721
    SSAO inhibitor-2

    Monoamine Oxidase Metabolic Disease Cardiovascular Disease Inflammation/Immunology
    SSAO inhibitor-2 (Compound 1) is a semicarbazide-sensitive amine oxidase (SSAO) inhibitor with IC50s of <10 nM, and 10-100 μM for human SSAO and MAO-A, respectively. SSAO inhibitor-3 can be used for the research of atherosclerosis, diabetes and its complications, obesity, stroke, chronic kidney disease, retinopathy, chronic obstructive pulmonary disease (COPD), autoimmune diseases, multiple sclerosis, etc.
  • HY-103550
    A-841720

    mGluR Neurological Disease
    A-841720 is a potent, non-competitive and selective mGlu1 receptor antagonist with an IC50 of 10 nM for human mGlu1 receptor. A-841720 displays 34-fold selectivity over mGlu5 (IC50 of 342 nM), and no significant activity at a range of other neurotransmitter receptors, ion channels, and transporters. A-841720 has the potential for chronic pain research.
  • HY-N1830
    3-Epiwilsonine

    Others Cancer
    3-Epiwilsonine is an alkaloid from Cephalotaxus wilsoniana, exhibits effect on acute and chronic myeloid leukemia and malignant lymphoma.
  • HY-143723
    SSAO inhibitor-3

    Monoamine Oxidase Metabolic Disease Cardiovascular Disease Inflammation/Immunology
    SSAO inhibitor-3 (Compound 2) is a semicarbazide-sensitive amine oxidase (SSAO) inhibitor with IC50s of <10 nM, and 0.1-10 μM for human SSAO and AOC1, respectively. SSAO inhibitor-3 can be used for the research of atherosclerosis, diabetes and its complications, obesity, stroke, chronic kidney disease, retinopathy, chronic obstructive pulmonary disease (COPD), autoimmune diseases, multiple sclerosis, etc.
  • HY-103033
    T.cruzi-IN-1

    Parasite Infection
    T.cruzi-IN-1 is a potent Trypanosoma cruzi inhibitor with an IC50 of 8 nM. T.cruzi-IN-1, a 4-trifluoromethyl substituted analog, has the potential for both the acute and chronic stages of Chagas disease.
  • HY-P99442
    Apolizumab

    Hu1D10

    Apoptosis Inflammation/Immunology
    Apolizumab (Hu1D10) is a humanized monoclonal anti-Human leukocyte antigen-DR beta-chain antibody. Apolizumab can mediate apoptosis of chronic lymphocytic leukemia (CLL) cells in vitro.
  • HY-70069
    GSK256066 Trifluoroacetate

    Phosphodiesterase (PDE) Inflammation/Immunology
    GSK256066 Trifluoroacetate is a selective and high-affinity phosphodiesterase 4 (PDE) inhibitor, with an IC50 of 3.2 pM for PDE4B. GSK256066 Trifluoroacetate is developed for the research of chronic obstructive pulmonary disease.
  • HY-118355
    ALLM

    Calpain inhibitor II

    Proteasome Cathepsin Neurological Disease
    ALLM (Calpain inhibitor II) is a potent inhibitor of calpain and cathepsin proteases. ALLM inhibits neuronal cell death and improves chronic neurological function after spinal cord injury (SCI).
  • HY-N1428C
    Ferric citrate

    Iron(III) citrate; Zerenex

    Antibiotic Reactive Oxygen Species Metabolic Disease
    Ferric citrate (Iron(III) citrate), an orally active iron supplement, is an efficacious phosphate binder. Ferric citratee can be used for iron deficiency anemia and chronic kidney disease (CKD) research.
  • HY-13512
    Camostat mesylate

    Camostat mesilate; FOY305; FOY-S980

    Ser/Thr Protease SARS-CoV Infection Inflammation/Immunology
    Camostat mesylate (Camostat mesilate) is an orally active, synthetic serine protease inhibitor for chronic pancreatitis. Camostat mesylate, an inhibitor of TMPRSS2, shows antiviral activity against SARS-CoV-2. Camostat mesylate also inhibits the activity of prostasin, trypsin, and matriptase.
  • HY-115494
    Neladenoson dalanate hydrochloride

    Neladenoson bialanate hydrochloride; BAY-1067197 hydrochloride

    Adenosine Receptor Cardiovascular Disease
    Neladenoson dalanate (Neladenoson bialanate; BAY-1067197) hydrochloride is a orally active agonist precursor of partial Adenosine A1 Receptor. Neladenoson dalanate hydrochloride has a good pharmacokinetic and safety profile, can be used for the chronic heart diseases.
  • HY-P99452
    Axatilimab

    SNDX-6352

    c-Fms Cancer Inflammation/Immunology
    Axatilimab (SNDX-6352) is a humanized IgG4 antibody with high affinity to CSF-1R. Axatilimab can be used for the research of chronic graft versus host disease (cGVHD) and neoplastic diseases.
  • HY-P99462
    Barzolvolimab

    CDX 0159

    c-Kit Inflammation/Immunology
    Barzolvolimab (CDX 0159) is a humanized anti-KIT IgG1 monoclonal antibody. Barzolvolimab specificity and potently inhibits KIT activation by SCF. Barzolvolimab can reduce skin mast cells and disease activity in chronic inducible urticaria.
  • HY-123353
    Neladenoson dalanate

    Neladenoson bialanate; BAY-1067197

    Adenosine Receptor Cardiovascular Disease
    Neladenoson dalanate (Neladenoson bialanate; BAY-1067197) is a orally active agonist precursor of partial Adenosine A1 Receptor. Neladenoson dalanate has a good pharmacokinetic and safety profile, can be used for the chronic heart diseases.
  • HY-P3761
    Ac-Tyr-Val-Lys-Asp-aldehyde

    Caspase Others
    Ac-Tyr-Val-Lys-Asp-aldehyde is a caspase-1 inhibitor, can be used for disease research including anemia-associated to chronic diseases, chemotherapy-induced anemia and Diamond-Blackfan anemia.
  • HY-N10368
    Shinjulactone M

    Others Infection Inflammation/Immunology Neurological Disease
    Shinjulactone M is a quassinoid isolated from various parts of Ailanthus species. Ailanthus, an important genus of the Simaroubaceae family, can be used as an febrifuge (antimalarial) and anthelmintic, and is given for the research of chronic bronchitis, epilepsy and asthma.
  • HY-10469
    GSK256066

    Phosphodiesterase (PDE) Inflammation/Immunology
    GSK256066 is a selective and high-affinity phosphodiesterase 4 (PDE4) inhibitor, with an IC50 of 3.2 pM for PDE4B. GSK256066 is developed for the research of chronic obstructive pulmonary disease.
  • HY-17609
    Difelikefalin

    CR-845; FE-202845

    Opioid Receptor Neurological Disease
    Difelikefalin (CR-845; FE-202845) is a peripherally restricted and selective agonist of kappa opioid receptor (KOR). Difelikefalin produces anti-inflammatory effects and has the potential in modulating pruritus in conditions such as chronic kidney disease.
  • HY-66011
    Moxifloxacin Hydrochloride

    BAY 12-8039

    Bacterial Antibiotic Infection Cancer
    Moxifloxacin Hydrochloride (BAY 12-8039) is an oral 8-methoxyquinolone antimicrobial for use in the treatment of acute bacterial sinusitis, acute bacterial exacerbations of chronic bronchitis, and community-acquired pneumonia.
  • HY-112726
    PXS-4728A

    BI-1467335

    Monoamine Oxidase Inflammation/Immunology
    PXS-4728A (BI-1467335) is a selective, orally active inhibitor of semicarbazide-sensitive amine oxidase (SSAO). PXS-4728A ameliorates chronic obstructive pulmonary disease in mice.
  • HY-P99541
    Tuvirumab

    anti-hepatitis B; OST 577; SDZ-OST 577

    HBV Infection
    Tuvirumab (OST 577; SDZ-OST 577) is a human IgG1 subclass monoclonal antibody directed against HBV surface antigen (HBsAg). Tuvirumab binds specifically and with high affinity (K=3.6 nM) to HBsAg. Tuvirumab has the potential for chronic hepatitis B research.
  • HY-17638
    Mizagliflozin

    DSP-3235 free base; KGA-3235 free base; GSK-1614235 free base

    SGLT Metabolic Disease
    Mizagliflozin (DSP-3235 free base) is a potent, orally active and selective SGLT1 inhibitor, with a Ki of 27 nM for human SGLT1. Mizagliflozin displays 303-fold selectivity over SGLT2. Mizagliflozin is used as an antidiabetic drug that can modify postprandial blood glucose excursion. Mizagliflozin also exhibits potential in the amelioration of chronic constipation.
  • HY-137460
    Vodobatinib

    K0706

    Bcr-Abl Cancer
    Vodobatinib (K0706) is a potent, third generation and orally active Bcr-Abl1 tyrosine kinase inhibitor with an IC50 of 7 nM. Vodobatinib exhibits activity against most BCR-ABL1 point mutants, and has no activity against BCR-ABL1T315I. Vodobatinib can be used for chronic myeloid leukemia (CML) research.
  • HY-13739
    Ranimustine

    MCNU

    DNA Alkylator/Crosslinker Cancer
    Ranimustine (MCNU) is a nitrosourea alkylating agent, can be used for research of chronic myelogenous leukemia and polycythemia vera.
  • HY-147301
    Resomelagon

    AP1189

    Melanocortin Receptor Metabolic Disease Inflammation/Immunology
    Resomelagon (AP1189) is a potent, orally active melanocortin receptor (MR) agonist about MC1 and MC3. Resomelagon induces ERK1/2 phosphorylation and Ca 2+ mobilization. Resomelagon has anti-inflammatory activity. Resomelagon can be used for obesity and chronic inflammation research.
  • HY-120274
    Balcinrenone

    AZD9977

    Mineralocorticoid Receptor Metabolic Disease Cardiovascular Disease
    Balcinrenone (AZD9977) is a potent, selective, and orally active mineralocorticoid receptor (MR) modulator. Balcinrenone is used for heart failure, and chronic kidney disease research.
  • HY-B1332
    Ipratropium bromide hydrate

    Sch 1000 bromide hydrate

    mAChR Inflammation/Immunology Neurological Disease
    Ipratropium bromide (Sch 1000) hydrate is a muscarinic receptor antagonist, with IC50s of 2.9 nM, 2 nM, and 1.7 nM for M1, M2, and M3 receptors, respectively. Ipratropium bromide hydrate relaxes smooth muscle, can be used in the research for COPD (chronic obstructive pulmonary disease) and asthma.
  • HY-B0241
    Ipratropium bromide

    Sch 1000

    mAChR Inflammation/Immunology Neurological Disease
    Ipratropium bromide (Sch 1000) is a muscarinic receptor antagonist, with IC50s of 2.9 nM, 2 nM, and 1.7 nM for M1, M2, and M3 receptors, respectively. Ipratropium bromide relaxes smooth muscle, can be used in the research for COPD (chronic obstructive pulmonary disease) and asthma.
  • HY-19589
    JTS-653

    TRP Channel Inflammation/Immunology Neurological Disease
    JTS-653 is a highly potent and selective transient receptor potential vanilloid 1 (TRPV1) antagonist in vitro and in vivo. JTS-653 attenuates chronic pain refractory to non-steroidal anti-inflammatory agents.
  • HY-110237
    BX430

    P2X Receptor Calcium Channel Cardiovascular Disease
    BX430 is a potent and selective noncompetitive allosteric human P2X4 receptor channels antagonist with an IC50 of 0.54 μM. BX430 has species specificity. BX430 is used for chronic pain and cardiovascular disease.
  • HY-108449
    WS-12

    AR-15512; AVX-012

    TRP Channel Cancer
    WS-12 (AR-15512) is a potent and selective TRPM8 agonist, the menthol derivative, as a cooling agent. WS-12 shows analgesic effect, and can be used in chronic neuropathic pain research.
  • HY-139066
    Punicic acid

    Trichosanic acid

    Others Metabolic Disease
    Punicic acid is a bioactive compound of pomegranate seed oil. Punicic acid is an isomer of conjugated α-linolenic acid and a ω-5 polyunsaturated fatty acid. Punicic acid has the potential for the research of various chronic diseases.
  • HY-16981
    SB-332235

    CXCR Inflammation/Immunology
    SB-332235 is a potent, orally active nonpeptide CXCR2 antagonist, with an IC50 of 7.7 nM. SB-332235 displays 285-fold selectivity for CXCR2 over CXCR1. SB-332235 inhibits acute and chronic models of arthritis in the rabbit. SB-332235 inhibits viability of AML cells.
  • HY-108741A
    Plecanatide acetate

    Guanylate Cyclase Inflammation/Immunology
    Plecanatide acetate, an analogue of Uroguanylin, is an orally active guanylate cyclase-C (GC-C) receptor agonist. Plecanatide acetate activates GC-C receptors to stimulate cGMP synthesis with an EC50 of 190 nM in T84 cells assay. Plecanatide acetate can be used for the research of chronic idiopathic constipation, and it also shows anti-inflammatory activity in models of murine colitis.
  • HY-B0330
    Levofloxacin

    (-)-Ofloxacin

    Topoisomerase DNA/RNA Synthesis Antibiotic Bacterial Orthopoxvirus Infection Cancer
    Levofloxacin ((-)-Ofloxacin) is an orally active antibiotic and is active against both Gram-positive and Gram-negative bacteria. Levofloxacin inhibits the DNA gyrase and topoisomerase IV. Levofloxacin can be used for chronic periodontitis, airway inflammation and BK Viremia research. Levofloxacin shows anti-orthopoxvirus activity.
  • HY-B0330A
    Levofloxacin hydrate

    Levofloxacin hemihydrate

    Bacterial Antibiotic Topoisomerase DNA/RNA Synthesis Orthopoxvirus Infection Cancer
    Levofloxacin hydrate (Levofloxacin hemihydrate) is an orally active antibiotic and is active against both Gram-positive and Gram-negative bacteria. Levofloxacin hydrate inhibits the DNA gyrase and topoisomerase IV. Levofloxacin hydrate can be used for chronic periodontitis, airway inflammation and BK Viremia research. Levofloxacin hydrate shows anti-orthopoxvirus activity.
  • HY-B0330C
    Levofloxacin sodium

    (-)-Ofloxacin sodium

    Antibiotic Orthopoxvirus Bacterial DNA/RNA Synthesis Topoisomerase Infection Inflammation/Immunology
    Levofloxacin ((-)-Ofloxacin) sodium is an orally active antibiotic and is active against both Gram-positive and Gram-negative bacteria. Levofloxacin sodium inhibits the DNA gyrase and topoisomerase IV. Levofloxacin sodium can be used for chronic periodontitis, airway inflammation and BK Viremia research. Levofloxacin sodium shows anti-orthopoxvirus activity.
  • HY-B0330B
    Levofloxacin hydrochloride

    (-)-Ofloxacin hydrochloride

    Antibiotic Bacterial DNA/RNA Synthesis Topoisomerase Orthopoxvirus Infection
    Levofloxacin ((-)-Ofloxacin) hydrochloride is an orally active antibiotic and is active against both Gram-positive and Gram-negative bacteria. Levofloxacin hydrochloride inhibits the DNA gyrase and topoisomerase IV. Levofloxacin hydrochloride can be used for chronic periodontitis, airway inflammation and BK Viremia research. Levofloxacin hydrochloride shows anti-orthopoxvirus activity.
  • HY-13706A
    CAY10471

    TM30089

    Prostaglandin Receptor Inflammation/Immunology
    CAY10471 (TM30089) is a potent, selective, and orally active prostaglandin D2 receptor CRTH2 antagonist. CAY10471 attenuates the progression of tubulointerstitial fibrosis and chronic contact hypersensitivity (CHS) in animal model.
  • HY-P99444
    Astegolimab

    MSTT 1041A; RG 6149

    Interleukin Related Inflammation/Immunology
    Astegolimab (MSTT 1041A; RG 6149) is a human IgG2 monoclonal antibody that blocks IL-33 signaling by targeting ST2, the IL-33 receptor. Astegolimab has the potential for chronic obstructive pulmonary disease (COPD) research.
  • HY-123794
    MP07-66

    Phosphatase Cancer
    MP07-66, a FTY720 analogue, is devoid of immunosuppressive effects and shows promising antitumor effects in chronic lymphocytic leukemia by disruption of the SET-PP2A complex leading to PP2A reactivation.
  • HY-108260
    Deferitrin

    GT-56-252

    Others Cardiovascular Disease
    Deferitrin (GT-56-252), a desferrithiocin (DFT) analogue, is an orally active trident iron chelator. Deferitrin is used for chronic iron overload due to transfusional therapy. Deferitrin has the potential for beta-thalassemia major.
  • HY-136909
    SR33805

    Calcium Channel Cardiovascular Disease
    SR33805 is a potent Ca 2+ channel antagonist, with EC50s of 4.1 nM and 33 nM in depolarized and polarized conditions, respectively. SR33805 blocks L-type but not T-type Ca 2+ channels. SR33805 can be used for the research of acute or chronic failing hearts.
  • HY-101588
    Gefapixant

    MK-7264; AF-219

    P2X Receptor Inflammation/Immunology
    Gefapixant is an orally active and potent purinergic P2X3 receptor (P2X3R) antagonist, with IC50 values of ~30 nM versus recombinant hP2X3 homotrimers and 100-250 nM at hP2X2/3 heterotrimeric receptors. Gefapixant can be used for the research of chronic cough and knee osteoarthritis.
  • HY-145604
    Vicasinabin

    RG7774

    Cannabinoid Receptor Neurological Disease
    Vicasinabin (RG7774) is the potent agonist of cannabinoid receptor 2 (CB2). Vicasinabin has the potential for the research of human diseases including chronic pain, atherosclerosis, regulation of bone mass, neuroinflammation, and other related diseases (extracted from patent US20130116236A1).
  • HY-145150
    TRPC5-IN-1

    TRP Channel Metabolic Disease
    TRPC5-IN-1 (Compound 6j) is a selective TRPC5 inhibitor with 50.5 % Inhibition for TRPC5 at 3 μM. TRPC5-IN-1 can be used for the research of chronic kidney disease (CKD).
  • HY-114989
    Fluorizoline

    Apoptosis Cancer
    Fluorizoline selectively and directly binds to prohibitin 1 (PHB1) and 2 (PHB2), and induces apoptosis. Fluorizoline reduces chronic lymphocytic leukemia (CLL) cell viability through the upregulation of NOXA and BIM. Fluorizoline exerts antitumor action in a p53-independent manner.
  • HY-101588A
    Gefapixant citrate

    MK-7264 citrate; AF-219 citrate

    P2X Receptor Inflammation/Immunology
    Gefapixant citrate is an orally active and potent purinergic P2X3 receptor (P2X3R) antagonist, with IC50 values of ~30 nM versus recombinant hP2X3 homotrimers and 100-250 nM at hP2X2/3 heterotrimeric receptors. Gefapixant citrate can be used for the research of chronic cough and knee osteoarthritis.
  • HY-14117
    Enprofylline

    Adenosine Receptor Phosphodiesterase (PDE) Inflammation/Immunology
    Enprofylline acts as a selective and competitive A2B receptor antagonist with the Ki of 7 μM. Enprofylline also acts as a phosphodiesterase inhibitor. Enprofylline can be used for the research of asthma, chronic obstructive pulmonary disease.
  • HY-122001
    PF-05186462

    Sodium Channel Neurological Disease
    PF-05186462 is a potent and selective inhibitor of human Nav1.7 voltage-dependent sodium channel, with an IC50 of 21 nM. PF-05186462 shows significant selectivity for Nav1.7 versus other sodium channels (Nav 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, and 1.8). PF-05186462 can be used for the research of acute or chronic pain.
  • HY-119572
    Sodium zirconium cyclosilicate

    Others Inflammation/Immunology
    Sodium zirconium cyclosilicate is an orally administered, non-absorbed, novel, inorganic microporous zirconium silicate compound, is a highly selective cation exchanger that selectively removes excess K + in vivo. Sodium zirconium cyclosilicate can be used in research of chronic kidney disease (CKD).
  • HY-B1451
    Imidapril hydrochloride

    TA-6366

    Angiotensin-converting Enzyme (ACE) MMP Metabolic Disease Cardiovascular Disease
    Imidapril hydrochloride (TA-6366) is an orally active angiotensin-converting enzyme (ACE) and MMP-9 inhibitor. Imidapril hydrochloride suppresses the conversion of angiotensin I to angiotensin II and thereby reduces total peripheral resistance and systemic blood pressure. Imidapril hydrochloride can be used for hypertension, type 1 diabetic, nephropathy and chronic heart failure research.
  • HY-B0164A
    Mizolastine dihydrochloride

    Histamine Receptor Inflammation/Immunology
    Mizolastine dihydrochloride is an orally active, high affinity and specific peripheral histamine H1 receptor antagonist (second generation antihistamine). Mizolastine dihydrochloride effectively inhibits mRNA expression of VEGF165, VEGF120, TNF-α and KC. Mizolastine dihydrochloride can be used in studies of allergic rhinitis and chronic idiopathic urticarial.
  • HY-B0164
    Mizolastine

    Histamine Receptor Inflammation/Immunology
    Mizolastine is an orally active, high affinity and specific peripheral histamine H1 receptor antagonist (second generation antihistamine). Mizolastine effectively inhibits mRNA expression of VEGF165, VEGF120, TNF-α and KC. Mizolastine can be used in studies of allergic rhinitis and chronic idiopathic urticarial.
  • HY-145904
    PDGFRα/FLT3-ITD-IN-3

    PDGFR FLT3 Cancer
    PDGFRα/FLT3-ITD-IN-3 (Compound 18d) is a potent inhibitor of PDGFRα/FLT3 with IC50s of 0.153 and 0.004 μM, respectively. PDGFRα/FLT3-ITD-IN-3 has the potential for the research of acute myeloid leukemia or chronic eosinophilic leukemia.
  • HY-101985
    BV02

