2. Search Result
Search Result
Results for "

diseases

" in MCE Product Catalog:

9627

Inhibitors & Agonists

83

Screening Libraries

57

Fluorescent Dye

117

Biochemical Assay Reagents

999

Peptides

162

Inhibitory Antibodies

1529

Natural
Products

977

Isotope-Labeled Compounds

Cat. No. Product Name Target Research Areas
  • HY-P4040
    Ac-D-DGla-LI-Cha-C

    		HCV Protease Cancer Infection Metabolic Disease Inflammation/Immunology Neurological Disease
    Ac-D-DGla-LI-Cha-C is a potent HCV protease inhibitor peptide. Ac-D-DGla-LI-Cha-C can be used for the research of cancer, autoimmune diseases, fibrotic diseases, inflammatory diseases, neurodegenerative diseases, infectious diseases, lung diseases, heart and vascular diseases and metabolic diseases.
  • HY-147108
    Mitochondria degrader-1

    		Mitochondrial Metabolism Cancer Metabolic Disease Inflammation/Immunology Neurological Disease
    Mitochondria degrader-1 (example 5) is a potent mitochondria degrader. Mitochondria degrader-1 induces the degradation of the injured mitochondria by the autophagy mechanism. Mitochondria degrader-1 can be used for the research of neurodegenerative disease, cancer, inflammatory disease, age-related disease, metabolic disease, mitochondrial disease or Down's disease.
  • HY-137431A
    (R)-Asundexian

    (R)-BAY-2433334

    		 Others Cardiovascular Disease
    (R)-Asundexian ((R)-BAY-2433334) is the enantiomer of Asundexian (HY-137431). (R)-Asundexian can be used in studies of cardiovascular disease (especially thrombotic or thromboembolic disease), edema, and ophthalmic disease.
  • HY-122105
    JNJ-40255293

    		Adenosine Receptor Neurological Disease
    JNJ-40255293 is a high-affinity human A 2A receptor antagonist with a KiKi of 7.5 nM. JNJ-40255293 can be used in the research of neurodegenerative diseases such as Parkinson's disease.
  • HY-153427
    Tau protein aggregation-IN-1

    		Tau Protein Neurological Disease
    Tau protein aggregation-IN-1 (Compound 0c) is a Tau protein aggregation inhibitor. Tau protein aggregation-IN-1 can be used in the study of protein folding disorders such as Alzheimer's disease, dementia, Parkinson's disease, Huntington's disease and prion-based spongiform encephalopathies.
  • HY-132594
    Lexanersen

    WVE-120102

    		 Huntingtin Neurological Disease
    Lexanersen (WVE-120102) is an antisense oligonucleotide used for the study of Huntington's disease.
  • HY-118284
    Vicagrel

    		P2Y Receptor Cardiovascular Disease
    Vicagrel is a potent, safe and orally active antiplatelet agent, which works by irreversibly inhibiting P2Y12 receptor. Vicagrel can be used for the research of blood clots in coronary artery disease, peripheral vascular disease, and cerebrovascular disease.
  • HY-16743
    Ibiglustat

    Venglustat; SAR402671; GZ402671

    		 Glucosylceramide Synthase (GCS) Metabolic Disease
    Ibiglustat (Venglustat) is an orally active, brain-penetrant glucosylceramide synthase (GCS) inhibitor. Ibiglustat can be used for the research of Gaucher disease type 3, Parkinson's disease associated with GBA mutations, Fabry disease, GM2 gangliosidosis, and autosomal dominant polycystic kidney disease.
  • HY-16743B
    Ibiglustat succinate

    Venglustat succinate; SAR402671 succinate; GZ402671 succinate

    		 Glucosylceramide Synthase (GCS) Neurological Disease
    Ibiglustat (Venglustat) succinate is an orally active, brain-penetrant glucosylceramide synthase (GCS) inhibitor. Ibiglustat succinate can be used for the research of Gaucher disease type 3, Parkinson's disease associated with GBA mutations, Fabry disease, GM2 gangliosidosis, and autosomal dominant polycystic kidney disease.
  • HY-16743A
    Ibiglustat (L-Malic acid)

    Venglustat (L-Malic acid); SAR402671 (L-Malic acid); GZ402671 (L-Malic acid)

    		 Glucosylceramide Synthase (GCS) Metabolic Disease
    Ibiglustat (Venglustat) L-Malic acid is an orally active, brain-penetrant glucosylceramide synthase (GCS) inhibitor. Ibiglustat L-Malic acid can be used for the research of Gaucher disease type 3, Parkinson's disease associated with GBA mutations, Fabry disease, GM2 gangliosidosis, and autosomal dominant polycystic kidney disease.
  • HY-107337
    Delapril hydrochloride

    		Angiotensin-converting Enzyme (ACE) Cardiovascular Disease
    Delapril hydrochloride is an angiotensin-converting enzyme (ACE) inhibitor for the treatment of cardiovascular diseases.
  • HY-P99356
    Cinpanemab

    BIIB054; Anti-Alpha-synuclein Reference Antibody (cinpanemab)

    		 α-synuclein Neurological Disease
    Cinpanemab (BIIB054) is a human-derived monoclonal antibody that binds to α-synuclein. Cinpanemab can be used for the research of Parkinson's disease.
  • HY-147240
    Acloproxalap

    		Others Infection Inflammation/Immunology Cardiovascular Disease
    Acloproxalap is a quinoline-based aldehyde scavenger that can be used in studies of diseases with toxic aldehyde accumulation, such as inflammatory diseases of the eye and skin, respiratory diseases such as pneumonia, organ diseases, and viral infection-related syndromes.
  • HY-40294
    Indazole

    		Monoamine Oxidase GSK-3 LRRK2 Cancer Neurological Disease Cardiovascular Disease
    Indazole, also called isoindazole, a heterocyclic aromatic organic compound. Its derivatives display a broad variety of biological activities including anti-inflammatory, antibacterial, anti-HIV, antiarrhythmic, antifungal and antitumour properties. Indazole and its derivatives can be used for research of cancer, neurological disorders, cardiovascular diseases, gastrointestinal diseases.
  • HY-147579
    Axl-IN-12

    		TAM Receptor Cancer Infection Inflammation/Immunology
    Axl-IN-12 (Example 2) is a potent AXL inhibitor. Axl-IN-12 can be used for the research of proliferative diseases, autoimmune diseases, allergic diseases, inflammatory diseases, transplant rejection, cancers, viral infectious diseases or other diseases of mammals.
  • HY-147578
    Axl-IN-11

    		TAM Receptor Cancer Infection Inflammation/Immunology
    Axl-IN-11 (Example 1) is a potent AXL inhibitor. Axl-IN-11 can be used for the research of proliferative diseases, autoimmune diseases, allergic diseases, inflammatory diseases, transplant rejection, cancers, viral infectious diseases or other diseases of mammals.
  • HY-145584
    Nesuparib

    JPI-547/OCN-201

    		 PARP Neurological Disease Cardiovascular Disease
    Nesuparib is a potent inhibitor of PARP. Nesuparib is useful for the research of neuropathic pain, neurodegenerative disease, and cardiovascular disease (extracted from patent WO2016200101A2).
  • HY-150018
    N-Demethyl MK-6884

    		mAChR Neurological Disease
    N-Demethyl MK-6884 (compound 34) is a potent M4 mAChR allosteric modulator. N-Demethyl MK-6884 can be used in the studies of alzheimer's disease and other diseases mediated by the M4 mAChR.
  • HY-90009B
    cis-Tadalafil

    cis-IC-351

    		 Phosphodiesterase (PDE) Cardiovascular Disease
    cis-Tadalafil is a PDE5 inhibitor (IC50: 0.09 μM). cis-Tadalafil can be used for research of cardiovascular diseases.
  • HY-121340
    Emylcamate

    		Others Neurological Disease
    Emylcamate is a potent muscle relaxant. Emylcamate has the potential for the research of neurological diseases.
  • HY-15976
    P7C3

    		Others Neurological Disease
    P7C3 is an orally bioavailable and blood-brain barrier penetrant aminopropyl carbazole, with neuroprotective effects. P7C3 can be used for the research of neurodegenerative diseases, including Parkinson's disease.
  • HY-B1680
    Lithium citrate

    Litarex

    		 Others Neurological Disease
    Lithium citrate reduces excessive intra-cerebral N-acetyl aspartate in Canavan disease.
  • HY-103499
    ZK 93426 hydrochloride

    		Others Neurological Disease
    ZK 93426 (hydrochloride) is a benzodiazepine antagonist. ZK 93426 (hydrochloride) can be used for the research of neurological disease.
  • HY-135601
    Cinacalcet metabolite M4

    		Drug Metabolite Cardiovascular Disease
    Cinacalcet metabolite M4 is a metabolite of Cinacalcet. Cinacalcet is an orally active, allosteric agonist of Ca receptor (CaR), used for cardiovascular disease.
  • HY-144399
    CD33 splicing modulator 1