    Bcr-Abl Others Cancer
    BV02 is a potent 4-3-3 PPI (14-3-3 protein–protein interaction) inhibitor. BV02 shows cytotoxicity for hematopoietic cells expressing the IM (imatinib mesylate)-sensitive wild type Bcr-Abl and the IM-resistant T315I mutation. BV02 has the potential for the research of chronic myeloid leukemia.
  • HY-B1451A
    Imidapril

    TA-6366 free base

    Angiotensin-converting Enzyme (ACE) MMP Metabolic Disease Cardiovascular Disease
    Imidapril (TA-6366 free base) is an orally active angiotensin-converting enzyme (ACE) and MMP-9 inhibitor. Imidapril suppresses the conversion of angiotensin I to angiotensin II and thereby reduces total peripheral resistance and systemic blood pressure. Imidapril can be used for hypertension, type 1 diabetic, nephropathy and chronic heart failure research.
  • HY-138761
    EP4 receptor antagonist 3

    Prostaglandin Receptor Cancer Inflammation/Immunology
    EP4 receptor antagonist 3 is a potent EP4 receptor antagonist, example 3,extracted from patent WO2010019796 A1. EP4 receptor antagonist 3 can be used for the reseacrh of EP4 receptor-mediated diseases, such as acute and chronic pain, osteoarthritis, rheumatoid arthritis and cancer.
  • HY-145902
    PDGFRα/FLT3-ITD-IN-1

    PDGFR FLT3 Cancer
    PDGFRα/FLT3-ITD-IN-1 (Compound 12d) is a potent inhibitor of PDGFRα/FLT3 with IC50s of more than 0.036 and 0.003 μM, respectively. PDGFRα/FLT3-ITD-IN-1 has the potential for the research of acute myeloid leukemia or chronic eosinophilic leukemia.
  • HY-145903
    PDGFRα/FLT3-ITD-IN-2

    PDGFR FLT3 Cancer
    PDGFRα/FLT3-ITD-IN-2 (Compound 13d) is a potent inhibitor of PDGFRα/FLT3 with IC50s of more than 20 and 1.654 μM, respectively. PDGFRα/FLT3-ITD-IN-2 has the potential for the research of acute myeloid leukemia or chronic eosinophilic leukemia.
  • HY-137976
    Penehyclidine hydrochloride

    Penequinine hydrochloride

    mAChR NF-κB Inflammation/Immunology
    Penehyclidine (Penequinine) hydrochloride, a anticholinergic drug, is a selective antagonist of M1 and M3 receptors. Penehyclidine hydrochloride activates NF-kβ in lung tissue and inhibits the release of inflammatory factors. Penehyclidine hydrochloride can alleviate the pulmonary inflammatory response in rats with chronic obstructive pulmonary disease (COPD) undergoing mechanical ventilation.
  • HY-142119
    Penehyclidine

    mAChR NF-κB Inflammation/Immunology
    Penehyclidine, a anticholinergic agent, is a selective antagonist of M1 and M3 receptors. Penehyclidine activates NF-kβ in lung tissue and inhibits the release of inflammatory factors. Penehyclidine can alleviate the pulmonary inflammatory response in rats with chronic obstructive pulmonary disease (COPD) undergoing mechanical ventilation.
  • HY-15738
    GNF-5

    Bcr-Abl Cancer
    GNF-5, the N-hydroxyethyl carboxamide analog of GNF-2, is an orally active Bcr-Abl inhibitor. GNF-5 has Bcr-Abl inhibition activity with an IC50 value of 0.22 µM. GNF-5 has good favorable pharmacokinetic properties. GNF-5 can be used for the research of kinds of cancer including chronic myelogenous leukemia (CML) and breast cancer.
  • HY-144429
    TRPC5-IN-4

    TRP Channel Metabolic Disease
    TRPC5-IN-4 is potent and safe TRPC inhibitor with IC50 value of 14.07 nM and 65 nM for TRPC5 and TRPC4, respectively. TRPC5-IN-4 shows no damage on the cellular component of liver and kidney. TRPC5-IN-4 can be used for the research of chronic kidney disease (CKD).
  • HY-152206
    JB062

    Myosin Neurological Disease
    JB062 is a nonmuscle myosin inhibitor with IC50 values of 1.6, 5.4, and >100 μM for Skeletal muscle myosin, Cardiac muscle myosin, and Smooth muscle myosin II, respectively. JB062 has cytotoxic to human cancer cells but not normal cells. JB062 can be used in research of muscle spasticity, chronic musculoskeletal pain, and hypertrophic cardiomyopathy.
  • HY-126397
    MnTBAP chloride

    NF-κB Inflammation/Immunology
    MnTBAP chloride is a superoxide dismutase (SOD) mimetic and peroxynitrite scavenger. MnTBAP chloride is a manganic porphyrin complex and has anti-oxidative property. MnTBAP chloride mediates anti-inflammatory effects through upregulation of BMPR-II and inhibition of the NFκB signaling. MnTBAP chloride has the potential for the fibrotic response in chronic kidney diseases (CKDs) research.
  • HY-117985
    Evogliptin

    DA-1229

    Dipeptidyl Peptidase Autophagy Metabolic Disease Inflammation/Immunology
    Evogliptin (DA-1229) is an orally active DPP4 inhibitor with significant and sustained hypoglycaemic effects in mouse models. Evogliptin also inhibits the production of inflammatory and fibrotic signals in hepatocytes by inducing autophagy. Evogliptin can be used in studies of type 2 diabetes, osteoporosis, renal impairment and chronic liver inflammation.
  • HY-151198
    CHF-6366

    mAChR Adrenergic Receptor Calcium Channel Endocrinology Inflammation/Immunology
    CHF-6366 is a potent M3 muscarinic antagonist and β2-adrenergic receptors agonist with pKi values of 10.4 and 11.4, respectively. CHF-6366 is also a weak calcium channel inhibitor (IC50~50 μM). CHF-6366 inhibits bronchoconstriction in guinea pigs. CHF-6366 can be used to research chronic obstructive pulmonary disease (COPD).
  • HY-103275
    Adaphostin

    NSC 680410

    Bcr-Abl Apoptosis Cancer
    Adaphostin (NSC 680410), the adamantyl ester of AG957, is a potent p210 bcr/abl inhibitor (IC50=14 μM). Adaphostin induces apoptosis in T-lymphoblastic human leukemia cell lines (IC50 ranging from 17 to 216 nM). Adaphostin has significant and selective activity against chronic and acute myeloid leukemia cells. Adaphostin increased the level of reactive oxygen species (ROS) within CLL B cells.
  • HY-B0251
    Eplerenone

    Epoxymexrenone

    Mineralocorticoid Receptor Endogenous Metabolite Cancer Cardiovascular Disease
    Eplerenone (Epoxymexrenone) is a selective, highly specific and orally active aldosterone blocker (SAB). Eplerenone also is a selective mineralocorticoid receptor antagonist (MRA) with IC50 value of 0.081 μM. Eplerenone can be used for the research of hypertension, atherosclerosis, chronic systolic heart failure (HF) and cardiovascular (CV).
  • HY-13995B
    Sevelamer carbonate

    Others Metabolic Disease
    Sevelamer carbonate is an orally active and non-calcium-based phosphate binding agent and used for the hyperphosphatemia of chronic kidney disease (CKD)research. Sevelamer carbonate effectively lowers serum phosphorus levels hile having minimal effect on serum calcium or serum chloride levels in vivo. Sevelamer carbonate is considered as an improved, buffered form of sevelamer (HY-13995).
  • HY-148092
    (S)-PM-43I

    STAT Cancer Inflammation/Immunology
    (S)-PM-43I is a potent STAT6 inhibitor and can reduce STAT6 phosphorylation level. (S)-PM-43I can be used in allergic lung disease, allergic rhinitis, chronic pulmonary obstructive disease and cancer research[1].
  • HY-117985B
    Evogliptin tartrate

    DA-1229 tartrate

    Dipeptidyl Peptidase Autophagy Metabolic Disease Inflammation/Immunology
    Evogliptin (DA-1229) tartrate is an orally active DPP4 inhibitor with significant and sustained hypoglycaemic effects in mouse models. Evogliptin tartrate also inhibits the production of inflammatory and fibrotic signals in hepatocytes by inducing autophagy. Evogliptin tartrate can be used in studies of type 2 diabetes, osteoporosis, renal impairment and chronic liver inflammation.
  • HY-14151
    Prucalopride

    5-HT Receptor Neurological Disease Cancer
    Prucalopride is an orally active, selective and specific 5-HT 4 receptor agonist (high affinity), with pKis of 8.6 and 8.1 for human 5-HT4a/4b receptors, respectively. Prucalopride improves intestinal motility by promoting regeneration of the intestinal nervous system in rats. Prucalopride also shows anticancer activity by blocking of the PI3K/AKT/mTor signaling pathway. Prucalopride can be used in studies of chronic constipation, pseudo-intestinal obstruction and cancer.
  • HY-17474A
    Parecoxib Sodium

    SC 69124A

    COX Inflammation/Immunology Cancer
    Parecoxib Sodium (SC 69124A) is a highly selective and orally active COX-2 inhibitor, the prodrug of Valdecoxib (HY-15762). Parecoxib Sodium is a nonsteroidal anti-inflammatory agent (NSAID) and inhibits prostaglandin (PG) synthesis. Parecoxib Sodium can be used for the relief of acute postoperative pain and symptoms of chronic inflammatory conditions such as osteoarthritis and rheumatoid arthritis in vivo.
  • HY-17474
    Parecoxib

    SC 69124

    COX Cancer Inflammation/Immunology
    Parecoxib (SC 69124) is a highly selective and orally active COX-2 inhibitor, the prodrug of Valdecoxib (HY-15762). Parecoxib Sodium is a nonsteroidal anti-inflammatory agent (NSAID) and inhibits prostaglandin (PG) synthesis. Parecoxib can be used for the relief of acute postoperative pain and symptoms of chronic inflammatory conditions such as osteoarthritis and rheumatoid arthritis in vivo.
  • HY-118858
    UCPH-102

    Others Cancer Neurological Disease
    UCPH-102 is a highly selective EAAT1 inhibitor with an IC50 of 0.43 µM. UCPH-102 exhibits a specific anti-proliferative effect on T-ALL cells. UCPH-102 also shows good blood-brain permeability, which can be used in studies of amyotrophic lateral sclerosis, Alzheimer’s disease, chronic pain and obsessive compulsive disorder.
  • HY-12083
    PPY-A

    Bcr-Abl Cancer
    PPY-A is a potent T315I mutant and wild-type Abl kinases inhibitor with IC50s of 9 and 20 nM, respectively. PPY-A inhibits Ba⁄F3 cells transformed with wild-type Abl and Abl T315I mutantl with IC50s of 390 and 180 nM, respectively. PPY-A can be used for the research of chronic myeloid leukemia (CML).
  • HY-131910
    IHMT-PI3Kδ-372

    PI3K Cytochrome P450 Inflammation/Immunology
    IHMT-PI3Kδ-372 is a potent and selective PI3Kδ inhibitor with an IC50 of 14 nM. IHMT-PI3Kδ-372 shows high selectivity over other class I PI3Ks (56∼83 fold) and other protein kinases. IHMT-PI3Kδ-372 can be uesd for chronic obstructive pulmonary disease (COPD) research.
  • HY-17600
    Acalabrutinib

    ACP-196

    Btk Cancer
    Acalabrutinib (ACP-196) is an orally active, irreversible, and highly selective second-generation BTK inhibitor. Acalabrutinib binds covalently to Cys481 in the ATP-binding pocket of BTK. Acalabrutinib demonstrates potent on-target effects and efficacy in mouse models of chronic lymphocytic leukemia (CLL).
  • HY-111372
    Finerenone

    BAY 94-8862

    Mineralocorticoid Receptor Cardiovascular Disease
    Finerenone (BAY 94-8862) is a third-generation, selective, and orally available nonsteroidal mineralocorticoid receptor (MR) antagonist (IC50=18 nM). Finerenone displays excellent selectivity versus glucocorticoid receptor (GR), androgen receptor (AR), and progesterone receptor (>500-fold). Finerenone has the potential for cardiorenal diseases research, such as type 2 diabetes mellitus and chronic kidney disease.
  • HY-146346
    HD-TAC7

    PROTACs HDAC Inflammation/Immunology
    HD-TAC7 is a potent PROTAC HDAC degrader with IC50 values of 3.6 μM, 4.2 μM and 1.1 μM for HDAC1, HDAC2 and HDAC3, respectively. HD-TAC7 can decreases NF-κB p65 in RAW 264.7 macrophages. HD-TAC7 can be used for the research of inflammatory diseases like asthma and chronic obstructive pulmonary disease (COPD).
  • HY-110358
    QAQ dichloride

    Sodium Channel Inflammation/Immunology
    QAQ dichloride, a photoswitchable voltage-gated Nav and Kv channels blocker, blocks channels in its trans form (of the azobenzene photoswitch), but not in its cis form. QAQ dichloride is membrane-impermeant and only infiltrates pain-sensing neurons that express endogenous import channels. QAQ dichloride acts as a light-sensitive analgesic and can be used for studying of signaling mechanisms in acute and chronic pain.
  • HY-123348
    Sampatrilat

    UK-81252

    Angiotensin-converting Enzyme (ACE) Neprilysin Inflammation/Immunology Cardiovascular Disease
    Sampatrilat (UK-81252) is a potent and orally active vasopeptidase inhibitor of ACE and neutral endopeptidase (NEP). Sampatrilat inhibits C-domain ACE (Ki=13.8 nM) 12.4-fold more potent than that for the N-domain (Ki=171.9 nM). Sampatrilat (UK-81252) can be used for the study of chronic heart failure and blood pressure regulation.
  • HY-10790
    Cilomilast

    SB-207499

    Phosphodiesterase (PDE) Inflammation/Immunology
    Cilomilast (SB-207499) is a potent, selective and orally active inhibitor of Phosphodiesterase 4 (PDE4), with IC50s of ~100 and 120 nM for LPDE4 and HPDE4, respectively. Cilomilast shows selectivity for PDE4 over PDE1, PDE2, PDE3 and PDE5 (IC50=74, 65, >100, and 83 µM, respectively). Cilomilast has anti-inflammatory and immunomodulatory effects and can be used for thr research of asthma and chronic obstructive pulmonary disease (COPD).
  • HY-108662
    PIT

    2,2'-Pyridylisatogen tosylate

    P2Y Receptor Inflammation/Immunology
    PIT (2,2'-Pyridylisatogen tosylate) is a selective and non-competitive antagonist of P2Y1 receptor with an IC50 value of 0.14 μM for human P2Y1 receptor. PIT antagonizes P2Y1 receptor signaling without affecting nucleotide binding. PIT is an irreversible antagonist of responses to ATP at metabotropic purinoceptors (of the P2Y family) in some smooth muscles. PIT can be used for the research of chronic bronchitis and asthma.
  • HY-W062904
    Laquinimod sodium

    ABR-215062 sodium

    NF-κB Apoptosis Inflammation/Immunology Neurological Disease
    Laquinimod (ABR-215062) sodium, an orally available carboxamide derivative, is a potent immunomodulator which prevents neurodegeneration and inflammation in the central nervous system. Laquinimod sodium reduces astrocytic NF-κB activation to protect from Cuprizone-induced demyelination. Laquinimod sodium has the potential for relapsing remitting (RR) and chronic progressive (CP) forms of multiple sclerosis (MS; RRMS or CPMS) as well as neurodegenerative diseases research.
  • HY-13010
    Laquinimod

    ABR-215062

    NF-κB Apoptosis Inflammation/Immunology
    Laquinimod (ABR-215062), an orally available carboxamide derivative, is a potent immunomodulator which prevents neurodegeneration and inflammation in the central nervous system. Laquinimod reduces astrocytic NF-κB activation to protect from Cuprizone-induced demyelination. Laquinimod has the potential for relapsing remitting (RR) and chronic progressive (CP) forms of multiple sclerosis (MS; RRMS or CPMS) as well as neurodegenerative diseases research.
  • HY-148096
    STAT6-IN-1

    STAT Cancer Inflammation/Immunology
    STAT6-IN-1 (compound 19a) is a STAT6 inhibitor with a high affinity for the SH2 domain of STAT6 (IC50=0.028 µM). STAT6-IN-1 can be used in studies of allergic lung disease, allergic rhinitis, chronic obstructive pulmonary disease or cancer.
  • HY-114314
    BA-53038B

    HBV Infection
    BA-53038B is a HBV core protein allosteric modulator (CpAM), binding to the HAP pocket and modulating HBV capsid assembly. BA-53038B has antiviral activity for hepatitis B virus (HBV) with an EC50 value of 3.32 μM. BA-53038B can be used for the research of chronic hepatitis B.
  • HY-145552
    Azilsartan mepixetil

    Angiotensin Receptor Cardiovascular Disease
    Azilsartan mepixetil is the antagonist of angiotensin II receptor. Azilsartan mepixetil has stronger and longer blood pressure effect, more abvious and longer lasting heart rate lowering effect and high safety. Azilsartan mepixetil achieves ideal protective effect for heart and kidney functions. Azilsartan mepixetil has the potential for the research of hypertension, chronic heart failure and diabetic nephropathy (extracted from patent CN107400122A).
  • HY-18627A
    PFI-2 hydrochloride

    (R)-PFI-2 hydrochloride

    Histone Methyltransferase Cancer Infection Inflammation/Immunology
    PFI-2 ((R)-PFI-2 hydrochloride) hydrochloride is a potent and selective SET domain containing lysine methyltransferase 7 (SETD7) inhibitor. (R)-PFI-2 shows high inhibiting activity with IC50 value of 2.0  nM and (S)-PFI-2 shows inhibiting activity with IC50  value of 1.0  μM. PFI-2 hydrochloride can be used for the research of chronic kidney disease and inflammation response in the development of renal fibrosis.
  • HY-18627
    PFI-2

    (R)-PFI-2

    Histone Methyltransferase Cancer Infection Inflammation/Immunology
    PFI-2 ((R)-PFI-2 hydrochloride) hydrochloride is a potent and selective SET domain containing lysine methyltransferase 7 (SETD7) inhibitor. (R)-PFI-2 shows high inhibiting activity with IC50 value of 2.0  nM and (S)-PFI-2 shows inhibiting activity with IC50  value of 1.0  μM. PFI-2 hydrochloride can be used for the research of chronic kidney disease and inflammation response in the development of renal fibrosis.
  • HY-107909
    Theophylline sodium glycinate

    1,3-Dimethylxanthine sodium glycinate; Theo-24 sodium glycinate

    Adenosine Receptor HDAC Apoptosis Interleukin Related TNF Receptor Cancer
    Theophylline (1,3-Dimethylxanthine) sodium glycinate is a potent phosphodiesterase (PDE) inhibitor, adenosine receptor antagonist, and histone deacetylase (HDAC) activator. Theophylline sodium glycinate inhibits PDE3 activity to relax airway smooth muscle. Theophylline sodium glycinate has anti-inflammatory activity by increase IL-10 and inhibit NF-κB into the nucleus. Theophylline sodium glycinate induces apoptosis. Theophylline sodium glycinate can be used for asthma and chronic obstructive pulmonary disease (COPD) research.
  • HY-A0062
    Telithromycin

    HMR3647; RU66647

    Bacterial Antibiotic Infection Inflammation/Immunology
    Telithromycin (HMR3647) is a novel ketolide antibiotic that structurally resembles macrolides. Telithromycin belongs to the ketolide family that is characterized by a keto group at position 3 of the macrolide ring and is active against bacteria causing community-acquired pneumonia, acute exacerbation of chronic bronchitis, and acute sinusitis. Telithromycin also has similar immunomodulatory effects as macrolides. Telithromycin can be used for the research of respiratory infections including bronchial asthma.
  • HY-Y0698
    Thioacetamide

    Acetothioamide; TAA; Thiacetamide

    Others Inflammation/Immunology
    Thioacetamide (TAA) is an indirect hepatotoxin and causes parenchymal cell necrosis. Thioacetamide requires metabolic activation by microsomal CYP2E1 to thioacetamide-S-oxide initially and then to thioacetamide-S-dioxide, which is a highly reactive metabolite, and its reactive metabolites covalently bind to proteins and lipids thereby causing oxidative stress and centrilobular necrosis. Thioacetamide can induce chronic liver fibrosis, encephalopathy and other events model.
  • HY-W010708
    Cholesteryl palmitate

    Endogenous Metabolite Inflammation/Immunology
    Cholesteryl palmitate is a useful prognostic biomarker for chronic interstitial pneumonia (CIP).
  • HY-U00209
    Benzofurodil

    Benfurodil; CB4091; Eudilat

    Others Cardiovascular Disease
    Benzofurodil is a cardiotonic, which is used for the chronic treatment of congestive heart failure.
  • HY-B0930
    Efloxate

    Angorlisin

    Others Cardiovascular Disease
    Efloxate is a vasodilator, used to treat chronic coronary insufficiency and Angina pectoris,
  • HY-120802
    Navafenterol

    AZD-8871; LAS191351

    mAChR Adrenergic Receptor Inflammation/Immunology
    Navafenterol (AZD-8871) is an inhaled dual-acting, potent, selective, and long-lasting M3-antagonist/β2-agonist (MABA) with long-lasting effects and favorable safety profile. The pIC50 is 9.5 for human M3 receptor, and the pEC50 is 9.5 for β2-adrenoceptor. Navafenterol can be used for the research of chronic obstructive pulmonary disease (COPD). Bronchoprotective and antisialagogue effects. Favorable cardiovascular profile.
  • HY-120802A
    Navafenterol saccharinate

    AZD-8871 saccharinate; LAS191351 saccharinate

    mAChR Adrenergic Receptor Infection Inflammation/Immunology
    Navafenterol (AZD-8871) saccharinate is an inhaled dual-acting, potent, selective, and long-lasting M3-antagonist/β2-agonist (MABA) with long-lasting effects and favorable safety profile. The pIC50 is 9.5 for human M3 receptor, and the pEC50 is 9.5 for β2-adrenoceptor. Navafenterol saccharinate can be used for the research of chronic obstructive pulmonary disease (COPD). Bronchoprotective and antisialagogue effects. Favorable cardiovascular profile.
  • HY-P1626
    Acetyl tetrapeptide-15

    Opioid Receptor Neurological Disease
    Acetyl tetrapeptide-15 is a synthetic peptide used in the cosmetics for sensitive skin. Acetyl tetrapeptide-15 is derived from endomorphin-2 (Tyr-Pro-Phe-Phe-NH2), a human μ-opioid agonist with selective anti-nociceptive effect. Acetyl tetrapeptide-15 reduces skin hyperreactivity producing inflammatory, chronic and neuropathic pain, by increasing the threshold of neuronal excitability in μ-opioid receptor via an endorphin-like pathway.
  • HY-150702
    MAGLi 432

    MAGL Inflammation/Immunology Neurological Disease
    MAGLi 432 is a non-covalent, potent, highly selective, and reversible MAGL inhibitor. MAGLi 432 binds with high affinity to the MAGL active site, with IC50 values of 4.2 nM (human enzyme) and 3.1 nM (mouse enzyme). MAGLi 432 can be used in the research of chronic inflammation, blood–brain barrier dysfunction, neurological disorders such as multiple sclerosis, Alzheimer’s disease and Parkinson’s disease.
  • HY-13910A
    Tenofovir hydrate

    GS 1278 hydrate; PMPA hydrate

    HIV Reverse Transcriptase Infection
    Tenofovir hydrate is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B.
  • HY-B0809A
    Theophylline monohydrate

    1,3-Dimethylxanthine monohydrate; Theo-24 monohydrate

    Phosphodiesterase (PDE) Adenosine Receptor HDAC Apoptosis Interleukin Related TNF Receptor Endogenous Metabolite Cancer
    Theophylline (1,3-Dimethylxanthine) monohydrate is a potent phosphodiesterase (PDE) inhibitor, adenosine receptor antagonist, and histone deacetylase (HDAC) activator. Theophylline (1,3-Dimethylxanthine) monohydrate inhibits PDE3 activity to relax airway smooth muscle. Theophylline (1,3-Dimethylxanthine) monohydrate has anti-inflammatory activity by increase IL-10 and inhibit NF-κB into the nucleus. Theophylline (1,3-Dimethylxanthine) monohydrate induces apoptosis. Theophylline (1,3-Dimethylxanthine) monohydrate can be used for asthma and chronic obstructive pulmonary disease (COPD) research.
  • HY-B0809
    Theophylline

    1,3-Dimethylxanthine; Theo-24

    Phosphodiesterase (PDE) Adenosine Receptor HDAC Apoptosis Interleukin Related TNF Receptor Endogenous Metabolite Cancer
    Theophylline (1,3-Dimethylxanthine) is a potent phosphodiesterase (PDE) inhibitor, adenosine receptor antagonist, and histone deacetylase (HDAC) activator. Theophylline (1,3-Dimethylxanthine) inhibits PDE3 activity to relax airway smooth muscle. Theophylline (1,3-Dimethylxanthine) has anti-inflammatory activity by increase IL-10 and inhibit NF-κB into the nucleus. Theophylline (1,3-Dimethylxanthine) induces apoptosis. Theophylline (1,3-Dimethylxanthine) can be used for asthma and chronic obstructive pulmonary disease (COPD) research.
  • HY-B0809B
    Theophylline sodium acetate

    1,3-Dimethylxanthine sodium acetate; Theo-24 sodium acetate

    Endogenous Metabolite Phosphodiesterase (PDE) Adenosine Receptor HDAC Apoptosis Interleukin Related TNF Receptor Cancer
    Theophylline (1,3-Dimethylxanthine) sodium acetate is a potent phosphodiesterase (PDE) inhibitor, adenosine receptor antagonist, and histone deacetylase (HDAC) activator. Theophylline (1,3-Dimethylxanthine) sodium acetate inhibits PDE3 activity to relax airway smooth muscle. Theophylline (1,3-Dimethylxanthine) sodium acetate has anti-inflammatory activity by increase IL-10 and inhibit NF-κB into the nucleus. Theophylline (1,3-Dimethylxanthine) sodium acetate induces apoptosis. Theophylline (1,3-Dimethylxanthine) sodium acetate can be used for asthma and chronic obstructive pulmonary disease (COPD) research.
  • HY-150217
    CpG ODN 10101

    ODN 10101

    Toll-like Receptor (TLR) HCV Infection Inflammation/Immunology
    CpG ODN 10101, a synthetic oligodeoxynucleotide (ODN),  is a toll-like receptor 9 (TLR9) agonist. CpG ODN 10101 is a potent inducer of cytokine/chemokine expression ex vivo when used in combination with HH2(VQLRIRVAVIRA-NH2). CpG ODN 10101 induces IFN- secretion from dendritic cells (DCs) and stimulates B-cells.CpG ODN 10101 has antiviral and immunomodulatory properties that can influence chronic infection with HCV.
  • HY-13910B
    Tenofovir maleate

    GS 1278 maleate; PMPA maleate

    HIV Reverse Transcriptase Infection
    Tenofovir Disoproxil Fumarate is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B.
  • HY-147518
    p38-α MAPK-IN-5

    p38 MAPK Inflammation/Immunology
    p38-α MAPK-IN-5 (compound 4e) is a potent p38α inhibitor with IC50s of 0.1 nM, 0.2 nM, 944 nM, 4100 nM for p38α, p38 β, p38γ, p38δ, respectively. p38-α MAPK-IN-5 has anti-inflammatory effect. p38-α MAPK-IN-5 has the potential for asthma and chronic obstructive pulmonary disease (COPD) research.
  • HY-19883
    Lusutrombopag

    S-888711

    Thrombopoietin Receptor Inflammation/Immunology
    Lusutrombopag is an orally bioavailable thrombopoietin (TPO) receptor agonist, used for treatment of chronic liver disease.
  • HY-101581
    Bucloxic acid

    804CB; Bucloxonic acid; Esfar

    Others Inflammation/Immunology
    Bucloxic acid is an anti-inflammatory pyrrazole derivative. Bucloxic acid can be used in the treatment of chronic glomerular nephropathies.
  • HY-13782
    Tenofovir Disoproxil fumarate

    Tenofovir DF; Bis(POC)-PMPA fumarate; GS 4331 fumarate

    HIV Reverse Transcriptase HBV Infection
    Tenofovir Disoproxil fumarate is a nucleotide reverse transcriptase inhibitor used to treat HIV and chronic Hepatitis B.
  • HY-P99272
    Ulocuplumab

    BMS 936564; MDX 1338; Anti-Human CXCR4 Recombinant Antibody

    CXCR Cancer
    Ulocuplumab (Anti-Human CXCR4 Recombinant Antibody/BMS-936564/MDX1338) is a fully human IgG4 anti-CXCR4 antibody. Ulocuplumab induces apoptosis and inhibits CXCL12 mediated CXCR4 activation-migration of chronic lymphocytic leukemia (CLL). Ulocuplumab exhibits antitumor activity in established tumors including acute myeloid leukemia (AML), non-Hodgkin lymphoma (NHL), and multiple myeloma xenograft models.
  • HY-B1063
    Terpin hydrate

    Terpin monohydrate; cis-Terpin hydrate

    Others Inflammation/Immunology
    Terpin hydrate is an expectorant, commonly used to loosen mucus in patients presenting with acute or chronic bronchitis, and related conditions.
  • HY-N0388
    Gelsemine

    Others Neurological Disease
    Gelsemine, an alkaloid from the Chinese herb Gelsemium elegans, is effective in mitigating chronic pain. Antinociceptive effects.
  • HY-U00103
    Triamcinolone hexacetonide

    Others Inflammation/Immunology
    Triamcinolone hexacetonide is a commonly used long-acting steroids in treatment of subacute and chronic inflammatory joint diseases.
  • HY-A0211
    Carphenazine

    Others Neurological Disease
    Carphenazine is a phenothiazine antipsychotic agent. Carphenazine can be used for researching chronic schizophrenic psychoses.
  • HY-13782A
    Tenofovir Disoproxil

    Bis(POC)-PMPA; GS 4331

    HIV Reverse Transcriptase HBV Cancer
    Tenofovir Disoproxil (Bis(POC)-PMPA) is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B.
  • HY-U00105
    Oxitropium Bromide

    mAChR Inflammation/Immunology
    Oxitropium bromide is an mAChR antagonist used as an anticholinergic bronchodilator drug for the treatment of asthma and chronic obstructive pulmonary disease.
  • HY-B1235
    Acetohydroxamic acid

    N-Hydroxyacetamide

    Bacterial Infection
    Acetohydroxamic acid is a potent and irreversible inhibitor of bacterial and plant urease and also used as adjunctive therapy in chronic urinary infection.
  • HY-13995
    Sevelamer

    FXR Autophagy Endocrinology
    Sevelamer is a phosphate binding drug used to treat hyperphosphatemia in patients with chronic kidney disease; consists of polyallylamine that is crosslinked with epichlorohydrin.
  • HY-I0726
    Enantiomer of Sofosbuvir

    Others Infection
    Enantiomer of Sofosbuvir is an enantiomer of Sofosbuvir, a prescription medicine for the treatment of patients with chronic hepatitis C. There is no biological activity report on enantiomer of Sofosbuvir until now.
  • HY-B0679
    Lubiprostone

    RU-0211; SPI-0211

    Chloride Channel Metabolic Disease
    Lubiprostone(SPI-0211;RU0211) is a gastrointestinal agent used for the treatment of idiopathic chronic constipation.
  • HY-B0382
    Fosinopril sodium

    SQ28555

    Angiotensin-converting Enzyme (ACE) Apoptosis Cardiovascular Disease
    Fosinopril Sodium is the ester prodrug of an angiotensin-converting enzyme (ACE) inhibitor, used for the treatment of hypertension and some types of chronic heart failure.
  • HY-13910
    Tenofovir

    GS 1278; PMPA

    Reverse Transcriptase HIV HBV Infection
    Tenofovir (GS 1278) is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B (HBV).
  • HY-U00385
    Neuromuscular Disorder-Targeting Compound 1

    Others Neurological Disease
    Neuromuscular Disorder-Targeting Compound 1 is used in the research of neuromuscular disorders such as symptoms of fibromyalgia syndrome and chronic fatigue syndrome.
  • HY-N2356
    Apiosylskimmin

    Adicardin

    Others Metabolic Disease
    Apiosylskimmin (Adicardin), a coumarin isolated from Hydrangea macrophylla, has anti-chronic renal failure activity .
  • HY-111603
    Calcium dobesilate

    Apoptosis Others
    Calcium dobesilate, a vasoprotective, is widely used in chronic venous disease, diabetic retinopathy and the symptoms of haemorrhoidal attack in many countries.
  • HY-103487
    Uprifosbuvir

    IDX21437; MK-3682

    HCV Infection
    Uprifosbuvir is an antiviral agent. Uprifosbuvir is a NS5b inhibitor developed for the research of chronic hepatitis C virus.
  • HY-10404
    Dilmapimod

    SB-681323; GW 681323

    p38 MAPK Autophagy Inflammation/Immunology Cancer
    Dilmapimod (SB-681323) is a potent p38 MAPK inhibitor that potentially suppresses inflammation in chronic obstructive pulmonary disease.
  • HY-17477
    Guacetisal

    Others Inflammation/Immunology
    Guacetisal is obtained from the esterification of acetylsalicylic acid with guaiacol which has the potential for chronic bronchitis treatment extracted from patent CN 106866420 A.
  • HY-N0117
    Indirubin

    Couroupitine B; Indigo red; Indigopurpurin

    Apoptosis Cancer
    Indirubin (Couroupitine B) is a bis-indole alkaloid and has emarkable anticancer activity against chronic myelocytic leukemia.
  • HY-W010708S
    Cholesteryl palmitate-d9

    Endogenous Metabolite Inflammation/Immunology
    Cholesteryl palmitate-d9 is the deuterium labeled Cholesteryl palmitate. Cholesteryl palmitate is a useful prognostic biomarker for chronic interstitial pneumonia (CIP).
  • HY-17584
    Linaclotide

    Guanylate Cyclase Others
    Linaclotide is a potent and selective guanylate cyclase C agonist; developed for the treatment of constipation-predominant irritable bowel syndrome (IBS-C) and chronic constipation.
  • HY-B1096
    Etamivan

    Ethamivan; N,N-Diethylvanillamide

    Others Neurological Disease
    Etamivan (Ethamivan), an orally active respiratory stimulant, is mainly used in the research of barbiturate overdose and chronic obstructive pulmonary disease.
  • HY-105092
    Tetomilast

    OPC-6535

    Phosphodiesterase (PDE) Inflammation/Immunology
    Tetomilast (OPC-6535) is a PDE4 inhibitor with potential for the treatment of inflammatory bowel disease (IBD) and chronic obstructive pulmonary disease (COPD).
  • HY-W092533
    6-Fluorotryptophan

    Tryptophan Hydroxylase Neurological Disease
    6-Fluorotryptophan, a competitive inhibitor of tryptophan hydroxylase, produced a transient disruption of sleep in rats chronically implanted with EEG recording electrodes.
  • HY-P3648
    Ala-Ala-Pro-Val-chloromethylketone

    AAPV-CMK

    Elastase Inflammation/Immunology
    Ala-Ala-Pro-Val-chloromethylketone is an irreversible human neutrophil elastase (NE) inhibitor for use in the study of chronic inflammatory airway diseases.
  • HY-19883S
    Lusutrombopag-d13

    S-888711-d13

    Thrombopoietin Receptor Inflammation/Immunology
    Lusutrombopag-d13 is deuterium labeled Lusutrombopag. Lusutrombopag is an orally bioavailable thrombopoietin (TPO) receptor agonist, used for treatment of chronic liver disease.
  • HY-100314
    BCR-ABL-IN-1

    Bcr-Abl Cancer
    BCR-ABL-IN-1 is an inhibitor of BCR-ABL tyrosine kinase, with a pIC50 of 6.46, and may be used in the research of chronic myelogenous leukemia.
  • HY-132810
    Bevurogant

    ROR Inflammation/Immunology
    Bevurogant is a retinoid-related orphan receptor-gamma t (RORγt) antagonist. Bevurogant can be used for the research of chronic inflammatory diseases.
  • HY-W010708S1
    Cholesteryl palmitate-d7

    Endogenous Metabolite Inflammation/Immunology
    Cholesteryl palmitate-d7 is deuterium labeled Cholesteryl palmitate. Cholesteryl palmitate is a useful prognostic biomarker for chronic interstitial pneumonia (CIP).
  • HY-111431
    p-Cresyl sulfate

    p-Tolyl sulfate

    Endogenous Metabolite Metabolic Disease
    p-Cresyl Sulfate, a major uremic toxin derived from the metabolites of tyrosine and phenylalanine through liver, existed in the blood of patients with chronic kidney disease (CKD).
  • HY-139555
    Zectivimod

    LPL Receptor Inflammation/Immunology
    Zectivimod is a sphingosine-1-phosphate receptor agonist. Zectivimod can be used for the research of autoimmune diseases, chronic inflammatory diseases and immunoregulation disorders.
  • HY-50919
    Paricalcitol

    VD/VDR Metabolic Disease
    Paricalcitol, a vitamin D analogue, is a vitamin D receptor agonist, used for the prevention and treatment of secondary hyperparathyroidism (excessive secretion of parathyroid hormone) associated with chronic renal failure.
  • HY-107929
    Calcium polystyrene sulfonate

    Poly(styrenesulfonic acid) calcium salt

    Others Cardiovascular Disease
    Calcium polystyrene sulfonate is an ion-exchange resin used for reducing blood levels of potassium. Calcium polystyrene sulfonate is used to treat hyperkalemia in patients with chronic kidney disease (CKD).
  • HY-17608
    Daprodustat

    GSK1278863

    HIF/HIF Prolyl-Hydroxylase Cardiovascular Disease
    Daprodustat (GSK1278863) is an orally active hypoxia-inducible factor prolyl hydroxylase (HIF-PH) inhibitor being developed for the treatment of anemia associated with chronic kidney disease.
  • HY-B0277A
    Vidarabine phosphate

    ara-AMP; ara-A 5'-monophosphate

    HBV Antibiotic Infection
    Vidarabine phosphate (Ara-AMP), an antiviral agent, inhibits chronic HBV infection. Vidarabine phosphate also against herpes simplex and varicella zoster viruses.
  • HY-W074930
    (S)-Tenofovir

    (S)-GS 1278; (S)-PMPA; (S)-TDF

    HIV HBV Infection
    (S)-Tenofovir ((S)-GS 1278) is the less active S-enantiomer of Tenofovir. Tenofovir is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B (HBV).
  • HY-10159B
    Nilotinib hydrochloride

    AMN107 hydrochloride

    Bcr-Abl Autophagy Cancer
    Nilotinib (AMN107) hydrochloride is an orally active Bcr-Abl tyrosine kinase inhibitor with antineoplastic activity and can be used in studies of chronic myelogenous leukaemia.
  • HY-109162
    Trazpiroben

    TAK-906

    Dopamine Receptor Neurological Disease
    Trazpiroben (TAK-906) is a dopamine D2/D3 receptor antagonist used for chronic research of moderate-to-severe gastroparesis.
  • HY-131274
    Fexofenadine Impurity F

    Others Others
    Fexofenadine Impurity F is the impurity of Fexofenadine. Fexofenadine, a H1R antagonist, is an anti-allergic agent used in seasonal allergic rhinitis and chronic idiopathic urticarial.
  • HY-147255
    Canocapavir

    ZM-H1505R

    HBV Infection
    Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. .
  • HY-B1271
    Sulfinpyrazone

    G-28315

    Endogenous Metabolite Inflammation/Immunology
    Sulfinpyrazone (G-28315) is an orally active and potent uricosuric agent for chronic and intermittent gouty arthritis. Sulfinpyrazone has antithrombotic and platelet inhibitory effects.
  • HY-B1037
    Salbutamol

    Albuterol; AH-3365

    Adrenergic Receptor Neurological Disease Endocrinology
    Salbutamol is a short-acting β2-adrenergic receptor agonist used for the relief of bronchospasm in conditions such as asthma and chronic obstructive pulmonary disease (COPD).
  • HY-66011A
    Moxifloxacin

    Bacterial Antibiotic Infection Cancer
    Moxifloxacin is an orally active 8-methoxyquinolone antimicrobial for use in the treatment of acute bacterial sinusitis, acute bacterial exacerbations of chronic bronchitis, and community-acquired pneumonia.
  • HY-P0062
    Ziconotide

    SNX-111

    Calcium Channel Inflammation/Immunology Neurological Disease Cancer
    Ziconotide (SNX-111), a peptide, is a potent and selective block of N-type calcium channels antagonist. Ziconotide reduces synaptic transmission, and can be used for chronic pain research.
  • HY-P99550
    Tozorakimab

    MEDI-3506

    Interleukin Related Inflammation/Immunology
    Tozorakimab (MEDI-3506) is a human immunoglobulin G1 monoclonal antibody targeting interleukin-33. Tozorakimab can be used to research chronic obstructive pulmonary disease.
  • HY-111603S
    Dobesilate-d6 calcium

    Apoptosis Others
    Dobesilate-d6 (calcium) is deuterium labeled Calcium dobesilate. Calcium dobesilate, a vasoprotective, is widely used in chronic venous disease, diabetic retinopathy and the symptoms of haemorrhoidal attack in many countries.
  • HY-N1283
    Seneciphyllinine

    Others Metabolic Disease
    Seneciphyllinine, a pyrrolizidine alkaloid, is isolated from the roots of Gynura japonica. Pyrrolizidine alkaloids are highly hepatotoxic natural chemicals that produce irreversible chronic and acute hepatotoxic effects on human beings.
  • HY-109105
    Tepilamide fumarate

    XP-23829; PPC-06

    Others Inflammation/Immunology
    Tepilamide fumarate (XP-23829; PPC-06) is an oral fumaric acid ester, acts as a prodrug of Monomethyl fumarate (HY-103252), and is used in the research of moderate to severe chronic plaque psoriasis.
  • HY-P0062B
    Ziconotide acetate

    SNX-111 acetate

    Calcium Channel Inflammation/Immunology Cardiovascular Disease Cancer
    Ziconotide acetate (SNX-111 acetate), a peptide, is a potent and selective block of N-type calcium channels antagonist. Ziconotide acetate reduces synaptic transmission, and can be used for chronic pain research.
  • HY-76585
    Paricalcitol-d6

    VD/VDR Metabolic Disease
    Paricalcitol-d6 is the deuterium labeled Paricalcitol. Paricalcitol is a drug used for the prevention and treatment of secondary hyperparathyroidism (excessive secretion of parathyroid hormone) associated with chronic renal failure.
  • HY-113334
    Turanose

    Endogenous Metabolite Metabolic Disease Inflammation/Immunology
    Turanose is an isomer of Sucrose that naturally exists in honey. Turanose has anti-inflammatory and regulates adipogenesis effect. Turanose has potential for obesity and related chronic diseases research.
  • HY-B0674
    Ebastine

    LAS-W 090; RP64305

    Histamine Receptor Inflammation/Immunology Endocrinology
    Ebastine (LAS-W 090) is an orally active, second-generation histamine H1 receptor antagonist. Ebastine can be used for the symptoms of allergic rhinitis and chronic idiopathic urticaria research.
  • HY-P99323
    Timolumab

    BTT 1023; Anti-Human AOC3 Recombinant Antibody

    AP-1 Inflammation/Immunology
    Timolumab (BTT1023 ), a recombinant fully human monoclonal antibody that specifically binds VAP-1. Timolumab (BTT1023 ) could be used in the study of chronic inflammatory diseases.
  • HY-12515A
    Nicardipine hydrochloride

    YC-93

    Calcium Channel Autophagy Neurological Disease
    Nicardipine hydrochloride (YC-93) is a calcium channel blocker with an IC50 of 1 μM for blocking cardiac calcium channels. Nicardipine hydrochloride acts as an agent for chronic stable angina and for controlling blood pressure.
  • HY-137453
    Tenofovir amibufenamide