    		Others Neurological Disease
    CD33 splicing modulator 1 (Compound 1) is a CD33 splicing modulator. CD33/Siglec 3 is a myeloid lineage cell surface receptor that is known to regulate microglia activity. CD33 splicing modulator 1 increases exon 2 skipping in cellular mRNA pools. CD33 splicing modulator 1 has the potential for the research of neurodegenerative disease including Alzheimer's disease.
  • HY-144399A
    CD33 splicing modulator 1 hydrochloride

    		Others Neurological Disease
    CD33 splicing modulator 1 (Compound 1) hydrochloride is a CD33 splicing modulator. CD33/Siglec 3 is a myeloid lineage cell surface receptor that is known to regulate microglia activity. CD33 splicing modulator 1 hydrochloride increases exon 2 skipping in cellular mRNA pools. CD33 splicing modulator 1 hydrochloride has the potential for the research of neurodegenerative disease including Alzheimer's disease.
  • HY-144682
    O-GlcNAcase-IN-4

    		Others Neurological Disease
    O-GlcNAcase-IN-4 is a O-GlcNAcase inhibitor extracted from patent WO2018140299A1 Formulaic Ic. O-GlcNAcase-IN-4 can be used for the research of neurodegenerative diseases and disorders, such as Alzheimer's disease.
  • HY-105545
    Dexetimide

    (+)-Benzetimide; (S)-(+)-Dexetimide; Dexbenzetimide

    		 mAChR Neurological Disease
    Dexetimide ((+)-Benzetimide; (S)-(+)-Dexetimide; Dexbenzetimide) is a piperidine anticholinergic and a high-affinity muscarinic receptor antagonist. Dexetimide can be used in studies of parkinson's disease.
  • HY-123176
    GYKI-13380

    		Others Neurological Disease
    GYKI-13380 is an appetite suppressant. GYKI-13380 has the potential for the research of neurology diseases.
  • HY-115919
    AChE-IN-8

    		Cholinesterase (ChE) Neurological Disease
    AChE-IN-8 (Compound 19) is a potent inhibitor of AChE with an IC50 of 1.95 μM. AChE-IN-8 has the potential for the research of Alzheimer's disease.
  • HY-100411
    MLi-2

    		LRRK2 Neurological Disease
    MLi-2 is an orally active and highly selective LRRK2 inhibitor with an IC50 of 0.76 nM. MLi-2 has the potential for Parkinson’s disease.
  • HY-147233
    MIND4-19

    		Sirtuin Neurological Disease
    MIND4-19 is a potent SIRT2 inhibitor with an IC50 value of 7.0 μM. MIND4-19 can be used for researching Huntington's disease.
  • HY-147296
    Omesdafexor

    MET642

    		 FXR Cancer Metabolic Disease Inflammation/Immunology
    Omesdafexor is a FXR agonist. Omesdafexor can be used in the research of liver disease or a metabolic inflammation-mediated disease.
  • HY-P1362A
    β-Amyloid (42-1), human TFA

    Amyloid β Peptide (42-1)(human) TFA

    		 Amyloid-β Neurological Disease
    β-Amyloid (42-1), human TFA is the inactive form of Amyloid β Peptide (1-42). β-Amyloid (42-1), human TFA is a 42-amino acid peptide which plays a key role in the pathogenesis of Alzheimer disease.
  • HY-121949
    U-0521

    		Others Neurological Disease
    U-0521 is the inhibitor of the catechol-O-methyltransferase (COMT). U-0521 has the potential for the research of Parkinson's disease.
  • HY-144776
    NAT

    		NAMPT Neurological Disease Cancer
    NAT is an initial hit of NAMPT activator. NAMPT is the rate-limiting enzyme in the NAD salvage pathway, which makes it an attractive target for the research of many diseases associated with NAD exhaustion such as neurodegenerative diseases.
  • HY-B1786A
    (E/Z)-Sulindac sulfide

    		γ-secretase Amyloid-β Neurological Disease
    (E/Z)-Sulindac sulfide is a potent γ-secretase modulator (GSM). (E/Z)-Sulindac sulfide selectively reduces Aβ42 production in favor of shorter Aβ species. (E/Z)-Sulindac sulfide can be used for researching Alzheimer’s disease.
  • HY-147134
    GSK-3β inhibitor 10

    		GSK-3 Neurological Disease
    GSK-3β inhibitor 10 (compound 14a) is a highly potent GSK-3β inhibitor with an IC50 value of 80.5 nM. GSK-3β inhibitor 10 can be used for researching Alzheimer’s disease.
  • HY-132821A
    Irsenontrine maleate

    E2027 maleate

    		 Phosphodiesterase (PDE) Neurological Disease
    Irsenontrine (E2027) maleate is an orally active and selective phosphodiesterase 9 (PDE9) inhibitor. Irsenontrine maleate can be used for the research of neurological diseases.
  • HY-113969
    7,8-Dichloro-1,2,3,4-tetrahydroisoquinoline

    		Endogenous Metabolite Neurological Disease
    7,8-Dichloro-1,2,3,4-tetrahydroisoquinoline (compound 11), a tetrahydroisoquinoline (THIQ) derivative, is a selective phenylethanolamine N-methyltransferase (PNMT) inhibitor with a Ki value of 0.3 μM. 7,8-Dichloro-1,2,3,4-tetrahydroisoquinoline can be used in research on psychiatric disorders related to Alzheimer's disease and Parkinson's disease.
  • HY-144764
    5-HT1A antagonist 1

    		5-HT Receptor Neurological Disease
    5-HT1A antagonist 1 (compound 6f) is a potent and selective antagonist of 5-HT1A receptor, with a Ki of 35 nM. 5-HT1A antagonist 1 can be used for the research of CNS diseases.
  • HY-132821
    Irsenontrine

    E2027

    		 Phosphodiesterase (PDE) Neurological Disease
    Irsenontrine (E2027) is an orally active and selective phosphodiesterase 9 (PDE9) inhibitor. Irsenontrine can be used for the research of neurological diseases.
  • HY-19490A
    (S)-VQW-765

    (S)-AQW-051

    		 nAChR Neurological Disease
    (S)-VQW-765 ((S)-AQW-051) is an orally active, selective and effective α7 nicotinic ACh receptor (nAChR) partial agonist. (S)-VQW-765 has potential applications in cognitive disorders related to neurological diseases, such as Alzheimer's disease or schizophrenia.
  • HY-147576
    Axl-IN-9

    		TAM Receptor Cancer Inflammation/Immunology
    Axl-IN-9 (Example 10) is a potent AXL inhibitor, with an IC50 of 26 nM. Axl-IN-9 has excellent transmembrane properties. Axl-IN-9 exhibits excellent pharmacokinetic properties in an animal body. Axl-IN-9 can be used for the research of proliferative diseases, autoimmune diseases, allergic diseases, inflammatory diseases, transplant rejection, cancer, or other diseases in mammals.
  • HY-147577
    Axl-IN-10

    		TAM Receptor Cancer Inflammation/Immunology
    Axl-IN-10 (Example 1) is a potent AXL inhibitor, with an IC50 of 5 nM. Axl-IN-10 has excellent transmembrane properties.Axl-IN-10 exhibits excellent pharmacokinetic properties in an animal body. Axl-IN-10 can be used for the research of proliferative diseases, autoimmune diseases, allergic diseases, inflammatory diseases, transplant rejection, cancer, or other diseases in mammals.
  • HY-147976
    Glucocerebrosidase-IN-1

    		Glucosidase Metabolic Disease Neurological Disease
    Glucocerebrosidase-IN-1 (compound 11a) is a potent and selective GCase (glucocerebrosidase) inhibitor, with an IC50 of 29.3 μM and a Ki of 18.5 μM. Glucocerebrosidase-IN-1 can be used for the research of Gaucher disease (GD) and Parkinson’s disease (PD).
  • HY-W040146
    Propionylpromazine hydrochloride

    Propiopromazine hydrochloride

    		 Dopamine Receptor Neurological Disease
    Propionylpromazine hydrochloride (Propiopromazine hydrochloride), a dopamine receptor D2 (DRD2) antagonist, can be used in the research of Parkinson disease.
  • HY-148108
    AChE-IN-27

    		Cholinesterase (ChE) Neurological Disease
    AChE-IN-27 (compound 8c) is an AChE inhibitor (IC50=0.19 µM). AChE-IN-27 can be used in studies of neurological diseases such as alzheimer's disease, dementia, ataxia and myasthenia gravis.
  • HY-122908
    Atuliflapon

    AZD5718

    		 FLAP Cardiovascular Disease
    Atuliflapon (AZD5718) is an orally active inhibitor of FLAP (5‑Lipoxygenase activating protein), with an IC50 of 2 nM. Atuliflapon is used in the study for coronary artery disease.
  • HY-N7745
    Glucosylsphingosine

    Glucopsychosine; Lyso-Gb1

    		 Others Metabolic Disease
    Glucosylsphingosine (lyso-Gb1) is a deacylated form of glucosylceramide and is also degraded by the glucocerebrosidase. Glucosylsphingosine is a very promising, reliable and specific biomarker for monitoring Gaucher disease.
  • HY-152111
    AChE/MAO-B-IN-3