    HS-10234

    HBV Infection
    Tenofovir amibufenamide (HS-10234), a Tenofovir prodrug, is an orally active antiviral agent. Tenofovir amibufenamide inhibits HBV, and can be used for chronic hepatitis B (CHB) study.
  • HY-119304
    GW-406381

    COX Inflammation/Immunology Neurological Disease
    GW406381, a highly selective cyclooxygenase-2 (COX-2) inhibitor, attenuates spontaneous ectopic discharge in sural nerves of rats following chronic constriction injury.
  • HY-14777
    Radiprodil

    RGH-896

    iGluR Neurological Disease
    Radiprodil (RGH-896) is an orally active and selective NMDA NR2B antagonist. A potential therapeutic agent in treatment of neuropathic pain and possibly other chronic pain conditions.
  • HY-121398
    Dipivefrin

    Adrenergic Receptor Endogenous Metabolite Others
    Dipivefrin is a potent adrenergic agonist. Dipivefrin is an adrenergic pro-drug. Dipivefrin can be used for reduce IOP (intraocular pressure) in patients suffering from chronic open angle glaucoma.
  • HY-B0711
    Carglumic Acid

    N-Carbamyl-L-glutamic acid

    Others Cancer
    Carglumic acid (N-Carbamyl-L-glutamic acid), a functional analogue of N-acetylglutamate (NAG) and a carbamoyl phosphate synthetase 1 (CPS1) activator, is used to treat acute and chronic hyperammonemia associated with NAG synthase (NAGS) deficiency.
  • HY-19527
    IST5-002

    N6-Benzyladenosine-5'-phosphate

    STAT Apoptosis Cancer
    IST5-002, a potent Stat5a/b inhibitor, selectively inhibits transcriptional activity of Stat5a/b (IC50s: 1.5 μM for Stat5a, 3.5 μM for Stat5b). IST5-002 inducs cell apoptotic and death of prostate cancer cells and chronic myeloid leukemia (CML) cells. IST5-002 can be used in the research of prostate cancer and chronic myeloid leukemia (CML).
  • HY-147358
    Emitasvir diphosphate

    DAG181 diphosphate

    HCV Infection
    Emitasvir (DAG181) diphosphate is an orally active hepatitis C virus (HCV) nonstructural protein 5A (NS5A) inhibitor and can be used for research of chronic hepatitis C virus infection.
  • HY-13995AS
    Sevelamer-(d5)n hydrochloride

    FXR Autophagy Others
    Sevelamer-(d5)n hydrochloride is the deuterium labeled Sevelamer hydrochloride. Sevelamer hydrochloride is a phosphate binding drug used to treat hyperphosphatemia in patients with chronic kidney disease; consists of polyallylamine that is crosslinked with epichlorohydrin.
  • HY-W018791S
    Bifendate-d6

    DDB-d6

    HBV Infection
    Bifendate-d6 (DDB-d6) is the deuterium labeled Bifendate. Bifendate (DDB) is a synthetic intermediate of Schisandrin C with anti-HBV efficacy in research of chronic hepatitis B.
  • HY-132827
    Ocedurenone

    Mineralocorticoid Receptor Endocrinology
    Ocedurenone is a corticosteroid receptor antagonist. Ocedurenone can be used for the research of kidney disease (WO2018054357, compound I).
  • HY-N2746
    7-O-Geranylscopoletin

    7-Geranyloxy-6-methoxycoumarin

    Others Metabolic Disease Neurological Disease
    7-O-Geranylscopoletin is a coumarin from the root of Atalantia monophylla. Various parts of this plant have been used for folk medicine for several purposes such as chronic rheumatism, paralysis, antispasmodic, stimulant and hemiplegia.
  • HY-14538B
    Haloperidol lactate

    Others Neurological Disease
    Haloperidol lactate is a potent antipsychotic agent. Haloperidol lactate can be used in acute and chronic schizophrenia and gilles de la tourette's syndrome. Haloperidol lactate has the potential for the research of psychotic disorders.
  • HY-66011AS1
    Moxifloxacin-d3

    Bacterial Antibiotic Infection
    Moxifloxacin-d3 is the deuterium labeled Moxifloxacin. Moxifloxacin is an orally active 8-methoxyquinolone antimicrobial for use in the treatment of acute bacterial sinusitis, acute bacterial exacerbations of chronic bronchitis, and community-acquired pneumonia.
  • HY-14144
    Aclidinium Bromide

    LAS 34273; LAS-W 330

    mAChR Inflammation/Immunology
    Aclidinium Bromide (LAS 34273; LAS-W 330) is a long-acting, inhaled muscarinic antagonist. Aclidinium Bromide has the potential for chronic obstructive pulmonary disease (COPD) research.
  • HY-B0679S
    Lubiprostone-d7

    RU-0211-d7; SPI-0211-d7

    Chloride Channel Metabolic Disease
    Lubiprostone-d7 (RU-0211-d7) is the deuterium labeled Lubiprostone. Lubiprostone (RU0211) is a gastrointestinal agent used for the treatment of idiopathic chronic constipation.
  • HY-P0062A
    Ziconotide TFA

    SNX-111 TFA

    Calcium Channel Inflammation/Immunology Neurological Disease
    Ziconotide TFA (SNX-111 TFA), a peptide, is a potent and selective block of N-type calcium channels antagonist. Ziconotide TFA reduces synaptic transmission, and can be used for chronic pain research.
  • HY-112125
    KRN2

    Nuclear Factor of activated T Cells (NFAT) Inflammation/Immunology
    KRN2 is a selective inhibitor of nuclear factor of activated T cells (NFAT5), with an IC50 of 100 nM. KRN2 has potential to treat NFAT5-mediated Chronic Arthritis.
  • HY-12515
    Nicardipine

    YC-93 free base

    Calcium Channel Neurological Disease
    Nicardipine (YC-93 free base) is a calcium channel blocker with an IC50 of 1 μM for blocking cardiac calcium channels. Nicardipine acts as an agent for chronic stable angina and for controlling blood pressure.
  • HY-108704
    CT-721

    Bcr-Abl Cancer
    CT-721 is a potent and time-dependent Bcr-Abl kinase inhibitor with an IC50 of 21.3 nM for wild-type Bcr-Abl kinase, and possesses anti-chronic myeloid leukemia (CML) activities.
  • HY-122562
    MT-802

    PROTACs Btk Cancer Inflammation/Immunology
    MT-802 is a potent BTK degrader based on Cereblon ligand, with a DC50 of 1 nM. MT-802 has potential to treat C481S mutant chronic lymphocytic leukemia (CLL).
  • HY-106235
    LB80317

    HBV DNA/RNA Synthesis Infection
    LB80317 is an active metabolite of LB80380 and suppresses the DNA synthesis of HBV with an EC50 of 0.5 μM. LB80317 has antiviral effect and has the potential for chronic hepatitis B treatment.
  • HY-100009
    Ufenamate

    Flufenamic acid butyl ester; Butyl flufenamate

    Others Inflammation/Immunology
    Ufenamate (Flufenamic acid butyl ester) is an anthranilic acid-based anti-inflammatory agent. Ufenamate can be used for the research of skin diseases, such as acute and chronic eczema, contact dermatitis, diaper dermatitis, miliaria and atopic dermatitis.
  • HY-135398
    Decarboxy Moxifloxacin

    Bacterial Inflammation/Immunology Infection
    Decarboxy Moxifloxacin (compound 8) is a decarboxylated compound of Moxifloxacin. Moxifloxacin is an orally active 8-methoxyquinolone antimicrobial for use in acute bacterial sinusitis, acute bacterial exacerbations of chronic bronchitis, and community-acquired pneumonia.
  • HY-B0534
    Moclobemide

    Ro111163

    Monoamine Oxidase Neurological Disease
    Moclobemide (Ro111163) is a brain-penetrant and reversible monoamine oxidase (MAO-A) inhibitor with an IC50 of 6.061 μM for hMAO-A.Moclobemide up-regulates proliferation of hippocampal progenitor cells in chronically stressed mice.
  • HY-139589
    Zaloglanstat

    ISC-27864; GRC-27864

    PGE synthase Inflammation/Immunology Neurological Disease
    Zaloglanstat (ISC-27864) is the inhibitor of the microsomal prostaglandin E synthase-1 (mPGES-1), and can be used to study asthma, osteoarthritis, rheumatoid arthritis, acute or chronic pain and neurodegenerative diseases, etc.
  • HY-106198
    Lidorestat

    IDD-676

    Aldose Reductase Metabolic Disease
    Lidorestat (IDD-676) is a potent, selective and orally active aldose reductase inhibitor with an IC50 of 5 nM. Lidorestat can be used for chronic diabetes complications. Lidorestat also improves nerve conduction and reduces cataract formation.
  • HY-66011AS
    Moxifloxacin-d4

    Bacterial Antibiotic Infection
    Moxifloxacin-d4 is the deuterium labeled Moxifloxacin. Moxifloxacin is an orally active 8-methoxyquinolone antimicrobial for use in the treatment of acute bacterial sinusitis, acute bacterial exacerbations of chronic bronchitis, and community-acquired pneumonia.
  • HY-B0128
    Diphylline

    Diprophylline

    Adenosine Receptor Phosphodiesterase (PDE) Inflammation/Immunology Cardiovascular Disease
    Diphylline (Diprophylline) is a potent A1/A2 adenosine receptor antagonist and cyclic nucleotide phosphodiesterase inhibitor. Diphylline, a xanthine derivative, is a bronchodilator and vasodilator drug and has the potential for chronic bronchitis and emphysema.
  • HY-113904S
    (Rac)-Tenofovir-d6

    Reverse Transcriptase HIV HBV Infection
    (Rac)-Tenofovir-d6 ((Rac)-GS 1278-d6) is a labelled racemic Tenofovir. Tenofovir (GS 1278) is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B (HBV).
  • HY-B0405
    Bupivacaine

    iGluR Sodium Channel Calcium Channel Potassium Channel Neurological Disease Cancer
    Bupivacaine is a NMDA receptor inhibitor.Bupivacaine can block sodium, L-calcium, and potassium channels.Bupivacaine potently blocks SCN5A channels with the IC50 of 69.5 μM. Bupivacaine can be used for the research of chronic pain.
  • HY-B0405A
    Bupivacaine hydrochloride

    iGluR Sodium Channel Calcium Channel Potassium Channel Cancer Neurological Disease
    Bupivacaine hydrochloride is a NMDA receptor inhibitor.Bupivacaine can block sodium, L-calcium, and potassium channels.Bupivacaine potently blocks SCN5A channels with the IC50 of 69.5 μM. Bupivacaine hydrochloride can be used for the research of chronic pain.
  • HY-106564A
    Flutropium bromide

    Ba 598Br; Flubron

    Others Inflammation/Immunology
    Flutropium bromide (Ba 598Br) is a organic bromide salt of flutropium. Flutropium bromide shows an anticholinergic effect. Flutropium bromide effectively suppresses spasms and it can be used for the research of asthma and chronic obstructive pulmonary disease.
  • HY-13693
    Mometasone furoate

    Sch32088

    Glucocorticoid Receptor Inflammation/Immunology Endocrinology
    Mometasone furoate (Sch32088) is a glucocorticoid receptor agonist with anti-inflammatory and anti-allergic activity. Mometasone furoate acts as a corticosteroid agent and used for topical applications in chronic skin eczema and airway inflammation management of asthma in vivo
  • HY-B0801AS
    Fexofenadine-d10 hydrochloride

    MDL-16455-d10 hydrochloride; Terfenadine carboxylate-d10 hydrochloride

    Histamine Receptor Inflammation/Immunology Endocrinology
    Fexofenadine-d10 (hydrochloride) is deuterium labeled Fexofenadine (hydrochloride). Fexofenadine hydrochloride (MDL-16455 hydrochloride), a H1R antagonist, is an anti-allergic agent used in seasonal allergic rhinitis and chronic idiopathic urticarial (person aged ≥16 years).
  • HY-151164
    LasR-IN-2

    Bacterial Infection
    LasR-IN-2 is a LasR inhibitor that forms H-bonding with TRY-56 residue. LasR-IN-2 can be used in the research of bacterial infection, neutropenia, severe burns and chronic lung disease in cystic fibrosis (CF).
  • HY-W018772S6
    D-Ribose-d

    Endogenous Metabolite Inflammation/Immunology Cancer
    D-Ribose-d is the deuterium labeled D-Ribose. D-Ribose is an energy enhancer, and acts as a sugar moiety of ATP, and widely used as a metabolic therapy supplement for chronic fatigue syndrome or cardiac energy metabolism. D-Ribose is active in protein gly
  • HY-103165
    PSB-0788

    Adenosine Receptor Cancer Infection
    PSB-0788 is a new selective high-affinity A2B antagonist with IC50 value of 3.64 nM and Ki value of 0.393 nM, respeactively. PSB-0788 can be used for the research for chronic inflammatory lung diseases.
  • HY-66011AS2
    Moxifloxacin-d3 hydrochloride

    Bacterial Antibiotic Cancer Infection
    Moxifloxacin-d3 hydrochloride is the deuterium labeled Moxifloxacin hydrochloride. Moxifloxacin hydrochloride is an orally active 8-methoxyquinolone antimicrobial for use in the treatment of acute bacterial sinusitis, acute bacterial exacerbations of chronic bronchitis, and community-acquired pneumonia.
  • HY-112126
    KRN5

    Nuclear Factor of activated T Cells (NFAT) Inflammation/Immunology
    KRN5, a derivative of KRN2, is an oral active Nuclear factor of activated T cells 5 (NFAT5) suppressor, with an IC50 of 750 nM. KRN5 has potential to treat NFAT5-mediated Chronic Arthritis.
  • HY-B0382S
    Fosinopril-d5 sodium

    Angiotensin-converting Enzyme (ACE) Cardiovascular Disease
    Fosinopril-d5 sodium (SQ28555-d5 sodium) is the deuterium labeled Fosinopril sodium. Fosinopril Sodium is the ester prodrug of an angiotensin-converting enzyme (ACE) inhibitor, used for the treatment of hypertension and some types of chronic heart failure.
  • HY-N8168
    LPRP-Et-97543

    HBV Infection
    LPRP-Et-97543 is a potent anti-HBV agent. LPRP-Et-97543 reduces Core, S, and preS but not X promoter activities. LPRP-Et-97543 can be used for acute and chronic HBV infections research.
  • HY-P99505
    Ziltivekimab

    COR-001

    Interleukin Related Inflammation/Immunology Cardiovascular Disease
    Ziltivekimab (COR-001) is a human anti-IL-6 monoclonal antibody that is effective in reducing serum CRP. Ziltivekimab has anti-inflammatory activity and may be used in studies of chronic systemic inflammation and cardiovascular disease associated with CKD.
  • HY-B2078A
    Eprazinone dihydrochloride

    Neurokinin Receptor Inflammation/Immunology
    Eprazinone dihydrochloride is a gent with mucolytic, secretolytic, antitussive, and bronchial antispasmodic properties. Eprazinone dihydrochloride is a neurokinin 1 receptor (NK1R) ligand. Eprazinone dihydrochloride has the potential for chronic bronchitis treatment that improved pulmonary function and arterial partial pressure of oxygen.
  • HY-111646
    N6-Etheno 2'-deoxyadenosine

    Nucleoside Antimetabolite/Analog Endogenous Metabolite Inflammation/Immunology
    N6-Etheno 2'-deoxyadenosine is a reactive oxygen species (ROS)/reactive nitrogen species (RNS)-induced DNA oxidation product, used as a biomarker to evaluate chronic inflammation and lipid peroxidation in animal or human tissues.
  • HY-121826
    Naronapride

    ATI-7505

    5-HT Receptor Metabolic Disease Inflammation/Immunology
    Naronapride (ATI-7505) is a potent prokinetic 5-HT4 receptor agonist. Naronapride can be used for gastrointestinal diseases research.
  • HY-134189A
    EST73502 monohydrochloride

    Sigma Receptor Opioid Receptor Neurological Disease
    EST73502 monohydrochloride is a selective, orally active and blood-brain barrier (BBB) penetrant dual μ-opioid receptor (MOR) agonist and σ1 receptor (σ1R) antagonist, with Kis of 64 nM and 118 nM for MOR and σ1R, respectively. EST73502 monohydrochloride has antinociceptive activity.
  • HY-123159
    AKI603

    Aurora Kinase Cancer
    AKI603 is an inhibitor of Aurora kinase A (AurA), with an IC50 of 12.3 nM. AKI603 is developed to overcome resistance mediated by BCR-ABL-T315I mutation. AKI603 exhibits strong anti-proliferative activity in leukemic cells.
  • HY-134189
    EST73502

    Opioid Receptor Sigma Receptor Neurological Disease
    EST73502 is a selective, orally active and blood-brain barrier (BBB) penetrant dual μ-opioid receptor (MOR) agonist and σ1 receptor (σ1R) antagonist, with Kis of 64 nM and 118 nM for MOR and σ1R, respectively. EST73502 has antinociceptive activity.
  • HY-B1735
    Picotamide

    Prostaglandin Receptor Cardiovascular Disease
    Picotamide is a combined inhibitor of thromboxane A2 (TxA2) synthase and receptor. Picotamide has antiplatelet activity. Picotamide promotes the reduction of microalbuminuria and the inhibition of growth of carotid plaques in diabetes. Picotamide can be used for researching acute or chronic cardiovascular diseases.
  • HY-W018772S9
    D-Ribose-d-3

    Endogenous Metabolite Inflammation/Immunology Cancer
    D-Ribose-d-3 is the deuterium labeled D-Ribose. D-Ribose is an energy enhancer, and acts as a sugar moiety of ATP, and widely used as a metabolic therapy supplement for chronic fatigue syndrome or cardiac energy metabolism. D-Ribose is active in protein g
  • HY-W018772S12
    D-Ribose-d6

    Endogenous Metabolite Inflammation/Immunology Cancer
    D-Ribose-d6 is the deuterium labeled D-Ribose. D-Ribose is an energy enhancer, and acts as a sugar moiety of ATP, and widely used as a metabolic therapy supplement for chronic fatigue syndrome or cardiac energy metabolism. D-Ribose is active in protein gl
  • HY-B1037S
    Salbutamol-d3

    Albuterol-d3; AH-3365-d3

    Adrenergic Receptor Neurological Disease Endocrinology
    Salbutamol-d3 (Albuterol-d3) is the deuterium labeled Salbutamol. Salbutamol is a short-acting β2-adrenergic receptor agonist used for the relief of bronchospasm in conditions such as asthma and chronic obstructive pulmonary disease (COPD).
  • HY-W018772S10
    D-Ribose-d2

    Endogenous Metabolite Inflammation/Immunology Cancer
    D-Ribose-d2 is the deuterium labeled D-Ribose. D-Ribose is an energy enhancer, and acts as a sugar moiety of ATP, and widely used as a metabolic therapy supplement for chronic fatigue syndrome or cardiac energy metabolism. D-Ribose is active in protein gl
  • HY-W018772S14
    D-Ribose-d5

    Endogenous Metabolite Inflammation/Immunology Cancer
    D-Ribose-d5 is the deuterium labeled D-Ribose. D-Ribose is an energy enhancer, and acts as a sugar moiety of ATP, and widely used as a metabolic therapy supplement for chronic fatigue syndrome or cardiac energy metabolism. D-Ribose is active in protein gl
  • HY-128757
    Remibrutinib

    Btk Inflammation/Immunology
    Remibrutinib, is a potent and orally active bruton tyrosine kinase (BTK) inhibitor with an IC50 value of 1 nM. Remibrutinib inhibits BTK activity with an IC50 value of 0.023 μM in blood. Remibrutinib has the potential for Chronic urticaria (CU) treatment.
  • HY-W018772S8
    D-Ribose-d-2

    Endogenous Metabolite Inflammation/Immunology Cancer
    D-Ribose-d-2 is the deuterium labeled D-Ribose. D-Ribose is an energy enhancer, and acts as a sugar moiety of ATP, and widely used as a metabolic therapy supplement for chronic fatigue syndrome or cardiac energy metabolism. D-Ribose is active in protein g
  • HY-W018772S7
    D-Ribose-d-1

    Endogenous Metabolite Inflammation/Immunology Cancer
    D-Ribose-d-1 is the deuterium labeled D-Ribose. D-Ribose is an energy enhancer, and acts as a sugar moiety of ATP, and widely used as a metabolic therapy supplement for chronic fatigue syndrome or cardiac energy metabolism. D-Ribose is active in protein g
  • HY-B1037S2
    Salbutamol-d9

    Albuterol-d9; AH-3365-d9

    Adrenergic Receptor Neurological Disease Endocrinology
    Salbutamol-d9 (Albuterol-d9) is the deuterium labeled Salbutamol. Salbutamol is a short-acting β2-adrenergic receptor agonist used for the relief of bronchospasm in conditions such as asthma and chronic obstructive pulmonary disease (COPD).
  • HY-12515AS
    Nicardipine-d3 hydrochloride

    YC-93-d3

    Calcium Channel Neurological Disease
    Nicardipine D3 hydrochloride (YC-93 D3) is the deuterium labeled Nicardipine hydrochloride. Nicardipine hydrochloride is a calcium channel blocker with an IC50 of 1 μM for blocking cardiac calcium channels. Nicardipine hydrochloride acts as an agent for chronic stable angina and for controlling blood pressure.
  • HY-112713
    SMS2-IN-2

    Others Inflammation/Immunology
    SMS2-IN-2 is a potent, highly selective and orally active sphingomyelin synthase 2 (SMS2) inhibitor, with IC50s of 100 nM and 56 μM for SMS2 and SMS1, respectively. Anti-chronic inflammatory activity.
  • HY-109177
    Icenticaftor

    QBW251

    CFTR Inflammation/Immunology
    Icenticaftor (QBW251) is an orally active CFTR channel potentiator, with EC50s of 79 nM and 497 nM for F508del and G551D CFTR, respectively. Icenticaftor can be used for chronic obstructive pulmonary disease (COPD) and cystic fibrosis research.
  • HY-12515B
    (S)-Nicardipine