    		Cholinesterase (ChE) Monoamine Oxidase Amyloid-β Neurological Disease
    AChE/MAO-B-IN-3 (Compound D30) is a dual AChE and MAO-B inhibitor with IC50s of 0.0257 μM and 0.0456 μM against human AChE and MAO-B, respectively. AChE/MAO-B-IN-3 can be used for the research of Alzheimer’s disease.
  • HY-145317
    LRRK2-IN-2

    		LRRK2 Neurological Disease
    LRRK2-IN-2 (compoubd 22) is a potent, selective, orally active and brain-penetrant inhibitor LRRK2, with IC50 of <0.6 nM. LRRK2-IN-2 can be used for the research of Parkinson's disease.
  • HY-146068
    AEP-IN-1

    		Others Neurological Disease
    AEP-IN-1 (Compound 13e) is a CNS agent-like non-covalent inhibitor of asparagine endopeptidase (AEP), with the IC50 of 89 nM. AEP-IN-1 can be used for the research of numerous neurological diseases such as Alzheimer’s disease (AD).
  • HY-101321
    Immepip

    		Histamine Receptor Neurological Disease
    Immepip is a H3 agonist. Immepip can reduce cortical histamine release. Immepip can be used for the research of neurological diseases.
  • HY-146456
    A1AR antagonist 3

    		Adenosine Receptor Neurological Disease
    A1AR antagonist 3 (compound 13) is a selective adenosine 1 (A1) receptor antagonist with Kis of 9.69 nM and 0.529 nM for human A1 and rat A1, respectively. A1AR antagonist 3 can be used for researching neurological diseases.
  • HY-105170B
    ABT-418 hydrochloride

    		nAChR Neurological Disease
    ABT-418 hydrochloride is a potent and selective agonist of nAChRs with cognitive enhancing and anxiolytic activities. ABT-418 hydrochloride activates cholinergic channel and can be used for research of Alzheimer's disease.
  • HY-13410
    Xanomeline oxalate

    LY246708 oxalate

    		 mAChR Neurological Disease
    Xanomeline oxalate (LY246708 oxalate) is a potent and selective muscarinic receptor agonist (SMRA) and stimulates phosphoinositide hydrolysis in vivo. Xanomeline oxalate can be used for the research of Alzheimer’s disease.
  • HY-145318
    LRRK2-IN-3

    		LRRK2 Neurological Disease
    LRRK2-IN-3 (compoubd 24) is a potent, selective, orally active and brain-penetrant inhibitor LRRK2, with IC50 of 2.6 nM in human PBMCs. LRRK2-IN-3 can be used for the research of Parkinson's disease.
  • HY-P99216
    Ponezumab

    PF-04360365; RN 1219

    		 EGFR Neurological Disease
    Ponezumab (PF-04360365) is a humanised anti-amyloid IgG2 monoclonal antibody. Ponezumab reduces Aβ levels in the central nervous system and improves performance in mice in various models of learning and memory. Ponezumab can be used in study of Alzheimer's disease.
  • HY-107660
    SIRT2-IN-8

    		Sirtuin Neurological Disease
    SIRT2-IN-8 is a potent SIRT2 inhibitor. SIRT2-IN-8 can be used for Huntington’s and Parkinson’s diseases research.
  • HY-151536
    meso-Benzothiazole-BODIPY 505/515

    		Fluorescent Dye Neurological Disease
    meso-Benzothiazole-BODIPY 505/515 is a boron dipyrromethenes (BODIPY) -based fluorescent probediseases, lysosomal storage diseases and neural degeneration diseases.
  • HY-P3909
    Biotinyl-Ahx-Amyloid β-Protein (1-42) (ammonium)

    		Amyloid-β Neurological Disease
    Biotinyl-Ahx-Amyloid β-Protein (1-42) ammonium is a N-terminally biotin-labeled Amyloid β-Protein (1-42). Amyloid β-protein is the primary component of both vascular and parenchymal amyloid deposits in Alzheimer's disease.
  • HY-W015514
    N-(3-Aminopropyl)cyclohexylamine

    		Others Neurological Disease
    N-(3-Aminopropyl)cyclohexylamine, a cyclohexylamine derivative, acts as a selective and competitive inhibitor of spermine synthase. N-(3-Aminopropyl)cyclohexylamine can be used for the research of neurological diseases.
  • HY-B1363
    Bendroflumethiazide

    Bendrofluazide

    		 Others Cardiovascular Disease
    Bendroflumethiazide is an orally active diuretic. Bendroflumethiazide is an antihypertensive agent. Bendroflumethiazide has the potential for the research of arterial hypertensive disease.
  • HY-101321A
    Immepip dihydrobromide

    		Itk Neurological Disease
    Immepip dihydrobromide is a H3 agonist. Immepip dihydrobromide can reduce cortical histamine release. Immepip dihydrobromide can be used for the research of neurological diseases.
  • HY-P1060
    LPYFD-NH2

    		Amyloid-β Neurological Disease
    LPYFD-NH2, a pentapeptide, exerts some inhibitory effect on the aggregation of Aβ(1-42). LPYFD-NH2 can be used for the research of Alzheimer’s disease.
  • HY-W062697
    HTL14242

    HTL0014242

    		 mGluR Neurological Disease
    HTL14242 (HTL0014242) is an advanced and orally active mGlu5 NAM with a pKi and a pIC50 of 9.3 and 9.2, respectively. HTL14242 can be used for the research of parkinson’s disease.
  • HY-144762
    K027

    		Cholinesterase (ChE) Neurological Disease
    K027 is a potent reactivator of Organophosphates (OP)-inhibited acetylcholinesterase (AChE). K027 can be used for the research of Alzheimer's disease.
  • HY-105445
    CP-113818

    		Acyltransferase Neurological Disease
    CP-113818 is a potent cholesterol acyltransferase (ACAT) inhibitor. CP-113818 can be used for the research of Alzheimer's disease.
  • HY-128057
    NCRW0005-F05

    		GPR139 Metabolic Disease Neurological Disease
    NCRW0005-F05 is a potent GPR139 antagonist with an IC50 value of 0.21 μM. NCRW0005-F05 can be used to research diabetes, obesity and Parkinson's disease.
  • HY-P1060A
    LPYFD-NH2 TFA

    		Amyloid-β Neurological Disease
    LPYFD-NH2 TFA, a pentapeptide, exerts some inhibitory effect on the aggregation of Aβ(1-42). LPYFD-NH2 TFA can be used for the research of Alzheimer’s disease.
  • HY-145905
    D4R antagonist-1

    		Dopamine Receptor Neurological Disease
    D4R antagonist-1 is a potent and selective D4R antagonist with an IC50 of 6.87 µM. D4R antagonist-1 has the potential for the research of Parkinson’s disease.
  • HY-132821B
    (R)-Irsenontrine

    (R)-E2027

    		 Phosphodiesterase (PDE) Neurological Disease
    (R)-Irsenontrine ((R)-E2027), the R-enantiomer of Irsenontrine (HY-132821), is a potent phosphodiesterase 9 (PDE9) inhibitor with an IC50 value of 0.041 μM. (R)-Irsenontrine can be used for the research of neurological diseases.
  • HY-144681
    LY3372689

    		Tau Protein Neurological Disease
    LY3372689 (Formulaic Ia) is an orally active O-GlcNAcase (OGA) enzyme inhibitor. LY3372689 can be used for tauopathies research, including Alzheimer’s disease.
  • HY-14936
    Sofigatran

    MCC-977

    		 Thrombin Cardiovascular Disease
    Sofigatran (MCC-977) is an orally active factor IIa (thrombin) inhibitor, acts as an anticoagulant. Sofigatran is used for the research of cardiovascular disease.
  • HY-B0590
    Tetrabenazine

    Ro 1-9569

    		 Monoamine Transporter Neurological Disease
    Tetrabenazine (Ro 1-9569) is a reversible inhibitor of the vesicular monoamine transporter VMAT2 with the Kd value of 1.34 nM. Tetrabenazine can be used for research on diseases related to hyperactive movement disorders such as Huntington's disease.
  • HY-B0590E
    Tetrabenazine mesylate

    Ro 1-9569 mesylate

    		 Monoamine Transporter Neurological Disease
    Tetrabenazine (Ro 1-9569) mesylate is a reversible inhibitor of the vesicular monoamine transporter VMAT2 with the Kd value of 1.34 nM. Tetrabenazine mesylate can be used for research on diseases related to hyperactive movement disorders such as Huntington's disease.
  • HY-14838
    Etamicastat

    BIA 5-453

    		 Dopamine β-hydroxylase Cardiovascular Disease
    Etamicastat (BIA 5-453) is a potent and reversible dopamine-β-hydroxylase (DBH) inhibitor with an IC50 value of 107 nM. Etamicastat can be used in the research of cardiovascular diseases.
  • HY-N2195
    Nootkatone

    (+)-Nootkatone

    		 Others Neurological Disease
    Nootkatone, a neuroprotective agent from Vitis vinifera, has antioxidant and anti-inflammatory effects. Nootkatone improves cognitive impairment in lipopolysaccharide-induced mouse model of Alzheimer's disease.
  • HY-14838A
    Etamicastat hydrochloride