    (S)-YC-93 free base

    Calcium Channel Neurological Disease Cardiovascular Disease
    (S)-Nicardipine ((S)-YC-93 free base) is the less active S enantiomer of Nicardipine. Nicardipine is a calcium channel blocker with an IC50 of 1 μM for blocking cardiac calcium channels. Nicardipine acts as an agent for chronic stable angina and for controlling blood pressure.
  • HY-107355
    Letosteine

    Others Inflammation/Immunology
    Letosteine is an orally active, potent and safe expectorant. Letosteine dissolves bronchial mucus and reduces respiratory inflammation symptoms, and restores gas exchanges and natural defense mechanisms in the lung. Letosteine can be used for acute or chronic respiratory diseases (such as bronchopneumopathies) research[1][2][3].
  • HY-13641
    Mitobronitol

    Myelobromol; DBM

    DNA Alkylator/Crosslinker Cancer
    Mitobronitol (Myelobromol; DBM) is a brominated analog of mannitol, also known as an anticancer agent that is classified as an alkylating agent. Mitobronitol has potential for myelosuppression associated with significantly decreased risk for several complications of allogeneic bone marrow transplantation in accelerated chronic granulocytic leukemia.
  • HY-66011S
    rac cis-Moxifloxacin-d4 hydrochloride

    Bacterial Antibiotic Infection
    rac cis-Moxifloxacin-d4 hydrochloride is the deuterium labeled Moxifloxacin hydrochloride. Moxifloxacin Hydrochloride (BAY 12-8039) is an oral 8-methoxyquinolone antimicrobial for use in the treatment of acute bacterial sinusitis, acute bacterial exacerbations of chronic bronchitis, and community-acquired pneumonia.
  • HY-19447A
    Besifovir Dipivoxil maleate

    LB80380 maleate

    HBV Infection
    Besifovir Dipivoxil maleate (LB80380 maleate) is an oral prodrug of LB80317. Besifovir Dipivoxil maleate (LB80380 maleate) is effective in hepatitis B virus (HBV) DNA suppression for both treatment-naive and lamivudine-resistant chronic hepatitis B (CHB) patients in preliminary studies[2]
  • HY-14189
    Valategrast hydrochloride

    R-411

    Integrin Inflammation/Immunology
    Valategrast hydrochloride (R-411) is a potent integrin α4β1 (VLA-4) and α4β7 dual antagonist. Valategrast hydrochloride has the potential for Chronic obstructive pulmonary disease (COPD) and asthma treatment.
  • HY-122515
    Fulvic Acid

    Others Metabolic Disease Inflammation/Immunology
    Fulvic Acid is a natural product, which comes from humic substances produced by microorganisms in soil. Fulvic Acid can modulate the immune system, influence the oxidative state of cells, and improve gastrointestinal function. Fulvic Acid has the potential for researching chronic inflammatory diseases, including diabetes.
  • HY-116229
    Gemifloxacin

    SB-265805; LB20304

    Antibiotic Bacterial Infection
    Gemifloxacin, a fluoroquinolone, is a potent and orally active antipneumococcal agent. Gemifloxacin shows bactericidal activity against highly quinolone-resistant pneumococci.Gemifloxacin can be used for the research of respiratory infections, such as community-acquired pneumonia (CAP) and acute exacerbation of chronic bronchitis (AECB).
  • HY-147374
    Bromodomain inhibitor-9

    Epigenetic Reader Domain Metabolic Disease Inflammation/Immunology
    Bromodomain inhibitor-9 is a Bromodomains inhibitor that selectively inhibits BRD4-1 (Kd: 12 nM). Bromodomain inhibitor-9 can be used in the research of diseases or conditions associated with systemic or tissue inflammation, lipid metabolism, fibrosis or chronic autoimmune diseases.
  • HY-136205
    IA-Alkyne

    Iodoacetamide-alkyne; N-Hex-5-ynyl-2-iodo-acetamide

    TRP Channel Infection Inflammation/Immunology
    IA-Alkyne (Iodoacetamide-alkyne; N-Hex-5-ynyl-2-iodo-acetamide) is a TRP channel (TRPC) agonist and has the potential for the study of respiratory infection. IA-Alkyne can be used to develop an isotopically tagged probe for quantitative cysteine-reactivity profiling.
  • HY-W018772S
    D-Ribose-18O

    Endogenous Metabolite Inflammation/Immunology Cancer
    D-Ribose-18O is the 18O labeled D-Ribose. D-Ribose is an energy enhancer, and acts as a sugar moiety of ATP, and widely used as a metabolic therapy supplement for chronic fatigue syndrome or cardiac energy metabolism. D-Ribose is active in protein glycati
  • HY-100226
    A-205804

    Integrin Inflammation/Immunology
    A-205804 is an orally bioavailable, potent and selective lead inhibitor of E-selectin and ICAM-1 expression, with an IC50 of 20 nM and 25 nM for E-selectin and ICAM-1, respectively. A-205804 can be used in the research of chronic inflammatory diseases.
  • HY-W018772S1
    D-Ribose-13C

    Endogenous Metabolite Inflammation/Immunology Cancer
    D-Ribose-13C is the 13C labeled D-Ribose. D-Ribose is an energy enhancer, and acts as a sugar moiety of ATP, and widely used as a metabolic therapy supplement for chronic fatigue syndrome or cardiac energy metabolism. D-Ribose is active in protein glycati
  • HY-W018772S11
    D-Ribose-13C,d

    Endogenous Metabolite Inflammation/Immunology Cancer
    D-Ribose-13C,d is the deuterium and 13C labeled D-Ribose. D-Ribose is an energy enhancer, and acts as a sugar moiety of ATP, and widely used as a metabolic therapy supplement for chronic fatigue syndrome or cardiac energy metabolism. D-Ribose is active in
  • HY-B0534S1
    Moclobemide-d4

    Ro111163-d4

    Monoamine Oxidase Neurological Disease
    Moclobemide-d4 is deuterium labeled Moclobemide. Moclobemide (Ro111163) is a brain-penetrant and reversible monoamine oxidase (MAO-A) inhibitor with an IC50 of 6.061 μM for hMAO-A.Moclobemide up-regulates proliferation of hippocampal progenitor cells in chronically stressed mice.
  • HY-P9970
    Infliximab

    Avakine; CT-P13

    TNF Receptor Bacterial Metabolic Disease Inflammation/Immunology Neurological Disease Cancer
    Infliximab (Avakine) is a chimeric monoclonal IgG1 antibody that specifically binds to TNF-α. Infliximab prevents the interaction of TNF-α with TNF-α receptor (TNFR1 and TNFR2). Infliximab has the potential for autoimmune, chronic inflammatory diseases and diabetic neuropathy research.
  • HY-147152
    1-Myristoyl-3-chloropropanediol

    Others Others
    1-Myristoyl-3-chloropropanediol is a 3-monochloropropanediol (3-MCPD) fatty acid ester. 3-MPCD causes nephropathy and tubular hyperplasia and adenomas by chronic oral administration; also reduces fertility, or provokes infertility in rats and suppresses the immune function.
  • HY-19672
    Lirimilast

    BAY 19-8004

    Phosphodiesterase (PDE) Inflammation/Immunology
    Lirimilast (BAY 19-8004) is a potent, selective and orally active phosphodiesterase-4 (PDE4) inhibitor with an IC50 value of 49 nM. Lirimilast can be used for the treatment of asthma or chronic obstructive pulmonary disease (COPD). Lirimilast has potently anti-inflammatory properties.
  • HY-P99019
    Fremanezumab

    TEV-48125

    CGRP Receptor Neurological Disease
    Fremanezumab (TEV-48125) is a humanized IgG2a monoclonal antibody that selectively and potently binds to calcitonin gene-related peptide (CGRP). CGRP is a 37-amino acid neuropeptide involved in central and peripheral pathophysiological events of migraine. Fremanezumab has the potential for chronic migraine research.
  • HY-133654
    2,3,3-Tribromopropenoic acid

    Others Others
    2,3,3-Tribromopropenoic acid is a 2,3,3-Tribromo product based on propenoic acid. 2,3,3-Tribromopropenoic acid is a polar aromatic brominated disinfection byproduct during chlorination in water and shows cytotoxic potency in mammalian cell chronic cytotoxicity experiments.
  • HY-120897
    NS-3-008 hydrochloride

    Others Inflammation/Immunology
    NS-3-008 hydrochloride is an orally active transcriptional inhibitor of G0/G1 switch 2 (G0s2) with an IC50 of 2.25 μM. NS-3-008 hydrochloride can be used for chronic kidney disease.
  • HY-B1002
    Oxolinic acid

    Bacterial Antibiotic DNA/RNA Synthesis Infection
    Oxolinic acid is an antibiotic against both Gram-negative and Gram-positive bacteria. Oxolinic acid can be used for the research of acute and chronic urinary tract infections. Oxolinic acid is a DNA/RNA synthesis inhibitor. Oxolinic acid acts a dopamine uptake inhibitor and stimulants locomotor effect in mice.
  • HY-126143
    CHMFL-ABL-039

    Bcr-Abl Cancer
    CHMFL-ABL-039 is a type II native ABL kinase and drug-resistant V299L mutant BCR-ABL inhibitor with the IC50s of 7.9 nM and 27.9 nM, respectively. CHMFL-ABL-039 is used in the research of chronic myeloid leukemia.
  • HY-B0405S
    Bupivacaine-d9

    iGluR Sodium Channel Calcium Channel Potassium Channel Neurological Disease
    Bupivacaine-d9 is a deuterium labeled Bupivacaine. Bupivacaine is a NMDA receptor inhibitor.Bupivacaine can block sodium, L-calcium, and potassium channels.Bupivacaine potently blocks SCN5A channels with the IC50 of 69.5 μM. Bupivacaine can be used for the research of chronic pain.
  • HY-B0725A
    Doxepin

    mTOR PI3K Akt Neurological Disease
    Doxepin inhibits reuptake of serotonin and norepinephrine as a tricyclic antidepressant. Doxepin has therapeutic effects in atopic dermatitis,chronic urticarial,can improve cognitive processes, protect central nervous system. Doxepin has also been proposed as a protective factor against oxidative stress.
  • HY-143481
    Nav1.8-IN-2

    Sodium Channel Neurological Disease
    Nav1.8-IN-2 (compound 35A) is a potent Nav1.8 inhibitor with an IC50 value of 0.4 nM. Nav1.8-IN-2 can be used for researching pain disorders, cough disorders, and acute and chronic itch disorders.
  • HY-W018772S13
    D-Ribose-13C,d-1

    Endogenous Metabolite Inflammation/Immunology Cancer
    D-Ribose-13C,d-1 is the deuterium and 13C labeled D-Ribose. D-Ribose is an energy enhancer, and acts as a sugar moiety of ATP, and widely used as a metabolic therapy supplement for chronic fatigue syndrome or cardiac energy metabolism. D-Ribose is active
  • HY-146309
    iNOS-IN-2

    NO Synthase Inflammation/Immunology
    iNOS-IN-2 (Compound 53) is a potent down-regulator of inducible nitric oxide synthase (iNOS) protein. iNOS-IN-2 effectively inhibits the NO production (IC50=6.4 μM). iNOS-IN-2 has a potential therapeutic effect on chronic inflammation.
  • HY-12515C
    (R)-Nicardipine

    (R)-YC-93 free base

    Calcium Channel Neurological Disease Cardiovascular Disease
    (R)-Nicardipine ((R)-YC-93 free base) is the less active R enantiomer of Nicardipine. Nicardipine (YC-93) is a calcium channel blocker with an IC50 of 1 μM for blocking cardiac calcium channels. Nicardipine acts as an agent for chronic stable angina and for controlling blood pressure.
  • HY-W018772S2
    D-Ribose-13C-1

    Endogenous Metabolite Inflammation/Immunology Cancer
    D-Ribose-13C-1 is the 13C labeled D-Ribose. D-Ribose is an energy enhancer, and acts as a sugar moiety of ATP, and widely used as a metabolic therapy supplement for chronic fatigue syndrome or cardiac energy metabolism. D-Ribose is active in protein glyca
  • HY-W018772
    D-Ribose(mixture of isomers)

    Endogenous Metabolite Inflammation/Immunology Cancer
    D-Ribose(mixture of isomers) is an energy enhancer, and acts as a sugar moiety of ATP, and widely used as a metabolic therapy supplement for chronic fatigue syndrome or cardiac energy metabolism. D-Ribose(mixture of isomers) is active in protein glycation, induces NF-κB inflammation in a RAGE-dependent manner.
  • HY-W018772S4
    D-Ribose-13C-3

    Endogenous Metabolite Inflammation/Immunology Cancer
    D-Ribose-13C-3 is the 13C labeled D-Ribose. D-Ribose is an energy enhancer, and acts as a sugar moiety of ATP, and widely used as a metabolic therapy supplement for chronic fatigue syndrome or cardiac energy metabolism. D-Ribose is active in protein glyca
  • HY-W018772S5
    D-Ribose-13C-4

    Endogenous Metabolite Inflammation/Immunology Cancer
    D-Ribose-13C-4 is the 13C labeled D-Ribose. D-Ribose is an energy enhancer, and acts as a sugar moiety of ATP, and widely used as a metabolic therapy supplement for chronic fatigue syndrome or cardiac energy metabolism. D-Ribose is active in protein glyca
  • HY-B0024
    Prulifloxacin

    NM441

    Bacterial Antibiotic Infection
    Prulifloxacin (NM441) is an orally active fluoroquinolone antibiotic with a broad spectrum of activity against Gram-positive and -negative bacteria. Prulifloxacin is a prodrug of a thiazeto-quinoline carboxylic acid derivative Ulifloxacin (NM394). Prulifloxacin has the potential for lower urinary tract infections and exacerbations of chronic bronchitis.
  • HY-107591B
    PF-184

    IKK Inflammation/Immunology
    PF-184 is a potent and selective IKK-2 inhibitor (IC50: 37 nM) over rhIKK-1, IKKi, and more than 30 tyrosine and serine/threonine kinases. PF-184 can be used in the research of inflammation, such as asthma and chronic obstructive pulmonary disease.
  • HY-W018772S3
    D-Ribose-13C-2

    Endogenous Metabolite Inflammation/Immunology Cancer
    D-Ribose-13C-2 is the 13C labeled D-Ribose. D-Ribose is an energy enhancer, and acts as a sugar moiety of ATP, and widely used as a metabolic therapy supplement for chronic fatigue syndrome or cardiac energy metabolism. D-Ribose is active in protein glyca
  • HY-15790A
    Elobixibat hydrate

    A 3309 hydrate; AZD 7806 hydrate

    Others Metabolic Disease
    Elobixibat hydrate is a potent ileal bile acid transporter (IBAT) inhibitor, with IC50 values of 0.53 ± 0.17 nM, 0.13 ± 0.03 nM, and 5.8 ± 1.6 nM for human IBAT, mouse IBAT, and canine IBAT. Elobixibat hydrate can be used for chronic idiopathic constipation (CIC) research.
  • HY-139147
    iHCK-37

    ASN05260065

    Src Cancer Infection
    iHCK-37 (ASN05260065) is a potent and specific Hck inhibitor with a Ki value of 0.22 μM. iHCK-37 blocks HIV-1 viral replication with an EC50 value of 12.9 μM. iHCK-37 is used for chronic myeloid leukemia (CML) research.
  • HY-N1478
    Gardenoside

    P2X Receptor Neurological Disease
    Gardenoside is a natural compound found in Gardenia fruits, with hepatoprotective properties. Gardenoside suppresses the pain of chronic constriction injury by regulating the P2X3 and P2X7 receptors. Gardenoside has an inhibitory effect on free fatty acids (FFA)-induced cellular steatosis.
  • HY-14190
    Valategrast

    R-411 free base

    Integrin Inflammation/Immunology
    Valategrast (R-411 free base) is a potent and orally active integrin α4β1 (VLA-4) and α4β7 dual antagonist. Valategrast has the potential for Chronic obstructive pulmonary disease (COPD) and asthma treatment.
  • HY-151211
    BTK-IN-16

    Btk Cancer Inflammation/Immunology
    BTK-IN-16 is a dual inhibitor of BTK wild type and C481S mutant of Bruton’s tyrosine kinase (BTK) with IC50s of 5.1 and 4.1 μM. BTK-IN-16 can be used for the research of autoimmune diseases and chronic lymphocytic leukemia.
  • HY-108323
    CCR2 antagonist 4

    Teijin compound 1

    CCR Inflammation/Immunology
    CCR2 antagonist 4 (Teijin compound 1) is a potent and specific CCR2 antagonist, with IC50s of 180 nM for CCR2b. CCR2 antagonist 4 potently inhibits MCP-1-induced chemotaxis with an IC50 of 24 nM.
  • HY-138885
    Tryptamine guanosine carbamate

    TpGc

    Others Neurological Disease
    Tryptamine guanosine carbamate (TpGc) is a selective HINT1 (histidine triad nucleotide-binding protein 1) inhibitor (Ki=34 μM, Kd=3.65 μM). Tryptamine guanosine carbamate significantly enhances morphine antinociception while preventing the development of tolerance.
  • HY-103362
    CCR2 antagonist 4 hydrochloride

    Teijin compound 1 hydrochloride

    CCR Inflammation/Immunology
    CCR2 antagonist 4 hydrochloride (Teijin compound 1 hydrochloride) is a potent and specific CCR2 antagonist, with IC50s of 180 nM for CCR2b. CCR2 antagonist 4 hydrochloride potently inhibits MCP-1-induced chemotaxis with an IC50 of 24 nM.
  • HY-B1675A
    Levalbuterol hydrochloride

    (R)-Albuterol hydrochloride; (R)-Salbutamol hydrochloride; Levosalbutamol hydrochloride

    Adrenergic Receptor Inflammation/Immunology
    Levalbuterol ((R)-Albuterol) hydrochloride is a short-acting β2-adrenergic receptor agonist and the active (R)-enantiomer of Salbutamol. Levalbuterol hydrochloride is a more potent bronchodilator than Salbutamol and has the potential for the treatment of COPD.
  • HY-101268
    CHMFL-ABL-053

    Bcr-Abl Src p38 MAPK Cancer
    CHMFL-ABL-053 (Compound 18a) is a potent, selective, and orally available BCR-ABL, SRC and p38 kinase inhibitor with IC50 values of 70, 90 and 62 nM against ABL1, SRC and p38, respectively.
  • HY-W013812
    Ethyl linoleate

    Linoleic Acid ethyl ester; Mandenol

    Others Cardiovascular Disease
    Ethyl linoleate (Linoleic Acid ethyl ester) inhibit the development of atherosclerotic lesions and the expression of inflammatory mediators.
  • HY-B1675
    Levalbuterol

    (R)-Albuterol; (R)-Salbutamol; Levosalbutamol

    Adrenergic Receptor Inflammation/Immunology
    Levalbuterol ((R)-Albuterol; (R)-Salbutamol) is a short-acting β2-adrenergic receptor agonist and the active (R)-enantiomer of Salbutamol. Levalbuterol is a more potent bronchodilator than Salbutamol and has the potential for the treatment of COPD.
  • HY-116099
    ER-819762

    Prostaglandin Receptor Inflammation/Immunology
    ER-819762 is an orally active, highly selective prostaglandin E2 (PGE2) EP4 receptor antagonist with an EC50 of 70 nM against human EP4 receptor. ER-819762 can be used for rheumatoid arthritis research.
  • HY-A0154
    Deslanoside

    Deacetyllanatoside C; Desacetyllanatoside C

    Na+/K+ ATPase Drug Metabolite Cardiovascular Disease
    Deslanoside (Desacetyllanatoside C) is a rapidly acting cardiac glycoside used to treat congestive heart failure and supraventricular arrhythmias due to reentry mechanisms, and to control ventricular rate in the treatment of chronic atrial fibrillation. Deslanoside inhibits the Na-K-ATPase membrane pump, resulting in an increase in intracellular sodium and calcium concentrations .
  • HY-P3970
    KRFK

    TGF-β Receptor Inflammation/Immunology
    KRFK, a peptide derived from TSP-1, can activate TGF-β. KRFK promotes TGF-β-mediated signaling and its downstream role, independent of thrombospondin (TSP) receptors such as CD47 and CD36. KRFK can be used for chronic ocular surface inflammatory disorders reseach.
  • HY-A0270
    Diphenidol

    Others Neurological Disease
    Diphenidol is an orally active antiemetic. Diphenidol reduces abnormal neuropathic pain and TNF-α overexpression in rats following chronic compression injury. Diphenidol also has local anaesthetic activity and inhibits sodium currents. Diphenidol can be used in studies of meniere′s disease, anti-vertigo, antiemetic and analgesia.
  • HY-W010841
    Levocetirizine dihydrochloride

    (R)-Cetirizine dihydrochloride

    Histamine Receptor Endocrinology Inflammation/Immunology
    Levocetirizine dihydrochloride ((R)-Cetirizine dihydrochloride) is a third-generation peripheral H1-receptor antagonist. Levocetirizine dihydrochloride is an antihistaminic agent which is the R-enantiomer of Cetirizine. Levocetirizine dihydrochloride has a higher affinity for the histamine H1-receptor than (S)-Cetirizine and can effectively treat allergic rhinitis and chronic idiopathic urticaria.
  • HY-B0814
    Levocetirizine

    (R)-Cetirizine

    Histamine Receptor Inflammation/Immunology Endocrinology
    Levocetirizine ((R)-Cetirizine) is a third-generation peripheral H1-receptor antagonist. Levocetirizine is an antihistaminic agent which is the R-enantiomer of Cetirizine. Levocetirizine has a higher affinity for the histamine H1-receptor than (S)-Cetirizine and can effectively treat allergic rhinitis and chronic idiopathic urticaria.
  • HY-107046
    UK-432097

    Adenosine Receptor Inflammation/Immunology
    UK-432097 is a highly potent and selective A2AAR agonist with a pKi of 8.4 for human A2AAR. UK-432097 has anti-inflammatory and anti-aggregatory properties. UK-432097 has the potential for COPD (Chronic Obstructive Pulmonary Disease) research.
  • HY-119708
    Ensifentrine

    RPL-554

    Phosphodiesterase (PDE) Inflammation/Immunology
    Ensifentrine (RPL-554) is an inhaled first-in-class dual inhibitor of phosphodiesterase 3 (PDE3) and PDE4 with IC50s of 0.4 nM and 1479 nM, respectively. Ensifentrine has bronchoprotective and anti-inflammatory activities. Ensifentrine can be used for chronic obstructive pulmonary disease (COPD) research.
  • HY-B0205
    Candesartan

    CV 11974

    Angiotensin Receptor PPAR Cardiovascular Disease Endocrinology Cancer
    Candesartan (CV 11974) is an orally active angiotensin II AT1-Receptor blocker and PPAR-γ agonist. Candesartan has potent and long-lasting antihypertensive effects. Candesartan can be used for the research of hypertension, chronic heart failure (CHF) and Traumatic brain injury (TBI).
  • HY-B0674S
    Ebastine-d5

    Histamine Receptor Inflammation/Immunology Endocrinology
    Ebastine-d5 (LAS-W 090-d5) is the deuterium labeled Ebastine. Ebastine (LAS-W 090) is an orally active, second-generation histamine H1 receptor antagonist. Ebastine can be used for the symptoms of allergic rhinitis and chronic idiopathic urticaria research.
  • HY-N0794
    Proanthocyanidins

    Bacterial Fungal Cancer Infection Inflammation/Immunology Cardiovascular Disease
    Proanthocyanidins are a class of polyphenolic that are widely distributed in higher plants, consisted of an electrophilic flavanyl unit. Proanthocyanidins can be used as antioxidant and anti-cancers agent. Proanthocyanidins also exhibit anti-inflammatory, cardioprotective, antibacterial and antifungal properties, which can be used in the treatment of chronic venous insufficiency, capillary fragility, sunburn and retinopathy..
  • HY-129240S
    13-cis Acitretin-d3

    Isoacitretin D3; Ro 13-7652 D3

    Drug Metabolite Inflammation/Immunology
    13-cis Acitretin D3 (Isoacitretin D3) is a deuterium labeled 13-cis Acitretin. 13-cis Acitretin is the metabolite of Acitretin after chronic administration. Acitretin(Ro 10-1670) is a second-generation, systemic retinoid that has been used in the treatment of psoriasis.
  • HY-B1810
    Tulobuterol

    C-78 free base

    Adrenergic Receptor Inflammation/Immunology Endocrinology
    Tulobuterol (C-78 free base) is a long-acting β2-adrenoceptor agonist, which reduces the frequency of exacerbations of chronic obstructive pulmonary disease and bronchial asthma. Tulobuterol is also a sympathomimetic agent used as a transdermal patch, and increases normal diaphragm muscle strength.
  • HY-148093
    PM-81I

    STAT Cancer Inflammation/Immunology
    PM-81I is a potent STAT6 inhibitor (targeting the SH2 structural domain) that effectively reduces STAT6 phosphorylation levels. PM-81I can be used in studies of allergic lung disease, allergic rhinitis, chronic obstructive pulmonary disease or cancer[1].
  • HY-N10597
    5'''-O-Feruloyl complanatoside B

    Others Cancer Metabolic Disease Cardiovascular Disease
    5'''-O-Feruloyl complanatoside B is isolated from Astragali Semen, the seeds of Astragalus Complanatus. Semen Astragali Complanati (SAC) include fatty acids, amino acids, polysaccharides, flavonoids, triterpene glycosides and trace elements; have been reported to involve in chronic diseases such as cardiovascular diseases, diabetes mellitus and cancers.
  • HY-19979
    RCM-1

    Others Cancer
    RCM-1 is a forkhead box M1 (FOXM1) inhibitor with an EC50 of 0.72 μM in U2OS cells. RCM-1 blocks the nuclear localization and increased the proteasomal degradation of FOXM1. RCM-1 can be used for asthma and other chronic airway diseases research.
  • HY-N0172S
    Caffeic acid-13C3

    3,4-Dihydroxycinnamic acid-13C3

    Bacterial Fungal Infection
    Caffeic acid-13C3 (3,4-Dihydroxycinnamic acid-13C3) is an 13C labeled caffeic acid. Caffeic acid is a phytonutrient belonging to the flavonoids. Caffeic acid and its derivatives, are potential antimicrobial agents, chronic infection induced by microbes such as bacteria, fungi, and viruses.
  • HY-130307
    Rubrofusarin

    Bacterial Cancer Inflammation/Immunology Neurological Disease
    Rubrofusarin is an orange polyketide pigment from Fusarium graminearum. Rubrofusarin is also an active ingredient of the Cassia species and ameliorates chronic restraint stress (CRS) -induced depressive symptoms through PI3K/Akt signaling. Rubrofusarin has anticancer, antibacterial, and antioxidant effects.
  • HY-122347A
    Orvepitant maleate

    GW823296 maleate

    Neurokinin Receptor Neurological Disease
    Orvepitant maleate (GW823296 maleate) is potent, selective, orally active and well-tolerated neurokinin-1 receptor (NK-1) antagonist with a pKi of 10.2 for human neurokinin-1 receptor. Orvepitant maleate can across the blood-brain barrier. Orvepitant maleate has the potential for depressive disorder and chronic refractory cough (CRC) treatment.
  • HY-B0534S
    Moclobemide-d8

    Ro111163-d8

    Monoamine Oxidase Neurological Disease
    Moclobemide-d8 (Ro111163-d8) is the deuterium labeled Moclobemide. Moclobemide (Ro111163) is a brain-penetrant and reversible monoamine oxidase (MAO-A) inhibitor with an IC50 of 6.061 μM for hMAO-A.Moclobemide up-regulates proliferation of hippocampal progenitor cells in chronically stressed mice.
  • HY-B1002S
    Oxolinic acid-d5

    Bacterial Antibiotic DNA/RNA Synthesis Infection
    Oxolinic acid-d5 is the deuterium labeled Oxolinic acid. Oxolinic acid is an antibiotic against both Gram-negative and Gram-positive bacteria. Oxolinic acid can be used for the research of acute and chronic urinary tract infections. Oxolinic acid is a DNA/RNA synthesis inhibitor. Oxolinic acid acts a dopamine uptake inhibitor and stimulants locomotor effect in mice.
  • HY-B0004
    Doxofylline

    Adenosine Receptor Phosphodiesterase (PDE) Reactive Oxygen Species Inflammation/Immunology
    Doxofylline is an orally active PDE IV inhibitor and A1AR antagonist. Doxofylline reduces inflammation in epithelial cells via inhibiting mitochondrial ROS production and amelioration of multiple cellular pathways (NLRP3-TXNIP inflammasome activation). Doxophylline can be used in studies of asthma, chronic obstructive pulmonary disease, and bronchospasm.
  • HY-12908
    Bcl-xL antagonist 2

    Bcl-2 Family Apoptosis Cancer
    Bcl-xL antagonist 2 is a potent, selective, and orally active antagonist of BCL-XL with an IC50 and Ki of 0.091 μM and 65 nM, respectively. Bcl-xL antagonist 2 promotes the apoptosis of cancer cells. Bcl-xL antagonist 2 has the potential for the research of the chronic lymphocytic leukemia (CLL) and non-Hodgkin’s lymphoma (NHL).
  • HY-147051
    MRGPRX4 modulator-2

    Others Inflammation/Immunology
    MRGPRX4 modulator-2 (compound 1-55) is a potent MRGPR X4 modulator, possessing antagonist activity against MRGPR X4 with an IC50 < 100 nM. MRGPRX4 modulator-2 can be used for researching autoimmune diseases such as psoriasis, multiple sclerosis, Steven Johnson’s Syndrome, and other chronic itch conditions.
  • HY-147357
    TRPC3/6-IN-1

    TRP Channel Cardiovascular Disease
    TRPC3/6-IN-1 is a potent selectivity blocker of the canonical transient receptor channels (TRPC3/6), has block potency for hTRPC3 and hTRPC6 with IC50 values of 1260 nM and 500 nM, respectively. TRPC3/6-IN-1 can be used for the research of chronic models of heart failure.
  • HY-16126
    Carboxyamidotriazole

    L-651582; CAI

    Calcium Channel Cancer Inflammation/Immunology
    Carboxyamidotriazole (L-651582) is a cytostatic inhibitor of nonvoltage-operated calcium channels and calcium channel-mediated signaling pathways. Carboxyamidotriazole shows anti-tumor, anti-inflammatory and antiangiogenic effects.
  • HY-145830
    AC1-IN-1

    Adenylate Cyclase Neurological Disease
    AC1-IN-1 is a potent and selective Adenylyl cyclase type 1 (AC1) inhibitor with an IC50 of 0.54 µM. AC1-IN-1 displays modest antiallodynic effects in a mouse model of inflammatory pain. AC1-IN-1 has CNS activity.
  • HY-P9923
    Benralizumab

    MEDI-563; BIW-8405

    Interleukin Related Apoptosis Inflammation/Immunology Cancer
    Benralizumab (MEDI-563) is an interleukin-5 receptor α (IL-5Rα)-directed cytolytic monoclonal antibody that induces direct, rapid and nearly complete depletion of eosinophils via enhanced antibody-dependent cell-mediated cytotoxicity. Benralizumab can be used for severe eosinophilic asthma.
  • HY-108293
    Promestriene

    Estrogen Receptor/ERR Cancer Endocrinology
    Promestriene is a synthetic diethyl-ether of estradiol and a locally effective estrogen. Promestriene has an efficient action on vaginal atrophy while it is minimally absorbed.
  • HY-13569A
    Beraprost sodium

    Prostaglandin Receptor Inflammation/Immunology Cardiovascular Disease
    Beraprost sodium, a prostacyclin analog, is a stable and orally active prodrug of PGI2. Beraprost sodium is a potent vasodilator, has the potential for pulmonary arterial hypertension treatment through expanding renal vessels, improving microcirculation.
  • HY-108741
    Plecanatide

    Guanylate Cyclase Inflammation/Immunology
    Plecanatide, an analogue of Uroguanylin, is an orally active guanylate cyclase-C (GC-C) receptor agonist. Plecanatide activates GC-C receptors to stimulate cGMP synthesis with an EC50 of 190 nM in T84 cells assay. Plecanatide shows anti-inflammatory activity in models of murine colitis.
  • HY-16125
    Carboxyamidotriazole Orotate

    L-651582 Orotate; CAI Orotate

    Calcium Channel Cancer Inflammation/Immunology
    Carboxyamidotriazole Orotate (L-651582 Orotate) is the orotate salt form of Carboxyamidotriazole (CAI), an orally bioavailable signal transduction inhibitor. Carboxyamidotriazole Orotate is a cytostatic inhibitor of nonvoltage-operated calcium channels and calcium channel-mediated signaling pathways. Carboxyamidotriazole Orotate shows anti-tumor, anti-inflammatory and antiangiogenic effects.
  • HY-13693S1
    Mometasone furoate-d8

    Sch32088-d8

    Glucocorticoid Receptor Inflammation/Immunology Endocrinology
    Mometasone furoate-d8 (Sch32088-d8) is the deuterium labeled Mometasone furoate. Mometasone furoate (Sch32088) is a glucocorticoid receptor agonist with anti-inflammatory and anti-allergic activity. Mometasone furoate acts as a corticosteroid agent and used for topical applications in chronic skin eczema and airway inflammation management of asthma in vivo
  • HY-124270
    Sibenadet hydrochloride

    AR-C68397AA

    Dopamine Receptor Adrenergic Receptor Inflammation/Immunology
    Sibenadet hydrochloride (AR-C68397AA) is a dual D2 dopamine receptor, beta2-adrenoceptor agonist with bronchodilator activity. Investigation in animal models of key chronic obstructive pulmonary disease (COPD) symptoms has demonstrated that Sibenadet hydrochloride effectively inhibits sensory nerve activity, thereby reducing reflex cough, mucus production and tachypnoea.
  • HY-114367
    Delphinidin 3-rutinoside chloride

    Delphinidin 3-O-rutinoside chloride

    Apoptosis Cancer
    Delphinidin 3-rutinoside chloride (Delphinidin 3-O-rutinoside chloride) is an active anthocyanin found in Solanum melongena. Delphinidin 3-rutinoside chloride induces a pro-apoptotic effect in B cell chronic lymphocytic leukaemia (B CLL). Delphinidin 3-rutinoside chloride exerts phytoestrogen activity by binding to ERβ, with an IC50 of 2.3 μM.
  • HY-113469A
    Cyclic GMP sodium

    Endogenous Metabolite Inflammation/Immunology
    Cyclic GMP sodium (cGMP) is an important regulator of short-term changes in smooth muscle tone and longer-term responses to chronic drug treatment or proliferative signals, it is in response to atrial natriuretic peptide (ANP) or nitric oxide (NO). Cyclic GMP sodium interacts with cation channels to regulate ion transport or activate the cyclic GMP-dependent protein kinase to result in protein phosphorylation.
  • HY-W011733
    Tulobuterol hydrochloride

    C-78

    Adrenergic Receptor Influenza Virus Antibiotic Infection Endocrinology Inflammation/Immunology
    Tulobuterol hydrochloride (C-78) is a long-acting β2-adrenoceptor agonist, which reduces the frequency of exacerbations of chronic obstructive pulmonary disease and bronchial asthma. Tulobuterol hydrochloride is also a sympathomimetic agent used as a transdermal patch, increases normal diaphragm muscle strength. Tulobuterol hydrochloride inhibit rhinovirus replication and modulate airway inflammation.
  • HY-19644
    GSK2256294A

    GSK 2256294

    Epoxide Hydrolase Cardiovascular Disease
    GSK2256294A (GSK 2256294) is a selective and orally active inhibitor of soluble epoxide hydrolase (sEH). GSK2256294A inhibits recombinant human sEH, rat sEH orthologs and murine sEH orthologs with IC50s of 27, 61 and 189 pM, respectively. GSK2256294A can be used for the research of chronic obstructive pulmonary disease (COPD) and cardiovascular disease.
  • HY-14299
    Indacaterol

    Adrenergic Receptor Inflammation/Immunology Cardiovascular Disease
    Indacaterol is an orally active ultra-long-acting β2 adrenergic receptor (ADRB2) agonist. Indacaterol inhibits NF-κB activity in a β-arrestin2-dependent manner, preventing further lung damage and improving lung function in COPD (chronic obstructive pulmonary disorder). Indacaterol can also be used in cardiovascular disease research.
  • HY-17474S
    Parecoxib-d3

    SC 69124-d3

    COX Cancer Inflammation/Immunology
    Parecoxib-d3 is the deuterium labeled Parecoxib. Parecoxib (SC 69124) is a highly selective and orally active COX-2 inhibitor, the prodrug of Valdecoxib (HY-15762). Parecoxib Sodium is a nonsteroidal anti-inflammatory agent (NSAID) and inhibits prostaglandin (PG) synthesis. Parecoxib can be used for the relief of acute postoperative pain and symptoms of chronic inflammatory conditions such as osteoarthritis and rheumatoid arthritis in vivo.
  • HY-13337
    BMS-986094

    INX-08189

    HCV Infection
    BMS-986094 (INX-08189) is a potent inhibitor of hepatitis C virus (HCV) replication, with an EC50 of 35 nM at 24 h in Huh-7 cells. BMS-986094 is a phosphoramidate prodrug of 6-O-methyl-2’-C-methyl guanosine. BMS-986094 can be used for the research of chronic HCV infection.
  • HY-N6736
    K-252c

    PKC Bacterial Apoptosis Cancer Infection
    K-252c, a staurosporine analog isolated from Nocardiopsis sp., is a cell-permeable PKC inhibitor, with an IC50 of 2.45 µM. K-252c induces apoptosis in human chronic myelogenous leukemia cancer cells. K-252c also inhibits β-lactamase, chymotrypsin, and malate dehydrogenase.
  • HY-107794
    Clodronate disodium tetrahydrate

    Disodium clodronate tetrahydrate

    Others Inflammation/Immunology Neurological Disease
    Clodronate disodium tetrahydrate (Disodium clodronate tetrahydrate) is first-generation bisphosphonate, with anti-osteoporotic, anti-inflammatory and analgesic effects. Clodronate disodium tetrahydrate is a selective, potent, reversible and Cl - competitive vesicular nucleotide transporter (VNUT) inhibitor, with an IC50 of 15.6 nM. Clodronate disodium tetrahydrate inhibits vesicular ATP release from neurons and reduces chronic neuropathic and inflammatory pain.
  • HY-13905
    Flumatinib mesylate

    HHGV678 mesylate

    Bcr-Abl c-Kit PDGFR Cancer
    Flumatinib (HHGV678) mesylate is an orally active and selective inhibitor of Bcr-Abl. Flumatinib mesylate inhibits c-Abl, PDGFRβ and c-Kit with IC50 values of 1.2, 307.6 and 665.5 nM, respectively. Flumatinib mesylate inhibits Bcr-Abl autophosphorylation and Stat5 and Erk1/2 phosphorylation. Flumatinib mesylate inhibits tumor growth in chronic myelogenous leukemia model.
  • HY-122575
    Aurintricarboxylic acid

    P2X Receptor Influenza Virus Topoisomerase MicroRNA Apoptosis Infection Inflammation/Immunology Neurological Disease
    Aurintricarboxylic acid is a nanomolar-potency, allosteric antagonist with selectivity towards αβ-methylene-ATP-sensitive P2X1Rs and P2X3Rs, with IC50s of 8.6 nM and 72.9 nM for rP2X1R and rP2X3R, respectively. Aurintricarboxylic acid is a potent anti-influenza agent by directly inhibiting the neuraminidase. Aurintricarboxylic acid is an inhibitor of topoisomerase II and apoptosis. Aurintricarboxylic acid is a selective inhibitor of the TWEAK-Fn14 signaling pathway. Aurintricarboxylic acid also acts as a cystathionine-lyase (CSE) inhibitor with an IC50 of 0.6 μM. Aurintricarboxylic acid is a modifier of miRNAs that regulate miRNA function, with an IC50 of 0.47 µM.
  • HY-14301
    Olodaterol

    BI1744

    Adrenergic Receptor Inflammation/Immunology Endocrinology
    Olodaterol (BI1744) is a selective, long acting β2-adrenoceptor2-AR) agonist (EC50=0.1 nM and pKi= 9.14 for human β2-adrenoceptor, respectively). Olodaterol can be used for chronic obstructive pulmonary disease (COPD) and pulmonary fibrosis.
  • HY-B0024S
    Prulifloxacin-d8

    Bacterial Antibiotic Infection
    Prulifloxacin-d8 (NM441-d8) is the deuterium labeled Prulifloxacin. Prulifloxacin (NM441) is an orally active fluoroquinolone antibiotic with a broad spectrum of activity against Gram-positive and -negative bacteria. Prulifloxacin is a prodrug of a thiazeto-quinoline carboxylic acid derivative Ulifloxacin (NM394). Prulifloxacin has the potential for lower urinary tract infections and exacerbations of chronic bronchitis.
  • HY-136239
    Beclomethasone 17-propionate

    Beclomethasone-17-monopropionate; 17-BMP

    Glucocorticoid Receptor Drug Metabolite Inflammation/Immunology
    Beclomethasone 17-propionate (Beclomethasone-17-monopropionate), an active metabolite of Beclomethasone dipropionate (HY-13571), is a glucocorticoid receptor (GR) agonist. Beclomethasone 17-propionate exhibits greater affinity for GR than Beclomethasone dipropionate. Beclomethasone 17-propionate effectively suppresses cytokine production in chronic obstructive pulmonary disease (COPD) lung macrophages.
  • HY-14299A
    Indacaterol maleate

    QAB149

    Adrenergic Receptor Endocrinology
    Indacaterol maleate (QAB149) is an orally active ultra-long-acting β2 adrenergic receptor (ADRB2) agonist. Indacaterol maleate inhibits NF-κB activity in a β-arrestin2-dependent manner, preventing further lung damage and improving lung function in COPD (chronic obstructive pulmonary disorder). Indacaterol maleate can also be used in cardiovascular disease research.
  • HY-125021
    2BAct

    Eukaryotic Initiation Factor (eIF) Neurological Disease
    2BAct is a highly selective, and orally active eIF2B (eukaryotic initiation factor 2B) activator with an EC50 of 33 nM. 2BAct prevents neurological defects caused by a chronic integrated stress response. 2BAct is able to penetrate the central nervous system (CNS). 2BAct displays improved solubility and pharmacokinetics relative to eIF2B activator ISRIB (HY-12495).
  • HY-14301A
    Olodaterol hydrochloride

    BI1744 hydrochloride

    Adrenergic Receptor Endocrinology Inflammation/Immunology
    Olodaterol (BI1744) hydrochloride is a selective, long acting β2-adrenoceptor2-AR) agonist (EC50=0.1 nM and pKi= 9.14 for human β2-adrenoceptor, respectively). Olodaterol can be used for chronic obstructive pulmonary disease (COPD) and pulmonary fibrosis.
  • HY-B1490
    Imipramine hydrochloride

    Serotonin Transporter Apoptosis Autophagy Cancer Inflammation/Immunology Neurological Disease
    Imipramine hydrochloride is an orally active tertiary amine tricyclic antidepressant. Imipramine hydrochloride is a Fascin1 inhibitor with antitumor activities. Imipramine hydrochloride also inhibits serotonin transporter with an IC50 value of 32 nM. Imipramine hydrochloride stimulates U-87MG glioma cells autophagy and induces HL-60 cell apoptosis. Imipramine hydrochloride shows neuroprotective and immunomodulatory effects.
  • HY-B1490A
    Imipramine

    Serotonin Transporter Autophagy Apoptosis Cancer Inflammation/Immunology Neurological Disease
    Imipramine is an orally active tertiary amine tricyclic antidepressant. Imipramine is a Fascin1 inhibitor with antitumor activities. Imipramine also inhibits serotonin transporter with an IC50 value of 32 nM. Imipramine stimulates U-87MG glioma cells autophagy and induces HL-60 cell apoptosis. Imipramine shows neuroprotective and immunomodulatory effects.
  • HY-N3990
    Hardwickiic acid