    BIA 5-453 hydrochloride

    		 Dopamine β-hydroxylase Cardiovascular Disease
    Etamicastat hydrochloride (BIA 5-453 hydrochloride) is a potent and reversible dopamine-β-hydroxylase (DBH) inhibitor with an IC50 value of 107 nM. Etamicastat can be used in the research of cardiovascular diseases.
  • HY-137447A
    Pirepemat fumarate

    IRL752 fumarate

    		 Others Neurological Disease
    Pirepemat (IRL752) fumarate is a corticalpreferring catecholamine- and cognition-promoting agent. Pirepemat fumarate is used for the study of Parkinson's disease.
  • HY-148382
    RI-962

    		RIP kinase Necroptosis Inflammation/Immunology Neurological Disease
    RI-962 is a potent and selective receptor-interacting protein kinase 1 (RIPK1) inhibitor. RI-962 inhibits RIPK1 with an IC50 value of 35.0 nM. RI-962 can be used for the research of nervous system diseases and inflammatory diseases.
  • HY-112071
    Prenalterol

    		Adrenergic Receptor Cardiovascular Disease
    Prenalterol is a selective β1-adrenergic receptor agonist. Prenalterol has no effect on gut smooth muscle contractile activity. Prenalterol can be used for researching cardiovascular disease.
  • HY-146478
    A1/A3 AR antagonist 1

    		Adenosine Receptor Inflammation/Immunology Neurological Disease
    A1/A3 AR antagonist 1 (compound 10) is a potent adenosine 1 (A1) and adenosine 3 (A3) receptor dual antagonist with Kis of 36.7 nM, 25.4 nM and 1.47 nM for human A1, human A3 and rat A1, respectively. A1/A3 AR antagonist 1 can be used for researching kidney failure, inflammatory pulmonary diseases, and Alzheimer’s disease.
  • HY-148187
    NLRP3-IN-11

    		NOD-like Receptor (NLR) Infection Inflammation/Immunology Neurological Disease Cardiovascular Disease
    NLRP3-IN-11 is a NLR family pyrin domain containing 3 (NLRP3) proteins inhibitor. NLRP3-IN-11 has biological activity for NLRP3 with an IC50 value of <0.3 μM. NLRP3-IN-11 can be used for the researh of inflammatory and degenerative diseases including NASH, atherosclerosis and other cardiovascular diseases, Alzheimer's disease, Parkinson's disease, diabetes, gout, and numerous other autoinflammatory diseases.
  • HY-W027553
    Ipidacrine

    		Cholinesterase (ChE) Neurological Disease
    2,3,5,6,7,8-Hexahydro-1H-cyclopenta[b]quinolin-9-amine is a pharmaceutically active compound which is a nootropic agent that acts as cholinesterase inhibitor and is used in research of Alzheimer disease.
  • HY-P99163
    Tilavonemab

    ABBV-8E12; C2N-8E12

    		 Microtubule/Tubulin Neurological Disease
    Tilavonemab (ABBV-8E12) is a humanised anti-tau antibody that binds amino acids 25-30 near the N-terminal end of the tau protein. Tilavonemab blocks the ability of human and mouse neurons to take up tau aggregates and reduces brain atrophy. Tilavonemab can be used in the study of Alzheimer's disease.
  • HY-148650
    Sortilin antagonist 1

    		Neurotensin Receptor Neurological Disease
    Sortilin antagonist 1 (compound 44) is a sortilin antagonist with an IC50 value of 20 nM for inhibiting Neurotensin (NTS) binds to sortilin. Neurotensin is a sortilin ligand. Sortilin antagonist 1 can be used for the research of neurological disease.
  • HY-119943
    PF-06256142

    		Dopamine Receptor Neurological Disease
    PF-06256142 is a potent, selective, CNS-penetrant and orally active agonist of the D1 receptor, with an EC50 and Ki of 33 nM and 12 nM, respectively. PF-06256142 has the potential for the research of schizophrenia and Parkinson's disease.
  • HY-137447
    Pirepemat

    IRL752

    		 Others Neurological Disease
    Pirepemat (IRL752) is a corticalpreferring catecholamine- and cognition-promoting agent. Pirepemat (IRL752) is used for the study of Parkinson's disease.
  • HY-151522
    SIRT2-IN-10

    		Sirtuin Cancer Neurological Disease
    SIRT2-IN-10 (Compound 12) is a potent SIRT2 inhibitor with an IC50 of 1.3 μM. SIRT2-IN-10 can be used for the research of cancer and neurodegenerative disease.
  • HY-17387
    (-)-Huperzine A

    Huperzine A

    		 Cholinesterase (ChE) Apoptosis iGluR Neurological Disease
    (-)-Huperzine A (Huperzine A) is an alkaloid isolated from Huperzia serrata, with neuroprotective activity. (-)-Huperzine A is a potent, highly specific, reversible and blood-brain barrier penetrant inhibitor of acetylcholinesterase (AChE), with an IC50 of 82 nM. (-)-Huperzine A also is non-competitive antagonist of N-methyl-D-aspartate glutamate (NMDA) receptor. (-)-Huperzine A is developed for the research of neurodegenerative diseases, including Alzheimer’s disease.
  • HY-136311
    NCT-504

    		Others Neurological Disease
    NCT-504 is a selective allosteric inhibitor of PIP4Kγ, with an IC50 of 15.8 μM. NCT-504 is potential for the research of Huntington's disease.
  • HY-113303
    FAPy-adenine

    		Endogenous Metabolite Cancer Neurological Disease
    FAPy-adenine is an oxidized DNA base. Fapy-adenine shows an increased trend levels in the Alzheimer's disease brain. Oxidized nucleosides are biochemical markers for tumors, aging, and neurodegenerative diseases.
  • HY-144753
    AChE/BChE-IN-2

    		Cholinesterase (ChE) Neurological Disease
    AChE/BChE-IN-2 (Compound 13b) is a potent inhibitor of AChE/BChE (AChE IC50 = 0.96 ± 0.14 µM, BChE IC50 = 1.23 ± 0.23 µM). AChE/BChE-IN-2 has the potential for the research of AD diseases.
  • HY-153279
    5-Lipoxygenase-IN-3

    		Lipoxygenase Cancer Inflammation/Immunology Neurological Disease
    5-Lipoxygenase-IN-3 (Compound 14) is a 5-Lipoxygenase inhibitor (IC50: <1 μM). 5-Lipoxygenase-IN-3 can be used for research of inflammatory diseases, cancer, stroke and Alzheimer's disease.
  • HY-17020A
    Miglustat hydrochloride

    N-Butyldeoxynojirimycin hydrochloride; NB-DNJ hydrochloride; OGT 918 hydrochloride

    		 Glucosylceramide Synthase (GCS) Neurological Disease
    Miglustat (N-Butyldeoxynojirimycin) hydrochloride is an orally active ceramide glucosyltransferase inhibitor. Miglustat hydrochloride can be used for the research of type I gaucher disease.
  • HY-17020
    Miglustat

    N-Butyldeoxynojirimycin; NB-DNJ; OGT 918

    		 Glucosylceramide Synthase (GCS) Neurological Disease
    Miglustat (N-Butyldeoxynojirimycin) is an orally active ceramide glucosyltransferase inhibitor. Miglustat can be used for the research of type I gaucher disease.
  • HY-147846
    AChE/PDE4-IN-1

    		Cholinesterase (ChE) Phosphodiesterase (PDE) Neurological Disease
    AChE/PDE4-IN-1 (compound 12c) is a potent and selective dual PDE4/AChE inhibitor, with IC50s of 0.28 μM and 1.88 μM for AChE and PDE4D, respectively. AChE/PDE4-IN-1 exhibits anti-neuroinflammatory effect for the research of Alzheimer's disease.
  • HY-151370
    AChE-IN-26

    		Cholinesterase (ChE) Neurological Disease
    AChE-IN-26 (compound 4a) is an AChE (acetylcholinesterase) inhibitor with an IC50 value of 0.42 μM. AChE-IN-26 can be used for the research of Alzheimer’s disease.
  • HY-107922
    Ethopropazine hydrochloride

    Isothazine hydrochloride; Lysivane hydrochloride; Parsidol hydrochloride

    		 Cholinesterase (ChE) Neurological Disease
    Ethopropazine (Isothazine) hydrochloride is a potent, selective BChE inhibitor and a poor AChE inhibitor. Ethopropazine hydrochloride is a phenothiazine compound with anticholinergic properties. Ethopropazine hydrochloride can be used for the research of Parkinson’s disease.
  • HY-N8728
    Aposcopolamine

    		Cholinesterase (ChE) Adrenergic Receptor Neurological Disease
    Aposcopolamine is an alkaloid that can be isolated from Datura ferox. Aposcopolamin can closely binds with ACHE, ADRA2A and CHRM2. Aposcopolamine can be used for the research of Alzheimer's disease.
  • HY-112266
    MARK-IN-4

    		AMPK Neurological Disease
    MARK-IN-4 is a potent microtubule affinity regulating kinase (MARK) inhibitor with an IC50 of 1 nM. Inhibition of microtubule affinity regulating kinase (MARK) represents a potentially attractive means of arresting neurofibrillary tangle pathology in Alzheimer's disease.
  • HY-B1084
    Cinoctramide

    		Others Others
    Cinoctramide is an intermediate of pharmaceutical synthesis. Cinoctramide can be used for the research of autoimmune diseases.
  • HY-151616
    sEH inhibitor-10

    		Epoxide Hydrolase Metabolic Disease Inflammation/Immunology Cardiovascular Disease
    sEH inhibitor-10 (Compound 37) is a selective soluble epoxide hydrolase (sEH) inhibitor (IC50=0.5 μM). sEH inhibitor-10 maintains high cycloeicosatrienoic acid (EETs) levels by inhibiting sEH, thereby reducing inflammation, regulating endothelial tone, improving mitochondrial function, and reducing oxidative stress. sEH inhibitor-10 has good research potential in metabolic, renal and cardiovascular diseases.
  • HY-153092
    BI-685509

    		Others Metabolic Disease Cardiovascular Disease
    BI-685509 is a potent and orally active sGC activator. BI-685509 restores cyclic guanosine monophosphate (cGMP) and improves functionality of nitric oxide (NO) pathways. BI-685509 can be used in research of chronic kidney disease (CKD) and diabetic kidney disease (DKD).
  • HY-120419
    PF9601N

    		Monoamine Oxidase Neurological Disease
    PF9601N, an monoamine oxidase B (MAO-B) inhibitor, possesses neuroprotective properties in several in vitro and in vivo models of Parkinson's disease (PD). PF9601N can be used for the research of neurodegenerative diseases mediated by excitotoxicity.
  • HY-11070
    MK-0952

    		Phosphodiesterase (PDE) Neurological Disease
    MK-0952 is a selective and orally active PDE4 inhibitor, with an IC50 of 0.53 nM. MK-0952 has the potential for Alzheimer’s disease study.
  • HY-106432A
    Sabcomeline hydrochloride

    SB-202026 hydrochloride; Memric hydrochloride

    		 mAChR Neurological Disease
    Sabcomeline (SB-202026) hydrochloride is a potent and functionally selective muscarinic M1 receptor partial agonist that improve cognition. Sabcomeline hydrochloride can be used for Alzheimer's disease research.
  • HY-106432
    Sabcomeline

    SB-202026; Memric

    		 mAChR Neurological Disease
    Sabcomeline (SB-202026) is a potent and functionally selective muscarinic M1 receptor partial agonist that improve cognition. Sabcomeline can be used for Alzheimer's disease research.
  • HY-B0203A
    Nebivolol hydrochloride

    R 065824 hydrochloride

    		 Adrenergic Receptor Cardiovascular Disease Endocrinology
    Nebivolol (R 065824) hydrochloride is an orally active beta receptor blocker and has the high beta(1)-receptor affinity.Nebivolol hydrochloride has direct vasodilator properties and adrenergic blocking characteristics. Nebivolol hydrochloride can be used for the research of kinds of diseases such as hypertension, coronary artery disease, congestive heart failure and ischemic heart disease.
  • HY-B0203
    Nebivolol

    R 065824

    		 Adrenergic Receptor Cardiovascular Disease Endocrinology
    Nebivolol (R 065824) is an orally active beta receptor blocker and has the high beta(1)-receptor affinity. Nebivolol has direct vasodilator properties and adrenergic blocking characteristics. Nebivolol can be used for the research of kinds of diseases such as hypertension, coronary artery disease, congestive heart failure and ischemic heart disease.
  • HY-105647
    Ambuphylline

    Bufylline

    		 Phosphodiesterase (PDE) Cardiovascular Disease
    Ambuphylline (Bufylline) is a bronchodilator. Ambuphylline is a theophylline derivative possibly acting through phosphodiesterase inhibition. Ambuphylline can be used for the research of asthma and other lung diseases.
  • HY-143329
    MAO-B-IN-3

    		Monoamine Oxidase 5-HT Receptor Neurological Disease
    MAO-B-IN-3 is a reversible and selective MAO-B inhibitor (IC50=96 nM). MAO-B-IN-3 also binds to 5-HT6R with Ki value of 696 nM. MAO-B-IN-3 can be used for research of in Alzheimer's disease.
  • HY-142698
    SGC agonist 2

    		Others Cardiovascular Disease
    SGC agonist 2 is a potent agonist of soluble guanylate cyclase (SGC). Soluble guanylate cyclase is a key signal transduction enzyme in the NO-sGC-cGMP signaling pathway. SGC agonist 2 has the potential for the research of cardiovascular disease (heart failure, pulmonary hypertension, angina, myocardial infarction) and fibrotic diseases (renal fibrosis, systemic sclerosis) (extracted from patent WO2021219088A1, compound 031).
  • HY-103162
    ANR94

    		Adenosine Receptor Neurological Disease
    ANR94 is a potent and selective adenosine A2A receptor (AA2AR) antagonist with an Ki of 46 nM for hAA2AR. ANR94 has the potential for the research of Parkinson's disease.
  • HY-151338
    AChE-IN-25

    		Cholinesterase (ChE) Neurological Disease
    AChE-IN-25 is a potent, selective and uncompetitive acetylcholinesterase (AChE) inhibitor (IC50=2.95 µM). AChE-IN-25 can be used in Alzheimer's disease research.
  • HY-145888
    Antioxidant agent-2

    		Amyloid-β Neurological Disease
    Antioxidant agent-2 (comp 3c), an BBB-penetrated antioxidant agent and a selective metal ions chelator, presents good neuroprotective effect and hepatoprotective effect for the study of Alzheimer’s disease.
  • HY-147574
    Axl-IN-7

    		TAM Receptor Cancer Inflammation/Immunology Cardiovascular Disease
    Axl-IN-7 (Chemie 22) is a potent AXL inhibitor. Axl-IN-7 can be used for Axl-related diseases research, for example cancers (such as acute myeloid leukemia, melanoma, breast cancer, pancreatic cancer, and glial tumors), renal disease, immune system disorders, and cardiovascular disease.
  • HY-13720
    Pergolide

    LY127809 free base

    		 Dopamine Receptor Neurological Disease
    Pergolide (LY127809 (free base)) is an ergot-derived orally active dopamine receptor agonist. Pergolide can be used for Parkinson disease research.
  • HY-119943A
    (Rac)-PF-06256142

    		Dopamine Receptor Neurological Disease
    (Rac)-PF-06256142 is the less effective enantiomer of PF-06256142 (HY-119943). (Rac)-PF-06256142 is an agonist of D1 receptor, with an EC50 of 107 nM. (Rac)-PF-06256142 can be used for the research of schizophrenia and Parkinson's disease.
  • HY-105003
    ST 1535

    		Adenosine Receptor Neurological Disease
    ST 1535 is a potent and orally active A2A adenosine receptor antagonist. ST 1535 shows antiparkinsonian activity and antitremorigenic effects. ST 1535 has the potential for the research of Parkinson’s disease.
  • HY-148215
    Hsp90-IN-17

    		HSP Cancer
    Hsp90-IN-17 (Example 5) is an HSP90 inhibitor that can be used in the study of proliferative diseases, such as cancer and neurodegenerative diseases.
  • HY-148215A
    Hsp90-IN-17 hydrochloride

    		HSP Cancer
    Hsp90-IN-17 (Example 5) hydrochloride is an HSP90 inhibitor that can be used in the study of proliferative diseases, such as cancer and neurodegenerative diseases.
  • HY-P99452
    Axatilimab

    SNDX-6352

    		 c-Fms Cancer Inflammation/Immunology
    Axatilimab (SNDX-6352) is a humanized IgG4 antibody with high affinity to CSF-1R. Axatilimab can be used for the research of chronic graft versus host disease (cGVHD) and neoplastic diseases.
  • HY-116418
    Virodhamine

    		Endogenous Metabolite Cannabinoid Receptor Neurological Disease
    Virodhamine is an endocannabinoid, it regulates neurotransmission by activating the cannabinoid (CB) receptors. Virodhamine is an antagonist of CB1 receptor and an agonist of CB2 receptor. Virodhamine induces megakaryocytic differentiation by triggering MAPK signaling and ROS production. Virodhamine can be used for the research of various neurological disorders such as Alzheimer's and Parkinson's diseases.
  • HY-116868
    Anecortave acetate

    Anecortave

    		 PAI-1 Cardiovascular Disease
    Anecortave acetate is a potent ocular angiostatic agent. Anecortave acetate inhibits neovascularization which is induced by many different angiogenic factors, and increases plasminogen activator inhibitor-1 (PAI-1) mRNA expression. Anecortave acetate can be used to research ocular neovascular diseases.
  • HY-16748
    Nelonicline

    ABT-126

    		 nAChR Neurological Disease
    Nelonicline (ABT-126) is an orally active and selective α7 nicotinic receptor agonist with high affinity to α7 nAChRs in human brain (Ki=12.3 nM). Nelonicline is used for the research of shizophrenia and Alzheimer's disease.
  • HY-117259
    Valiltramiprosate