    (-)-Hardwikiic acid

    Sodium Channel Infection Neurological Disease
    Hardwickiic acid ((-)-Hardwikiic acid) is an antinociceptive compound that blocks Tetrodotoxin-sensitive voltage-dependent sodium channels. Hardwickiic acid shows insecticidal activity.
  • HY-129390
    Orelabrutinib

    ICP-022

    Btk Cancer
    Orelabrutinib (ICP-022) is a potent, orally active, and irreversible Bruton's tyrosine kinase (BTK) inhibitor with potential antineoplastic activity. Orelabrutinib prevents both the activation of the B-cell antigen receptor (BCR) signaling pathway and BTK-mediated activation of downstream survival pathways, inhibiting the growth of malignant B-cells that overexpress BTK.
  • HY-10943
    GNF-7

    Bcr-Abl Ack1 Cancer
    GNF-7 is a multikinase inhibitor. GNF-7 is a Bcr-Abl inhibitor, with IC50s of 133 nM and 61 nM for Bcr-Abl WT and Bcr-Abl T315I, respectively. GNF-7 also possesses inhibitory activity against both ACK1 (activated CDC42 kinase 1) and GCK (germinal center kinase) with IC50s of 25 nM and 8 nM, respectively. GNF-7 can be used for the research of hematologic malignancies.
  • HY-135871
    BMT-124110

    AAK1 Neurological Disease
    BMT-124110 is a potent, selective AAK1 inhibitor with an IC50 of 0.9 nM. BMT-124110 shows antinociceptive activity. BMT-090605 inhibits BMP-2-inducible protein kinase (BIKE) and Cyclin G-associated kinase (GAK) with IC50s of 17 and 99 nM, respectively.
  • HY-101682
    SCH 42495

    Neprilysin Cardiovascular Disease
    SCH 42495 is an orally active neutral metalloendopeptidase (NEP) inhibitor with antihypertensive effect. SCH 42495 is the orally active ethylester prodrug of SCH 42354.
  • HY-136268
    AQX-435

    Phosphatase Apoptosis Inflammation/Immunology
    AQX-435 is a potent SHIP1 phosphatase activator. AQX-435 reduces PI3K activation downstream of the B-cell receptor (BCR) and induces apoptosis of malignant B cells, and reduces lymphoma growth.
  • HY-N0825
    Nodakenin

    Cholinesterase (ChE) Inflammation/Immunology
    Nodakenin is a major coumarin glucoside in the root of Angelica decusiva. Nodakenin inhibits acetylcholinesterase (AChE) activity with an IC50 of 84.7 μM.
  • HY-136576
    RP101075

    LPL Receptor Drug Metabolite Inflammation/Immunology
    RP101075, an active metabolite of Ozanimod, is a potent, orally active S1PR (sphingosine-1-phosphate receptor 1) agonist, with an EC50 of 0.27 nM. RP101075 displays >100-fold selectivity over S1PR5 (EC50=5.9 nM) and >10000-fold over S1PR 2, 3, and 4. RP101075 displays superior cardiovascular safety profile.
  • HY-P3293
    Lonodelestat

    POL6014

    Elastase Inflammation/Immunology
    Lonodelestat (POL6014) is a potent, orally active and selective peptide inhibitor of human neutrophil elastase (hNE).
  • HY-101682A
    SCH 42495 racemate

    Neprilysin Cardiovascular Disease
    SCH 42495 racemate is the racemate of SCH 42495. SCH 42495 is an orally active neutral metalloendopeptidase (NEP) inhibitor with antihypertensive effect. SCH 42495 is the orally active ethylester prodrug of SCH 42354.
  • HY-B0241S
    Ipratropium-d3 bromide

    Sch 1000-d3

    mAChR Inflammation/Immunology Neurological Disease
    Ipratropium-d3 bromide (Sch 1000-d3) is the deuterium labeled Ipratropium bromide. Ipratropium bromide (Sch 1000) is a muscarinic receptor antagonist, with binding IC50 values of 2.9 nM, 2 nM, and 1.7 nM for M1, M2, and M3 receptors, respectively. Ipratropium bromide can be used in the research for COPD (chronic obstructive pulmonary disease) and asthma.
  • HY-12279
    Umbralisib

    TGR-1202; RP5264

    PI3K Casein Kinase Cancer
    Umbralisib (TGR-1202) is an orally active, potent and selective dual PI3Kδ and casein kinase-1-ε (CK1ε) inhibitor, with EC50 of 22.2 nM and 6.0 μM, respectively. Umbralisib exhibits unique immunomodulatory effects on chronic lymphocytic leukemia (CLL) T cells. Umbralisib can be used for haematological malignancies reseach.
  • HY-100867
    TAK-659

    Syk FLT3 Cancer
    TAK-659 is a highly potent, selective, reversible and orally available dual inhibitor of spleen tyrosine kinase (SYK) and fms related tyrosine kinase 3 (FLT3), with an IC50 of 3.2 nM and 4.6 nM for SYK and FLT3, respectively. TAK-659 induces cell death in tumor cells but not in nontumor cells, and with potential for the treatment of chronic lymphocytic leukemia (CLL).
  • HY-B0814S
    Levocetirizine-d4 dihydrochloride

    (R)-Cetirizine-d4 dihydrochloride

    Histamine Receptor Inflammation/Immunology Endocrinology
    Levocetirizine-d4 ((R)-Cetirizine-d4) dihydrochloride is the deuterium labeled Levocetirizine. Levocetirizine ((R)-Cetirizine) is a third-generation peripheral H1-receptor antagonist. Levocetirizine is an antihistaminic agent which is the R-enantiomer of Cetirizine. Levocetirizine has a higher affinity for the histamine H1-receptor than (S)-Cetirizine and can effectively treat allergic rhinitis and chronic idiopathic urticaria.
  • HY-12279A
    Umbralisib tosylate

    TGR-1202 tosylate; RP5264 tosylate

    PI3K Casein Kinase Cancer
    Umbralisib (TGR-1202) tosylate is an orally active, potent and selective dual PI3Kδ and casein kinase-1-ε (CK1ε) inhibitor, with EC50 of 22.2 nM and 6.0 μM, respectively. Umbralisib tosylate exhibits unique immunomodulatory effects on chronic lymphocytic leukemia (CLL) T cells. Umbralisib tosylate can be used for haematological malignancies reseach.
  • HY-15256
    Faldaprevir

    BI 201335

    HCV Protease Infection
    Faldaprevir (BI 201335) is a potent, orally active and selective noncovalent inhibitor of NS3/4A protease of HCV (hepatitis C virus) genotypes 1a and 1b, with Ki values of 2.6 and 2.0 nM, respectively. Faldaprevir inhibits HCV RNA replication, with EC50 values of 6.5 and 3.1 nM, respectively. Faldaprevir has potent antiviral activity against chronic HCV infection.
  • HY-103274
    PD180970

    Bcr-Abl Src c-Kit Apoptosis Cancer Neurological Disease
    PD180970 is a highly potent and ATP-competitive p210 Bcr-Abl kinase inhibitor, with an IC50 of 5 nM for inhibiting the autophosphorylation of p210 Bcr-Abl. PD180970 also inhibits Src and KIT kinase with IC50s of 0.8 nM and 50 nM, respectively. PD180970 indcues apoptosis of K562 leukemic cells, and can be used for chronic myelogenous leukemia research.
  • HY-17452
    Cefditoren sodium

    ME 1206

    Bacterial Infection Inflammation/Immunology
    Cefditoren sodium (ME 1206) is a broad-spectrum, third-generation, oral cephalosporin antibacterial with enhanced stability against many common β lactamases. Cefditoren sodium has activity against Gram-negative organisms and Gram-positive organisms. Cefditoren sodium can be used in the research of infection diseases such as acute exacerbations of chronic bronchitis, community-acquired pneumonia (CAP), streptococcal pharyngitis/tonsillitis, or uncomplicated skin and skin structure infections.
  • HY-100867A
    TAK-659 hydrochloride

    Syk FLT3 Cancer
    TAK-659 hydrochloride is a highly potent, selective, reversible and orally available dual inhibitor of spleen tyrosine kinase (SYK) and fms related tyrosine kinase 3 (FLT3), with an IC50 of 3.2 nM and 4.6 nM for SYK and FLT3, respectively. TAK-659 hydrochloride induces cell death in tumor cells but not in nontumor cells, and with potential for the treatment of chronic lymphocytic leukemia (CLL).
  • HY-151369
    AV123

    RIP kinase Metabolic Disease Inflammation/Immunology Neurological Disease Cardiovascular Disease
    AV123 (compound 12) is a non-cytotoxic RIPK1 inhibitor (IC50=12.12 µM). AV123 blocks the TNF-α-induced necroptotic (EC50=1.7 μM) but not the apoptotic cell death. AV123 can be used in the study of necrotic chronic conditions such as ischemia-reperfusion injury of the brain, heart and kidney, inflammatory diseases, neurodegenerative diseases and infectious diseases.
  • HY-B0241S1
    Ipratropium-d7 bromide

    Sch 1000-d7 bromide

    mAChR Inflammation/Immunology Neurological Disease
    Ipratropium-d7 (Sch 1000-d7) bromideis the deuterium labeled Ipratropium bromide. Ipratropium bromide (Sch 1000) is a muscarinic receptor antagonist, with binding IC50 values of 2.9 nM, 2 nM, and 1.7 nM for M1, M2, and M3 receptors, respectively. Ipratropium bromide can be used in the research for COPD (chronic obstructive pulmonary disease) and asthma.
  • HY-12279C
    Umbralisib hydrochloride

    TGR-1202 hydrochloride; RP5264 hydrochloride

    PI3K Casein Kinase Cancer
    Umbralisib (TGR-1202) hydrochloride is an orally active, potent and selective dual PI3Kδ and casein kinase-1-ε (CK1ε) inhibitor, with EC50 of 22.2 nM and 6.0 μM, respectively. Umbralisib hydrochloride exhibits unique immunomodulatory effects on chronic lymphocytic leukemia (CLL) T cells. Umbralisib hydrochloride can be used for haematological malignancies reseach.
  • HY-15306
    Eltrombopag

    SB-497115

    Thrombopoietin Receptor Bacterial Apoptosis Cancer Infection Cardiovascular Disease
    Eltrombopag (SB-497115) is an orally active thrombopoietin receptor nonpeptide agonist. Eltrombopag owns thrombopoietic activity, and has been used to research low blood platelet counts with chronic immune thrombocytopenia. Eltrombopag can be used for the research of cardiovascular. Eltrombopag also has highly inhibitory effects against multidrug resistant Staphylococcus aureus. Eltrombopag can induce apoptosis in hepatocellular carcinomab (HCC) as well.
  • HY-17452A
    Cefditoren (Pivoxil)

    Cefditoren pivoxyl; Cefditoren pivaloyloxymethyl ester; ME 1207

    Bacterial Antibiotic Infection Inflammation/Immunology
    Cefditoren Pivoxil (ME 1207) is a broad-spectrum, third-generation, oral cephalosporin antibacterial with enhanced stability against many common β lactamases. Cefditoren Pivoxil has activity against Gram-negative organisms and Gram-positive organisms. Cefditoren Pivoxil can be used in the research of infection diseases such as acute exacerbations of chronic bronchitis, community-acquired pneumonia (CAP), streptococcal pharyngitis/tonsillitis, or uncomplicated skin and skin structure infections.
  • HY-B1810S
    Tulobuterol-D9 hydrochloride

    C-78-D9

    Adrenergic Receptor Inflammation/Immunology Endocrinology
    Tulobuterol-D9 hydrochloride (C-78-D9) is the deuterium labeled Tulobuterol. Tulobuterol (C-78 free base) is a long-acting β2-adrenoceptor agonist, which reduces the frequency of exacerbations of chronic obstructive pulmonary disease and bronchial asthma. Tulobuterol is also a sympathomimetic agent used as a transdermal patch, and increases normal diaphragm muscle strength.
  • HY-B0240
    Disulfiram

    Tetraethylthiuram disulfide; TETD

    Aldehyde Dehydrogenase (ALDH) Interleukin Related Pyroptosis Apoptosis Metabolic Disease Cancer
    Disulfiram (Tetraethylthiuram disulfide) is a specific inhibitor of aldehyde-dehydrogenase (ALDH1), used for the treatment of chronic alcoholism by producing an acute sensitivity to alcohol. Disulfiram inhibits gasdermin D (GSDMD) pore formation in liposomes and inflammasome-mediated pyroptosis and IL-1β secretion in human and mouse cells. Disulfiram + Cu 2+ increases intracellular ROS levels triggering apoptosis of ovarian cancer stem cells[1-6].
  • HY-150569
    BCR-ABL-IN-6

    Bcr-Abl Cancer
    BCR-ABL-IN-6 (9h) is a selective Bcr-Abl kinase inhibitor with IC50s of 4.6 and 227 nM for Bcr-Abl WT and Bcr-Abl T3151 respectively. BCR-ABL-IN-6 inhibits Bcr-Abl kinase with strong affinity inside the cells with an EC50 of 14.6 nM. BCR-ABL-IN-6 is an imatinib derivative which can be used for research of chronic myelogenous leukemia.
  • HY-124526
    Chiauranib

    CS2164

    VEGFR PDGFR c-Kit Aurora Kinase c-Fms Cancer
    Chiauranib (CS2164) is an orally active multi-target inhibitor against tumor angiogenesis. Chiauranib potently inhibits the angiogenesis-related kinases (VEGFR1, VEGFR2, VEGFR3, PDGFRα and c-Kit), mitosis-related kinase Aurora B, and chronic inflammation-related kinase CSF-1R, with IC50 values ranging from 1-9 nM. Chiauranib has strongly anticancer effects.
  • HY-142701
    SSTR4 agonist 4

    Somatostatin Receptor Neurological Disease
    SSTR4 agonist 4 is a potent agonist of SSTR4. SSTR4 is expressed at relatively high levels in the hippocampus and neocortex, memory and learning regions, and Alzheimer's disease pathology. SSTR4 agonists are potent in rodent models of pain associated with acute and chronic associated anti-peripheral nociceptive and anti-inflammatory activity. SSTR4 agonist 4 has the potential for the research of pain (extracted from patent WO2021233428A1, compound 14).
  • HY-17474AS
    Parecoxib-d5 sodium

    SC 69124A-d5

    COX Inflammation/Immunology Cancer
    Parecoxib-d5 sodium (SC 69124A-d5) is the deuterium labeled Parecoxib sodium. Parecoxib Sodium (SC 69124A) is a highly selective and orally active COX-2 inhibitor, the prodrug of Valdecoxib (HY-15762). Parecoxib Sodium is a nonsteroidal anti-inflammatory agent (NSAID) and inhibits prostaglandin (PG) synthesis. Parecoxib Sodium can be used for the relief of acute postoperative pain and symptoms of chronic inflammatory conditions such as osteoarthritis and rheumatoid arthritis in vivo.
  • HY-13502B
    Mitoxantrone diacetate

    Mitozantrone diacetate; NSC 301739 diacetate

    Topoisomerase PKC Orthopoxvirus Apoptosis Endogenous Metabolite Cancer Infection
    Mitoxantrone diacetate is a potent topoisomerase II inhibitor. Mitoxantrone diacetate also inhibits protein kinase C (PKC) activity with an IC50 of 8.5 μM. Mitoxantrone diacetate induces apoptosis of B-CLL (B-chronic lymphocytic leukaemia) cells. Mitoxantrone diacetate shows antitumor activity. Mitoxantrone diacetate also has anti-orthopoxvirus activity with EC50s of 0.25 μM and and 0.8 μM for cowpox and monkeypox, respectively.
  • HY-13502
    Mitoxantrone

    Mitozantrone; NSC 301739

    Topoisomerase PKC Orthopoxvirus Apoptosis Endogenous Metabolite Cancer Infection
    Mitoxantrone is a potent topoisomerase II inhibitor. Mitoxantrone also inhibits protein kinase C (PKC) activity with an IC50 of 8.5 μM. Mitoxantrone induces apoptosis of B-CLL (B-chronic lymphocytic leukaemia) cells. Mitoxantrone shows antitumor activity. Mitoxantrone also has anti-orthopoxvirus activity with EC50s of 0.25 μM and and 0.8 μM for cowpox and monkeypox, respectively.
  • HY-112671
    CDDO-dhTFEA

    RTA dh404

    Keap1-Nrf2 NF-κB Inflammation/Immunology
    CDDO-dhTFEA (RTA dh404) is a synthetic oleanane triterpenoid compound which potently activates Nrf2 and inhibits the pro-inflammatory transcription factor NF-κB. CDDO-dhTFEA restores hypertension (MAP), increases Nrf2 and expression of its target genes, attenuates activation of NF-κB and transforming growth factor-β pathways, and reduces glomerulosclerosis, interstitial fibrosis and inflammation in the chronic kidney disease (CKD) rats.
  • HY-142700
    SSTR4 agonist 3

    Somatostatin Receptor Neurological Disease
    SSTR4 agonist 3 is a potent agonist of SSTR4. SSTR4 is expressed at relatively high levels in the hippocampus and neocortex, memory and learning regions, and Alzheimer's disease pathology. SSTR4 agonists are potent in rodent models of pain associated with acute and chronic associated anti-peripheral nociceptive and anti-inflammatory activity. SSTR4 agonist 3 has the potential for the research of pain (extracted from patent WO2021233427A1, compound 14).
  • HY-13502A
    Mitoxantrone dihydrochloride

    Mitozantrone dihydrochloride; NSC 301739 dihydrochloride

    Topoisomerase PKC Orthopoxvirus Apoptosis Endogenous Metabolite Cancer Infection
    Mitoxantrone dihydrochloride is a potent topoisomerase II inhibitor. Mitoxantrone dihydrochloride also inhibits protein kinase C (PKC) activity with an IC50 of 8.5 μM. Mitoxantrone dihydrochloride induces apoptosis of B-CLL (B-chronic lymphocytic leukaemia) cells. Mitoxantrone dihydrochloride shows antitumor activity. Mitoxantrone dihydrochloride also has anti-orthopoxvirus activity with EC50s of 0.25 μM and and 0.8 μM for cowpox and monkeypox, respectively.
  • HY-15306A
    Eltrombopag Olamine

    Eltrombopag diethanolamine salt; SB-497115GR

    Thrombopoietin Receptor Bacterial Apoptosis Cancer Infection Cardiovascular Disease
    Eltrombopag Olamine (Eltrombopag diethanolamine salt) is an orally active thrombopoietin receptor nonpeptide agonist. Eltrombopag Olamine owns thrombopoietic activity, and has been used to research low blood platelet counts with chronic immune thrombocytopenia. Eltrombopag Olamine can be used for the research of cardiovascular. Eltrombopag Olamine also has highly inhibitory effects against multidrug resistant Staphylococcus aureus. Eltrombopag Olamine can induce apoptosis in hepatocellular carcinomab (HCC) as well.
  • HY-12279B
    Umbralisib sulfate

    TGR-1202 sulfate; RP-5264 sulfate

    PI3K Casein Kinase Cancer
    Umbralisib (TGR-1202) sulfate is an orally active, potent and selective dual PI3Kδ and casein kinase-1-ε (CK1ε) inhibitor, with EC50 of 22.2 nM and 6.0 μM, respectively. Umbralisib sulfate exhibits unique immunomodulatory effects on chronic lymphocytic leukemia (CLL) T cells. Umbralisib sulfate can be used for haematological malignancies reseach.
  • HY-143390
    NMDA receptor modulator 2

    iGluR Neurological Disease
    NMDA receptor modulator 2 (Compound 1) is a potent NMDA receptor modulator. NMDA receptor modulator 2 can be used for neurological disorder research.
  • HY-143396
    NMDA receptor modulator 5

    iGluR Neurological Disease
    NMDA receptor modulator 5 (Compound 195) is a potent NMDA receptor modulator. NMDA receptor modulator 5 can be used for neurological disorder research.
  • HY-119513
    Nizofenone

    Others Neurological Disease
    Nizofenone is a neuroprotective agent which protects neurons from death following cerebral ischemia or anoxia. Nizofenone can be used in the research of acute neurological conditions, such as stroke.
  • HY-143393
    NMDA receptor modulator 4

    iGluR Neurological Disease
    NMDA receptor modulator 4 (Compound 169) is a potent NMDA receptor modulator. NMDA receptor modulator 4 can be used for neurological disorder research.
  • HY-143391
    NMDA receptor modulator 3

    iGluR Neurological Disease
    NMDA receptor modulator 3 (Compound 99) is a potent NMDA receptor modulator. NMDA receptor modulator 3 can be used for neurological disorder research.
  • HY-135772
    12-Ketodeoxycholic acid

    Endogenous Metabolite Metabolic Disease
    12-Ketodeoxycholic acid is a bile acid, metabolite from kidney. 12-Ketodeoxycholic acid can be a detectable marker for evidence of kidney injury
  • HY-143397
    NMDA receptor modulator 6

    iGluR Neurological Disease
    NMDA receptor modulator 6 (Compound 183) is a potent NMDA receptor modulator. NMDA receptor modulator 6 can be used for neurological disorder research.
  • HY-151123
    Pelacarsen

    AKCEA-APO(a)-LRx; TQJ230

    Others Cardiovascular Disease
    Pelacarsen (AKCEA-APO(a)-LRx) is a liver-specific antisense oligonucleotide against apolipoprotein(a) that reduces lipoprotein(a) up to 80% with good tolerability.
  • HY-N2807
    Acanthoside B

    Others Inflammation/Immunology Neurological Disease
    Acanthoside B is a potential bioactive lignan with anti-inflammatory and anti-amnesic activities. Acanthoside B can be used for alzheimer's disease and lung inflammation research
  • HY-108052
    Delphinidin 3-glucoside chloride

    Delphinidin 3-O-glucoside chloride; Delphinidin 3-O-β-glucoside chloride

    EGFR Apoptosis Cancer
    Delphinidin 3-glucoside chloride (Delphinidin 3-O-glucoside chloride) is an active anthocyanin found in Hibiscus sabdariffa extract. Delphinidin 3-glucoside chloride induces a pro-apoptotic effect in B cell chronic lymphocytic leukaemia (B CLL). Delphinidin 3-glucoside chloride exerts phytoestrogen activity by binding to ERβ, with an IC50 of 9.7 μM. Delphinidin-3-O-glucoside chloride inhibits EGFR with an IC50 of 2.37 µM.
  • HY-124623
    DNDI-8219