    ALZ-801

    		 Amyloid-β Neurological Disease
    ALZ-801 is a potent and orally available small-molecule β-amyloid (Aβ) anti-oligomer and aggregation inhibitor, valine-conjugated proagent of Tramiprosate with substantially improved PK properties and gastrointestinal tolerability compared with the parent compound. ALZ-801 is an advanced and markedly improved candidate for the treatment of alzheimer’s disease.
  • HY-P99164
    Zagotenemab

    LY33003560

    		 Microtubule/Tubulin Neurological Disease
    Zagotenemab (LY3303560) is a humanised anti-tau antibody that selectively binds and neutralises tau deposits in the brain. Zagotenemab can be used in Alzheimer's disease research.
  • HY-100642
    3-O-Methyltolcapone

    Ro 40-7591

    		 COMT Neurological Disease
    3-O-Methyltolcapone (Ro 40-7591) is a metabolite of Tolcapone. Tolcapone is an orally active, reversible, selective and potent COMT inhibitor. Tolcapone crosses the blood-brain barrier, and can be used for treatment of Parkinson's disease.
  • HY-117861
    ML198

    		Glucosidase Metabolic Disease
    ML198 is a glucocerebrosidase (GCase) modulator with an EC50 of 0.4 μM. ML198 is an activator and non-inhibitory chaperone of glucocerebrosidase. ML198 can be used for the research of Gaucher disease.
  • HY-143465
    BChE-IN-5

    		Cholinesterase (ChE) Neurological Disease
    BChE-IN-5 is a potent and selective BChE inhibitor of hBChE over hAChE with an IC50 of 2.8 nM for BChE. BChE-IN-5 has the potential for the research of alzheimer’s disease.
  • HY-N10408
    Tripchlorolide

    		Apoptosis Autophagy Cancer Neurological Disease
    Tripchlorolide is a neuroprotective agent that can be found in Tripterygium wilfordii. Tripchlorolide prevents tumor growth by inducing apoptosis and autophagy. Tripchlorolide improves cognitive deficits in Alzheimer's disease.
  • HY-16748A
    Nelonicline citrate

    ABT-126 citrate

    		 nAChR Neurological Disease
    Nelonicline (ABT-126) citrate is an orally active and selective α7 nicotinic receptor agonist with high affinity to α7 nAChRs in human brain (Ki=12.3 nM). Nelonicline citrate is used for the research of shizophrenia and Alzheimer's disease.
  • HY-146387
    SIRT5 inhibitor 3

    		Sirtuin Cancer Neurological Disease
    SIRT5 inhibitor 3 (compound 46) is a potent and competitive SIRT5 inhibitor with an IC50 value of 5.9 μM. SIRT5 inhibitor 3 can inhibit SIRT5 desuccinylation. SIRT5 inhibitor 3 can be used for researching cancer and neurodegenerative diseases.
  • HY-151810
    CYP4A11/CYP4F2-IN-2

    		Cytochrome P450 Metabolic Disease
    CYP4A11/CYP4F2-IN-2 is a potent and orally active dual inhibitor of cytochrome P450 (CYP) 4A11 and CYP4F2, with IC50s of 140 nM and 40 nM, respectively. CYP4A11/CYP4F2-IN-2 has potential for the research of renal diseases.
  • HY-151809
    CYP4A11/CYP4F2-IN-1

    		Cytochrome P450 Metabolic Disease
    CYP4A11/CYP4F2-IN-1 is a potent dual inhibitor of cytochrome P450 (CYP) 4A11 and CYP4F2, with IC50s of 19 nM and 17 nM, respectively. CYP4A11/CYP4F2-IN-1 has potential for the research of renal diseases.
  • HY-16759
    Verubecestat

    MK-8931

    		 Beta-secretase Neurological Disease
    Verubecestat (MK-8931) is an orally active, high-affinity BACE1 and BACE2 inhibitor with Ki values of 2.2 nM and 0.38 nM. Verubecestat effectively reduces Aβ40 and has the potential for Alzheimer's Disease.
  • HY-146155
    TRPC4/5-IN-1

    		TRP Channel Metabolic Disease Inflammation/Immunology
    TRPC4/5-IN-1 is a potent TRP channel 4/5 (TRPC4/5) inhibitor with IC50s of 2.06 μM and 0.54 μM, respectively. TRPC4/5-IN-1 can be used for proteinuric kidney diseases and skin inflammatory diseases research.
  • HY-107509
    LY2389575 hydrochloride

    		mGluR Neurological Disease
    LY2389575 hydrochloride is a selective and noncompetitive mGlu3 negative allosteric modulator (NAM), with an IC50 value of 190 nM. LY2389575 hydrochloride induces an increase in Mrc1 levels. LY2389575 hydrochloride also independently amplifies Amyloid beta (Aβ) toxicity and can be used in study of Alzheimer's disease.
  • HY-149242
    MAO-B-IN-20

    		Monoamine Oxidase Neurological Disease
    MAO-B-IN-20 (Compound C14) is a potent MAO-B inhibitor with an IC50 of 0.037 μM. MAO-B-IN-20 displays good metabolic stability and brain-blood barrier permeability. MAO-B-IN-20 can be used for the research of Parkinson's disease.
  • HY-W083062
    hMAO-B-IN-5

    		Monoamine Oxidase Neurological Disease
    hMAO-B-IN-5(B15) is a potent, selective and reversible inhibitor of human monoamine oxidase hMAO-B with IC50 of 0.12 μM. hMAO-B-IN-5 can pass through the blood-brain barrier and can be used in the research of neurodegenerative diseases.
  • HY-B0702
    Nicergoline

    		Adrenergic Receptor Neurological Disease Cardiovascular Disease
    Nicergoline, an ergoline derivative ester of bromonicotinic acid, is a potent, selective and orally active antagonist of α1A-adrenoceptor. Nicergoline has vasodilator effects. Nicergoline also has ameliorative effects on cognitive function in mouse models of Alzheimer's disease.
  • HY-147608
    CSF1R-IN-7

    		c-Fms Neurological Disease
    CSF1R-IN-7 (Formula I) is a CSF-1R inhibitor. CSF1R-IN-7 can be used for Alzheimer’s disease research.
  • HY-124063
    BI-1935

    		Epoxide Hydrolase Cardiovascular Disease
    BI-1935 is a potent soluble epoxide hydrolase (sEH) inhibitor. BI-1935 can be used for the research of cardiovascular disease.
  • HY-148253
    TP-030-1

    		RIP kinase Inflammation/Immunology Neurological Disease
    TP-030-1 is an inhibitor of RIPK1. TP-030-1 inhibits hRIPK1 with a Ki value of 3.9 nM and inhibits mRIPK1 with an IC50 value of 4.2 μM. TP-030-1 can be used for the research of inflammatory diseases and neurodegenerative diseases.
  • HY-U00058
    Diflucortolone valerate

    		Fungal Bacterial Infection Inflammation/Immunology
    Diflucortolone valerate is a powerful corticosteroid used topically for the research of various skin diseases.
  • HY-14679
    GSK3β inhibitor II

    		GSK-3 Neurological Disease
    GSK3β inhibitor II is an inhibitor of GSK3β. GSK3β inhibitor II can be used for research of Alzheimer’s disease (AD).
  • HY-147953
    MAO-B-IN-13

    		Monoamine Oxidase Neurological Disease
    MAO-B-IN-13 (compound 12a) is a highly potent, reversible and blood-brain barrier (BBB) penetrant MAO-B inhibitor with an IC50 value of 10 nM. MAO-B-IN-13 has neuroprotective and antioxidant activity. MAO-B-IN-13 can be used for researching Parkinson’s disease.
  • HY-146386
    SIRT5 inhibitor 2

    		Sirtuin Cancer Neurological Disease
    SIRT5 inhibitor 2 (compound 49) is a potent SIRT5 inhibitor with an IC50 value of 2.3 μM. SIRT5 inhibitor 2 has inhibitory activity against the SIRT5-dependent desuccinylation. SIRT5 inhibitor 2 can be used for researching cancer and neurodegenerative diseases.
  • HY-16482
    Teglicar

    		Endogenous Metabolite Metabolic Disease Neurological Disease
    Teglicar is a selective and reversible orally active liver isoform of carnitine palmitoyl-transferase 1 (L-CPT1) inhibitor with an IC50 value of 0.68 μM and a Ki value of 0.36 μM. Teglicar has a potential antihyperglycemic propert. Teglicar can be used for the research of diabetes and neurodegenerative disease including Huntington's disease (HD).
  • HY-P99491
    Camoteskimab

    AVTX-007; CERC-007; MEDI 2338

    		 Interleukin Related Inflammation/Immunology
    Camoteskimab (AVTX-007) is a fully human, high-affinity anti-IL-18 monoclonal antibody. Camoteskimab has the potential for the autoinflammatory diseases research, including adult-onset Still’s disease (AOSD).
  • HY-133712
    Yonkenafil

    Tunodafil

    		 Phosphodiesterase (PDE) Neurological Disease
    Yonkenafil (Tunodafil), a novel phosphodiesterase 5 (PDE5) inhibitor, is effective in reducing cerebral infarction, neurological deficits, edema, and neuronal damage in the infarcted area. Yonkenafil may improve cognitive function by modulating neurogenesis and has a potential therapeutic effect on Alzheimer's disease.
  • HY-P3859
    Cys-Gly-Lys-Arg-Amyloid β-Protein (1-42)

    		Amyloid-β Neurological Disease
    Cys-Gly-Lys-Arg-Amyloid β-Protein (1-42) is a peptide fragment of amyloid β-protein (Aβ). Cys-Gly-Lys-Arg-Amyloid β-Protein (1-42) can be used in research of Alzheimer's disease.
  • HY-P1061
    Colivelin

    		STAT Amyloid-β Neurological Disease
    Colivelin is a brain penetrant neuroprotective peptide and a potent activator of STAT3, suppresses neuronal death by activating STAT3 in vitro. Colivelin exhibits long-term beneficial effects against neurotoxicity, Aβ deposition, neuronal apoptosis, and synaptic plasticity deficits in neurodegenerative disease. Colivelin has the potential for the treatment of alzheimer's disease and ischemic brain injury
  • HY-110135
    NBI-31772

    		IGF-1R Others
    NBI-31772 is the potent and nonselective inhibitor of IGFBP with a Ki value of 47 nM. NBI-31772 has the potential for the research of IGF-responsive diseases.
  • HY-152264
    CFTR activator 1

    		CFTR Inflammation/Immunology
    CFTR activator 1 is a potent and selective CFTR activator, with an EC50 of 23 nM. CFTR activator 1 can be used to ameliorate dry eye disease.
  • HY-103253
    LY231617

    		Others Neurological Disease
    LY231617 is a potent and blood-brain barrier penetrable antioxidant. LY231617 is a neuroprotective agent in brain, it can be used for the research of nervous disease.
  • HY-144826
    ZDWX-25

    		GSK-3 Neurological Disease
    ZDWX-25 is a highly potent GSK-3β and DYRK1A dual inhibitor with an IC50 value of 71 nM for GSK-3β. ZDWX-25 possesses significant cytotoxic activities against SH-SY5Y and HL-7702 cells. ZDWX-25 can be used for researching alzheimer's disease.
  • HY-N2043
    Huperzine B

    		Cholinesterase (ChE) Neurological Disease
    Huperzine B is a Lycopodium alkaloid isolated from Huperzia serrata and a highly selective acetylcholinesterase (AChE) inhibitor. Huperzine B can be uesd to can be used to improve Alzheimer's disease.
  • HY-132582
    IONIS-MAPTRx

    BIIB080; ISIS 814907

    		 Tau Protein Neurological Disease
    IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease. ( MCE IONIS-MAPTRx for murine use: Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
  • HY-B0757A
    (±)-α-Tocopherol nicotinate

    Vitamin E Nicotinate

    		 Reactive Oxygen Species Endogenous Metabolite Cardiovascular Disease
    (±)-α-Tocopherol nicotinate, vitamin E - nicotinate, is an orally active fat-soluble antioxidant that prevents lipid peroxidation in cell membranes. (±)-α-Tocopherol nicotinate is hydrolysed in the blood to α -tocopherol and niacin and may be used in studies of related vascular diseases.
  • HY-106392
    Lucerastat

    NB-DGJ; N-(n-Butyl)deoxygalactonojirimycin

    		 Glucosylceramide Synthase (GCS) Metabolic Disease
    Lucerastat, the galactose form of Miglustat, is an orally-available inhibitor of glucosylceramide synthase (GCS). Lucerastat has the potential for Fabry disease study.
  • HY-107580
    GPR109 receptor agonist-1

    		GPR109A Cardiovascular Disease Metabolic Disease
    GPR109 receptor agonist-1 (Compound 3a) is a highly selective agonist of the human orphan G-protein-coupled receptor GPR109b, with the pEC50 of 6.4. GPR109 receptor agonist-1 can be used for the research of cardio-metabolic diseases.
  • HY-N10151
    Notoginsenoside R3

    		Others Cardiovascular Disease
    Notoginsenoside R3 is an active principle components of P. notoginseng. Notoginsenoside R3 act as a signaling molecule that is associated with various physiological effects. P. notoginseng and its components are used as traditional Chinese medicine for cardiovascular disease.
  • HY-130750
    Phycocyanobilin

    		Reactive Oxygen Species Neurological Disease
    Phycocyanobilin, an orally active antioxidative agent, is an effective scavenger for various reactive oxygen species. Phycocyanobilin can be used for the research of Alzheimer’s disease.
  • HY-P1061A
    Colivelin TFA

    		STAT Amyloid-β Apoptosis Neurological Disease
    Colivelin TFA is a brain penetrant neuroprotective peptide and a potent activator of STAT3, suppresses neuronal death by activating STAT3 in vitro. Colivelin TFA exhibits long-term beneficial effects against neurotoxicity, Aβ deposition, neuronal apoptosis, and synaptic plasticity deficits in neurodegenerative disease. Colivelin TFA has the potential for the treatment of alzheimer's disease and ischemic brain injury.
  • HY-109150
    Mesdopetam

    IRL790

    		 Dopamine Receptor Neurological Disease
    Mesdopetam (IRL790) is a dopamine D3 receptor antagonist (Ki=90 nM; IC50=9.8 μM for human recombinant D3 receptor) with psychomotor stabilizing properties. Mesdopetam is used for the research of motor and psychiatric complications in Parkinson disease.
  • HY-P9930
    Evolocumab

    AMG 145

    		 Ser/Thr Protease Metabolic Disease Cancer
    Evolocumab (AMG 145) is a human monoclonal antibody that inhibits PCSK9. Evolocumab binds to the circulating PCSK9 protein, inhibiting it from binding to the LDLR. Evolocumab can be used for the research of hypercholesterolemia and atherosclerotic cardiovascular diseases.
  • HY-101376
    (+)-N-Allylnormetazocine hydrochloride

    (+)-SKF 10047 hydrochloride; (+)-N-Allyl-N-normetazocine hydrochloride

    		 Opioid Receptor Neurological Disease
    (+)-N-Allylnormetazocine ((+)-SKF 10047) hydrochloride is a benzomorphan opioid with psychotomi metic effects. (+)-N-Allylnormetazocine hydrochloride is an opioid receptor antagonist with Ki values of 300 nM and 27 μM for σ1 and σ2 opioid receptors, respectively. (+)-N-Allylnormetazocine hydrochloride can be used for the research of neurological disease.
  • HY-144108
    HCV-IN-35

    		HCV Infection
    HCV-IN-35 (Compound (R)-3h) is a potent inhibitor of HCV. HCV-IN-35 has the potential for the research infection diseases.
  • HY-143721
    SSAO inhibitor-2

    		Monoamine Oxidase Metabolic Disease Cardiovascular Disease Inflammation/Immunology
    SSAO inhibitor-2 (Compound 1) is a semicarbazide-sensitive amine oxidase (SSAO) inhibitor with IC50s of <10 nM, and 10-100 μM for human SSAO and MAO-A, respectively. SSAO inhibitor-3 can be used for the research of atherosclerosis, diabetes and its complications, obesity, stroke, chronic kidney disease, retinopathy, chronic obstructive pulmonary disease (COPD), autoimmune diseases, multiple sclerosis, etc.
  • HY-146528
    c-ABL-IN-3

    		Others Cancer Neurological Disease
    c-ABL-IN-3 is a potent inhibitor of c-Abl. Activation of c-Abl has been implicated in various diseases, notably cancer. c-ABL-IN-3 has the potential for the research of neurodegenerative diseases (amyotrophic lateral sclerosis (ALS) and Parkinson’s disease (PD) and cancer (extracted from patent WO2021048567A1, compound 50).
  • HY-146527
    c-ABL-IN-2

    		Bcr-Abl Cancer Neurological Disease
    c-ABL-IN-2 is a potent inhibitor of c-Abl. Activation of c-Abl has been implicated in various diseases, notably cancer. c-ABL-IN-2 has the potential for the research of neurodegenerative diseases (amyotrophic lateral sclerosis (ALS) and Parkinson’s disease (PD) and cancer (extracted from patent WO2020260871A1, compound 25).
  • HY-146530
    c-ABL-IN-4

    		Others Cancer Neurological Disease
    c-ABL-IN-4 is a potent inhibitor of c-Abl. Activation of c-Abl has been implicated in various diseases, notably cancer. c-ABL-IN-4 has the potential for the research of neurodegenerative diseases (amyotrophic lateral sclerosis (ALS) and Parkinson’s disease (PD) and cancer (extracted from patent WO2021048567A1, compound 54).
  • HY-101918
    DS-1040 Tosylate

    		Others Cardiovascular Disease
    DS-1040 Tosylate is an orally active, selective inhibitor of activated thrombin-activatable fibrinolysis inhibitor (TAFIa) with IC50s of 5.92 nM and 8.01 nM for human and rat TAFIa. DS-1040 Tosylate is a fibrinolysis enhancer for thromboembolic diseases.
  • HY-N6959
    Osmundacetone