    Parasite Infection
    DNDI-8219 (compound 58) is a potent selective and orally active trypanocidal agent, possessing inhibitory activity against Trypanosoma cruzi (T. cruzi) with an IC50 of 0.4 μM. DNDI-8219 has low cytotoxicity (L6 cells IC50 > 100 μM). DNDI-8219 can effectively cure chronic T. cruzi infection and markedly reduce parasite burdens in mouse model. DNDI-8219 has good solubility, metabolic stability and safety.
  • HY-18862
    PF-03715455

    p38 MAPK Inflammation/Immunology
    PF-03715455 is a potent inhaled p38 MAPK inhibitor. PF-03715455 shows some selectivity for p38α over p38β with respective IC50 values of 0.88 and 23 nM. PF-03715455 potently inhibits LPS-induced TNFα production in human whole blood (IC50=1.7 nM). PF-03715455 has potential for the treatment of COPD (chronic obstructive pulmonary disease).
  • HY-135976
    P2X3 antagonist 34

    P2X Receptor Inflammation/Immunology Neurological Disease
    P2X3 antagonist 34 is a potent, selective and orally active P2X3 homotrimeric receptor antagonist with IC50s of 25 nM, 92 nM and 126 nM for human P2X3, rat P2X3 and guinea pig P2X3 receptors, respectively. P2X3 antagonist 34 is less active against human, rat and guinea pig P2X2/3 heterotrimeric receptors. P2X3 antagonist 34 has strong anti-tussive effect.
  • HY-108601A
    Ro 32-0432 hydrochloride

    PKC Inflammation/Immunology Neurological Disease
    Ro 32-0432 hydrochloride is a potent, selective, ATP-competitive and orally active PKC inhibitor. The IC50 values of Ro 32-0432 hydrochloride for PKCα, PKCβI, PKCβII, PKCγ and PKCε are 9.3 nM, 28 nM, 30 nM, 36.5 nM and 108.3 nM, respectively. Ro 32-0432 hydrochloride is also a selective G protein-coupled receptor kinase 5 (GRK5) inhibitor. Ro 32-0432 hydrochloride prevents T-cell activation and has the potential for chronic inflammatory and autoimmune diseases research.
  • HY-N0632
    Esculentoside A

    COX NF-κB Inflammation/Immunology
    Esculentoside A (EsA), a kind of triterpene saponin isolated from roots of Phytolacca esculenta. Esculentoside A (EsA) possesses anti-inflammatory activity in acute and chronic experimental models, has selective inhibitory activity towards cyclooxygenase-2 (COX-2). Esculentoside A (EsA) suppresses inflammatory responses in LPS-induced acute lung injury (ALI) through inhibition of the nuclear factor kappa B (NF-ΚB) and mitogen activated protein kinase (MAPK) signaling pathways.
  • HY-B0725
    Doxepin Hydrochloride

    Histamine Receptor Cytochrome P450 Neurological Disease
    Doxepin hydrochloride is an orally active tricyclic antidepressant agent. Doxepin hydrochloride is a potent and selective histamine receptor H1 antagonist. Doxepin hydrochloride is also a potent CYP450 inhibitor and significantly inhibits CYP450 2C19 and 1A2. Doxepin inhibits reuptake of serotonin and norepinephrine as a tricyclic antidepressant.
    . Doxepin has therapeutic effects in atopic dermatitis,chronic urticarial,can improve cognitive processes, protect central nervous system.
    . Doxepin has also been proposed as a protective factor against oxidative stress.
    .
  • HY-106353
    Smilagenin

    Endogenous Metabolite mAChR Neurological Disease
    Smilagenin (SMI) is a small-molecule steroidal sapogenin from Anemarrhena asphodeloides and Pelargonium hortorum widely used in traditional Chinese medicine for treating chronic neurodegeneration diseases. Smilagenin (SMI) improves memory of aged rats by increasing the muscarinic receptor subtype 1 (M1)-receptor density. Smilagenin (SMI) attenuates Aβ(25-35)-induced neurodegenerationvia stimulating the gene expression of brain-derived neurotrophic factor, may represents a novel therapeutic strategy for AD.
  • HY-P99198
    Fletikumab

    NNC 0109-0012

    Interleukin Related Inflammation/Immunology
    Fletikumab (NNC0109-0012) is a monoclonal antibody targeting to IL-20. Fletikumab can be used for inflammation research, such as rheumatoid arthritis.
  • HY-124600
    NVR 3-778

    HBV Infection
    NVR 3-778 is a first-in-Class and oral bioavailable HBV CAM (capsid assembly modulator) belonging to the SBA (sulfamoylbenzamide) class, with anti-HBV activity.
  • HY-15306S1
    Eltrombopag-d9

    SB-497115-d9

    Thrombopoietin Receptor Bacterial Apoptosis Cancer Infection Cardiovascular Disease
    Eltrombopag-d9 (SB-497115-d9) is the deuterium labeled Eltrombopag (HY-15306A). Eltrombopag (SB-497115) is an orally active thrombopoietin receptor nonpeptide agonist. Eltrombopag owns thrombopoietic activity, and has been used to research low blood platelet counts with chronic immune thrombocytopenia. Eltrombopag can be used for the research of cardiovascular. Eltrombopag also has highly inhibitory effects against multidrug resistant Staphylococcus aureus. Eltrombopag can induce apoptosis in hepatocellular carcinomab (HCC) as well.
  • HY-126291
    GNE-616

    Sodium Channel Neurological Disease
    GNE-616 is a highly potent, metabolically stable, orally bioavailable, and subtype selective Nav1.7 inhibitor (Ki of 0.79 nM and Kd of 0.38 nM for hNav1.7) for the treatment of chronic pain. GNE-616 shows >1000 nM Kd and >2500-fold selectivity over hNav1.1, hNav1.3, hNav1.4, and hNav1.5. Selectivity over hNav1.2 and hNav1.6 is more modest at 31- and 73-fold, respectively.
  • HY-118948
    MSN-50

    Bcl-2 Family Neurological Disease
    MSN-50 is a Bax and Bak oligomerization inhibitor. MSN-50 efficiently inhibits liposome permeabilization, prevents genotoxic cell death and promotes neuroprotection.
  • HY-123450
    S116836

    Bcr-Abl Apoptosis PDGFR Cancer
    S116836, a potent, orally active BCR-ABL tyrosine kinase inhibitor, blocks both wild-type as well as T315I Bcr-Abl. S116836 arrests the cells in the G0/G1 phase of cell cycle, induces apoptosis, increases ROS production, and decreases GSH production in BaF3/WT and BaF3/T315I cells. S116836 also inhibits SRC, LYN, HCK, LCK and BLK, and receptor tyrosine kinases such as FLT3, TIE2, KIT, PDGFR-β. Antitumor activies.
  • HY-117718
    AG957

    Tyrphostin AG957; NSC 654705

    Bcr-Abl Cancer
    AG957 (Tyrphostin AG957;NSC 654705) is a tyrosine kinase inhibitor with anti-BCR/ABL tyrosine kinase activity. AG957 is a bcr/abl kinase inhibitor with an IC50 of 2.9 μM for p210 bcr/abl autokinase activity.
  • HY-19519
    Ladarixin

    DF 2156A free base

    CXCR Cancer Inflammation/Immunology
    Ladarixin (DF 2156A free base) is an orally active, allosteric non-competitive and dual CXCR1 and CXCR2 antagonist. Ladarixin can be used for the research of COPD and asthma.
  • HY-113432
    Nudifloramide

    2PY

    Endogenous Metabolite PARP Metabolic Disease
    Nudifloramide (2PY) is one of the end products of nicotinamide-adenine dinucleotide (NAD) degradation. Nudifloramide significantly inhibits poly(ADP-ribose) polymerase (PARP-1) activity in vitro.
  • HY-19519A
    Ladarixin sodium

    DF 2156A

    CXCR Infection Inflammation/Immunology
    Ladarixin sodium (DF 2156A) is an orally active, allosteric non-competitive and dual CXCR1 and CXCR2 antagonist. Ladarixin sodium can be used for the research of COPD and asthma.
  • HY-15306S
    (E/Z)-Eltrombopag 13C4

    (E/Z)-SB-497115 13C4

    Thrombopoietin Receptor Bacterial Apoptosis Cancer Infection Cardiovascular Disease
    (E/Z)-Eltrombopag 13C4 ((E/Z)-SB-497115 13C4) is a mixture complex of E-Eltrombopag and Z-Eltrombopag, with 13C labeled. Z-Eltrombopag is an orally active thrombopoietin receptor nonpeptide agonist. Eltrombopag owns thrombopoietic activity, and has been used to research low blood platelet counts with chronic immune thrombocytopenia. Eltrombopag can be used for the research of cardiovascular. Eltrombopag also has highly inhibitory effects against multidrug resistant Staphylococcus aureus. Eltrombopag can induce apoptosis in hepatocellular carcinomab (HCC) as well.
  • HY-151134
    HBV-IN-25

    HBV Infection
    HBV-IN-25 is a good potency, orally active novel HBV cccDNA reducer. HBV-IN-25 has anti-HBeAg potency and anti-HBV activity with IC50 values of 0.58 μM and 1.15 μM, respectively. HBV-IN-25 has good aqueous solubility (LYSA>452 μg/mL) and good PK property with no cellular toxicity.
  • HY-W040022
    Cefcapene pivoxil hydrochloride hydrate

    Bacterial Antibiotic Infection
    Cefcapene pivoxil hydrochloride hydrate is a prodrug and an orally active 3rd-generation cephalosporin with broad-spectrum of anti-bacterial activity. Cefcapene pivoxil hydrochloride hydrate is used for the study of palmoplantar pustulosis (PPP) and other infectious diseases.
  • HY-10790S
    Cilomilast-d9

    Phosphodiesterase (PDE) Inflammation/Immunology
    Cilomilast-d9 (SB-207499-d9) is the deuterium labeled Cilomilast. Cilomilast (SB-207499) is a potent, selective and orally active inhibitor of Phosphodiesterase 4 (PDE4), with IC50s of ~100 and 120 nM for LPDE4 and HPDE4, respectively. Cilomilast shows selectivity for PDE4 over PDE1, PDE2, PDE3 and PDE5 (IC50=74, 65, >100, and 83 µM, respectively). Cilomilast has anti-inflammatory and immunomodulatory effects and can be used for thr research of asthma and chronic obstructive pulmonary disease (COPD).
  • HY-150579
    Keap1-Nrf2-IN-13

    Keap1-Nrf2 Cancer Inflammation/Immunology
    Keap1-Nrf2-IN-13 is a Keap1-Nrf2 protein–protein interaction (PPI) inhibitor with an IC50 value of 0.15 μM. Keap1-Nrf2-IN-13 has strong binding affinities to the Keap1 protein by forming hydrogen bond with the key polar residues (Asn414, Arg415, Arg483, Gln530). Keap1-Nrf2-IN-13 can be used in the research of oxidative stress-related and inflammatory diseases, including pulmonary fibrosis, chronic obstructive pulmonary disorder (COPD) and cancers.
  • HY-136650
    Fludarabine triphosphate

    F-ara-ATP

    Nucleoside Antimetabolite/Analog Drug Metabolite DNA/RNA Synthesis Apoptosis Cancer
    Fludarabine triphosphate (F-ara-ATP), the active metabolite of Fludarabine (HY-B0069), is a potent, noncompetitive and specific inhibitor of DNA primase, with an IC50 of 2.3 μM and a Ki of 6.1 μM. Fludarabine triphosphate inhibits DNA synthesis by blocking DNA primase and primer RNA formation. Fludarabine triphosphate inhibits ribonucleotide reductase and DNA polymerase and ultimately leads to cellular apoptosis.
  • HY-103370
    Talniflumate

    BA 7602-06

    Chloride Channel Inflammation/Immunology
    Talniflumate (BA 7602-06) is the prodrug of Niflumic acid (HY-B0493), exerting its activity in the body through conversion to niflumic acid by esterase. Talniflumate is an orally active Ca 2+-activated Cl - channel (CaCC) blocker. Talniflumate can be used as an analgesic and anti-inflammatory agent in cystic fibrosis mouse model of distal intestinal obstructive syndrome.
  • HY-136650A
    Fludarabine triphosphate trisodium

    F-ara-ATP trisodium

    Nucleoside Antimetabolite/Analog Drug Metabolite DNA/RNA Synthesis Apoptosis Cancer
    Fludarabine triphosphate (F-ara-ATP) trisodium, the active metabolite of Fludarabine (HY-B0069), is a potent, noncompetitive and specific inhibitor of DNA primase, with an IC50 of 2.3 μM and a Ki of 6.1 μM. Fludarabine triphosphate trisodium inhibits DNA synthesis by blocking DNA primase and primer RNA formation. Fludarabine triphosphate trisodium inhibits ribonucleotide reductase and DNA polymerase and ultimately leads to cellular apoptosis.
  • HY-14951
    Firategrast

    SB 683699

    Integrin Neurological Disease
    Firategrast (SB 683699) is an orally active and specific α4β1/α4β7 integrin antagonist. Firategrast reduces trafficking of lymphocytes into the central nervous system (CNS) and decreases multiple sclerosis (MS) activity.
  • HY-P0299
    LSKL, Inhibitor of Thrombospondin (TSP-1)

    TGF-β Receptor Cancer
    LSKL, Inhibitor of Thrombospondin (TSP-1) is a latency-associated protein (LAP)-TGFβ derived tetrapeptide and a competitive TGF-β1 antagonist. LSKL, Inhibitor of Thrombospondin (TSP-1) inhibits the binding of TSP-1 to LAP and alleviates renal interstitial fibrosis and hepatic fibrosis. LSKL, Inhibitor of Thrombospondin (TSP-1) suppresses subarachnoid fibrosis via inhibition of TSP-1-mediated TGF-β1 activity, prevents the development of chronic hydrocephalus and improves long-term neurocognitive defects following subarachnoid hemorrhage (SAH). LSKL, Inhibitor of Thrombospondin (TSP-1) can readily crosse the blood-brain barrier.
  • HY-P0299A
    LSKL, Inhibitor of Thrombospondin (TSP-1) (TFA)

    TGF-β Receptor Cancer
    LSKL, Inhibitor of Thrombospondin (TSP-1) TFA is a latency-associated protein (LAP)-TGFβ derived tetrapeptide and a competitive TGF-β1 antagonist. LSKL, Inhibitor of Thrombospondin (TSP-1) TFA inhibits the binding of TSP-1 to LAP and alleviates renal interstitial fibrosis and hepatic fibrosis. LSKL, Inhibitor of Thrombospondin (TSP-1) TFA suppresses subarachnoid fibrosis via inhibition of TSP-1-mediated TGF-β1 activity, prevents the development of chronic hydrocephalus and improves long-term neurocognitive defects following subarachnoid hemorrhage (SAH). LSKL, Inhibitor of Thrombospondin (TSP-1) TFA can readily crosse the blood-brain barrier.
  • HY-148525
    β2AR/M-receptor agonist-2

    mAChR Adrenergic Receptor Inflammation/Immunology Cardiovascular Disease
    β2AR/M-receptor agonist-2 (compound 15) is a muscarinic antagonist and β2 adrenoceptor agonist (MABA). β2AR/M-receptor agonist-2 shows potency to β2 adrenoceptor with an EC50 value of 3.7 nM. β2AR/M-receptor agonist-2 also has potency to human cloned M3 receptor with a Ki value of 0.73 nM. β2AR/M-receptor agonist-2 is a potent bronchodilator, it can be used for the research of chronic obstructive pulmonary disease (COPD).
  • HY-120508
    Pivanex

    AN-9; Pivalyloxymethyl butyrate

    HDAC Bcr-Abl Apoptosis Cancer Inflammation/Immunology
    Pivanex (AN-9), a derivative of Butyric acid, is an orally active HDAC inhibitor. Pivanex down-regulates bcr-abl protein and enhances apoptosis. Pivanex has antimetastic and antiangiogenic properties.
  • HY-17600S
    Acalabrutinib-d4

    ACP-196-d4

    Btk Cancer
    Acalabrutinib D4 (ACP-196 D4) is a deuterium labeled Acalabrutinib. Acalabrutinib (ACP-196) is an orally active, irreversible, and highly selective second-generation BTK inhibitor.
  • HY-109556
    Insulin Detemir

    Akt ERK Metabolic Disease
    Insulin Detemir is an artificial insulin, shows effect on controlling blood sugar levels. Insulin Detemir stimulates GLP-1 secretion as a consequence of enhanced Gcg expression by a mechanism involving activation of Akt- and/or extracellular signal-regulated kinase (ERK)-dependent-cat and CREB signaling pathways. Insulin Detemir can be used for type 2 diabetes research.
  • HY-117626
    LP-935509

    AAK1 Cyclin G-associated Kinase (GAK) SARS-CoV Infection Inflammation/Immunology Neurological Disease
    LP-935509 is an orally active, potent, selective, ATP-competitive and brain-penetrant inhibitor of adaptor protein-2 associated kinase 1 (AAK1) with an IC50 of 3.3 nM and a Ki of 0.9 nM, respectively. LP-935509 is also a potent inhibitor of BIKE (IC50=14 nM) and a modest inhibitor of GAK (IC50=320 nM). LP-935509 shows antinociceptive activity. LP-935509 can be used for neuropathic pain and SARS-CoV-2 research.
  • HY-18698
    L-701324

    iGluR Neurological Disease
    L-701324 is a potent, orally active NMDA receptor antagonist that antagonizes the activity of the NMDA receptor by blocking its glycine B binding site. L-701324 binds with high affinity to rat brain membranes (IC50=2 nM). L-701324 has antidepressant activity.
  • HY-103445
    SSR69071

    Elastase Cardiovascular Disease
    SSR69071 is a potent, orally active and selective inhibitor of neutrophil elastase. SSR69071 reduces myocardial infarct size following ischemia-reperfusion injury. SSR69071 displays a higher affinity for human elastase (Ki=0.0168 nM) than for rat (Ki=3 nM), mouse (Ki=1.8 nM), and rabbit (Ki= 58 nM) elastases.
  • HY-B1588S
    Carbenoxolone-d4

    Amyloid-β HIV 11β-HSD Infection Inflammation/Immunology Neurological Disease
    Carbenoxolone-d4 is deuterium labeled Carbenoxolone. Carbenoxolone, a semi-synthetic derivative of glycyrrhetinic acid, has previously been used for the management of dyspepsia and peptic ulcer because of its anti-inflammatory properties. Carbenoxolone, a general hemichannel and gap junction inhibitor, has the therapeutic potential of carbenoxolone in the treatment of chronic liver disease. Carbenoxolone is a suitable candidate for the inhibition of Aβ42 aggregation and the therapeutic potential of Cbx against AD. Carbenoxolone is small molecule Pannexin1 (Panx1,is an ATP release channel) inhibitor, attenuate Panx1 channel activity through modulation of the first extracellular loop. Carbenoxolone is an 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) inhibitor that converts inactive glucocorticoid into an active form. Carbenoxolone has antiviral activity against DENV infection targeting the virus itself.
  • HY-144782
    HDAC10-IN-2

    HDAC Autophagy Cancer
    HDAC10-IN-2 (compound 10c) is a potent and highly selective HDAC10 inhibitor, with an IC50 of 20 nM. HDAC10-IN-2 modulates autophagy in aggressive FLT3-ITD positive acute myeloid leukemia cells.
  • HY-144779
    HDAC10-IN-1

    HDAC Autophagy Cancer
    HDAC10-IN-1 (compound 13b) is a potent and highly selective HDAC10 inhibitor, with an IC50 of 58 nM. HDAC10-IN-1 modulates autophagy in aggressive FLT3-ITD positive acute myeloid leukemia cells.
  • HY-101290A
    BMT-090605 hydrochloride

    Cyclin G-associated Kinase (GAK) AAK1 Neurological Disease
    BMT-090605 hydrochloride is a potent, selective the adapter protein-2 associated kinase 1 (AAK1) inhibitor with an IC50 value of 0.6 nM. BMT-090605 hydrochloride shows antinociceptive activity. BMT-090605 hydrochloride inhibits BMP-2-inducible protein kinase (BIKE) and Cyclin G-associated kinase (GAK) with IC50 values of 45 nM and 60 nM, respectively. BMT-090605 hydrochloride can be used for the research of neuropathic pain.
  • HY-W352344
    2'-Deoxy-L-adenosine

    HBV Infection
    2'-Deoxy-L-adenosine is an orally active synthon for modified oligodeoxyribonucleotides. 2'-Deoxy-L-adenosine is a potent, specific and selective inhibitor of the replication of hepatitis B virus (HBV) as well as the closely related duck and woodchuck hepatitis viruses (WHV).
  • HY-101290
    BMT-090605

    AAK1 Cyclin G-associated Kinase (GAK) Neurological Disease
    BMT-090605 is a potent, selective the adapter protein-2 associated kinase 1 (AAK1) inhibitor with an IC50 value of 0.6 nM. BMT-090605 shows antinociceptive activity. BMT-090605 inhibits BMP-2-inducible protein kinase (BIKE) and Cyclin G-associated kinase (GAK) with IC50 values of 45 nM and 60 nM, respectively. BMT-090605 can be used for the research of neuropathic pain.
  • HY-13599
    Cladribine

    2-Chloro-2′-deoxyadenosine; CldAdo; 2CdA

    Adenosine Deaminase Apoptosis Cardiovascular Disease Cancer
    Cladribine (2-Chloro-2′-deoxyadenosine), a purine nucleoside analog, is an orally active adenosine deaminase inhibitor. Cladribine functions as an inhibitor of DNA synthesis to block the repair of the damaged DNA. Cladribine can inhibit DNA methylation. Cladribine has anti-lymphoma activity. Cladribine can be used for the research of several hematologic malignancies and multiple sclerosis.