    		Reactive Oxygen Species Apoptosis Metabolic Disease
    Osmundacetone is a natural product isolated from Osmundae Rhizoma, with neuroprotective and anti-apoptotic effects. Osmundacetone has DPPH scavenging activity and protects neurological cell from oxidative stress. Osmundacetone can be a potential agent for the research of neurodegenerative diseases.
  • HY-109150A
    Mesdopetam hemitartrate

    IRL790 hemitartrate

    		 Dopamine Receptor Neurological Disease
    Mesdopetam (IRL790) hemitartrate is a dopamine D3 receptor antagonist (Ki=90 nM; IC50=9.8 μM for human recombinant D3 receptor) with psychomotor stabilizing properties. Mesdopetam hemitartrate is used for the research of motor and psychiatric complications in Parkinson disease.
  • HY-10979
    AN0128

    		Bacterial Infection Inflammation/Immunology
    AN0128 is a boron-containing antibacterial and anti-inflammatory agent. AN0128 against S. aureus, S. epidermidis, P. acnes, B. subtilis with minimum inhibitory concentration (MIC) values of 1, 0.5, 0.3, 1 μg/mL. AN0128 can be used for the research of periodontal disease and cutaneous diseases.
  • HY-106616
    Muzolimine

    BAY-g 2821; Edrul

    		 Others Cardiovascular Disease
    Muzolimine (BAY-g 282) is a slow and long lasting diuresis agent. Muzolimine produces a diuresis in the loop of Henle and also shows anti-hypertensive effects. Muzolimine can be used for the research of cardiovascular disease.
  • HY-W015546
    β-N-methylamino-L-alanine hydrochloride

    BMAA hydrochloride; β-N-methylamino-L-alanine hydrochloride

    		 Others Neurological Disease
    β-N-methylamino-L-alanine hydrochloride (BMAA hydrochloride) is a neurotoxin produced by cyanobacteria. β-N-methylamino-L-alanine hydrochloride could cause amyotrophic lateral sclerosis (ALS) and possibly other neurodegenerative diseases.
  • HY-N8260
    Angeloylgomisin Q

    		Others Neurological Disease
    Angeloylgomisin Q is a new dibenzocyclooctadiene lignan from the stems of Schisandra sphaerandra. Angeloylgomisin Q has the potential for alzheimer's disease research.
  • HY-44154
    PSB-CB5

    		Others Metabolic Disease
    PSB-CB5 is a potent and selective antagonist of GRP18. PSB-CB5 has the potential for the research of metabolic disease and obesity.
  • HY-P3858
    (D-Asp1)-Amyloid β-Protein (1-42)

    		Amyloid-β Neurological Disease
    (D-Asp1)-Amyloid β-Protein (1-42) is a peptide fragment of amyloid β-protein (Aβ). Amyloid β-protein is the primary component of both vascular and parenchymal amyloid deposits in Alzheimer's disease.
  • HY-B1371
    Spiperone

    Spiroperidol

    		 Dopamine Receptor 5-HT Receptor Neurological Disease
    Spiperone is a potent dopamine D2, serotonin 5-HT1A, and serotonin 5-HT2A antagonist. Spiperone is a widely used pharmacological tool. Spiperone has the potential for the research of neurology diseases.
  • HY-136866
    Aβ42-IN-2

    		γ-secretase Neurological Disease
    Aβ42-IN-2 is a γ-secretase modulator extracted from patent WO2016070107, compound example 36. Aβ42-IN-2 has an IC50 of 6.5 nM for Αβ42. Aβ42-IN-2 can be used for the research of Alzheimer's disease.
  • HY-143723
    SSAO inhibitor-3

    		Monoamine Oxidase Metabolic Disease Cardiovascular Disease Inflammation/Immunology
    SSAO inhibitor-3 (Compound 2) is a semicarbazide-sensitive amine oxidase (SSAO) inhibitor with IC50s of <10 nM, and 0.1-10 μM for human SSAO and AOC1, respectively. SSAO inhibitor-3 can be used for the research of atherosclerosis, diabetes and its complications, obesity, stroke, chronic kidney disease, retinopathy, chronic obstructive pulmonary disease (COPD), autoimmune diseases, multiple sclerosis, etc.
  • HY-151208
    MAO-B-IN-16

    		Monoamine Oxidase Neurological Disease
    MAO-B-IN-16 is a selective monoamine oxidase B (MAO-B) inhibitor, with an IC50 of 1.55 µM. MAO-B-IN-16 can be used in the study of central nervous disorders, such as parkinson's disease.
  • HY-14431
    Cerlapirdine

    SAM-531; PF-05212365

    		 5-HT Receptor Neurological Disease
    Cerlapirdine (SAM-531, PF-05212365) is a selective and potent full antagonist of the 5-hydroxytryptamine 6 (5-HT6) receptor. Cerlapirdine has the potential for researching the Alzheimer's disease.
  • HY-105327
    P11149

    		Cholinesterase (ChE) Neurological Disease
    P11149 is a competitive, BBB-penetarated weakly, orally active and selective inhibitor of AChE. P11149 exhibits an IC50 of 1.3 μM for rat BChE/AChE. P11149, a Galanthamine derivative, demonstrates central cholinergic activity, behavioral efficacy and safety. P11149 is used in the study for Alzheimer's disease.
  • HY-109055
    Elenbecestat

    E2609

    		 Beta-secretase Neurological Disease
    Elenbecestat (E2609) is a potent, orally bioavailable and CNS-penetrant BACE-1 inhibitor. Elenbecestat has the potential for Alzheimer's disease (AD) research.
  • HY-P3846
    (Glu20)-Amyloid β-Protein (1-42)

    		Amyloid-β Neurological Disease
    (Glu20)-Amyloid β-Protein (1-42) is a slower fibrillizing variant of amyloid β-protein (Aβ). The Glu20 mutation reduces the aggregation propensity of Aβ42 and prevents accumulation of the slowly fibrillizing peptide. Amyloid β-protein is the primary component of both vascular and parenchymal amyloid deposits in Alzheimer's disease.
  • HY-115494
    Neladenoson dalanate hydrochloride

    Neladenoson bialanate hydrochloride; BAY-1067197 hydrochloride

    		 Adenosine Receptor Cardiovascular Disease
    Neladenoson dalanate (Neladenoson bialanate; BAY-1067197) hydrochloride is a orally active agonist precursor of partial Adenosine A1 Receptor. Neladenoson dalanate hydrochloride has a good pharmacokinetic and safety profile, can be used for the chronic heart diseases.
  • HY-123353
    Neladenoson dalanate

    Neladenoson bialanate; BAY-1067197

    		 Adenosine Receptor Cardiovascular Disease
    Neladenoson dalanate (Neladenoson bialanate; BAY-1067197) is a orally active agonist precursor of partial Adenosine A1 Receptor. Neladenoson dalanate has a good pharmacokinetic and safety profile, can be used for the chronic heart diseases.
  • HY-P99399
    Semorinemab

    RG 6100; RO7105705; MTAU-9937A

    		 Tau Protein Neurological Disease
    Semorinemab (RG 6100) is an anti-Tau humanized IgG4 monoclonal antibody, targets the N-terminal portion of the Tau protein (amino acid residues 6-23). Semorinemab binds with human Tau with a Kd value of 3.8 nM. Semorinemab can be used for the research of Alzheimer's Disease.
  • HY-P1387
    β-Amyloid (1-40) (rat)

    		Amyloid-β Apoptosis Neurological Disease
    β-Amyloid (1-40) (rat) is a rat form of the amyloid β-peptide, which accumulates as an insoluble extracellular deposit around neurons, giving rise to the senile plaques associated with Alzheimer's disease (AD). β-Amyloid (1-40) (rat) increases 45Ca 2+ influx, induces neurodegeneration in the rat hippocampal neurons of the CA1 subfield. β-Amyloid (1-40) (rat) induces apoptosis. β-Amyloid (1-40) (rat) can be used for the research of Alzheimer's disease.
  • HY-W017500
    N-Methyl-DL-aspartic acid

    		iGluR Neurological Disease
    N-Methyl-DL-aspartic acid is a glutamate analogue and a NMDA receptor agonist and can be used for neurological diseases research.
  • HY-119857
    AGK7

    SIRT2 Inhibitor,Inactive Control

    		 Sirtuin Neurological Disease
    AGK7 is a potent inhibitor of sirtuin 2 (SIRT2). AGK7 rescues alpha-synuclein toxicity and modified inclusion morphology in a cellular model of Parkinson's disease. AGK7 protects against dopaminergic cell death both in vitro and in a Drosophila model of Parkinson's disease.
  • HY-17609
    Difelikefalin

    CR-845; FE-202845

    		 Opioid Receptor Neurological Disease
    Difelikefalin (CR-845; FE-202845) is a peripherally restricted and selective agonist of kappa opioid receptor (KOR). Difelikefalin produces anti-inflammatory effects and has the potential in modulating pruritus in conditions such as chronic kidney disease.
  • HY-122647
    Valiglurax

    VU0652957; VU2957

    		 mGluR Neurological Disease
    Valiglurax (VU0652957) is a potent, orally active and selective mGlu4 positive allosteric modulator with EC50 values of 64.6 nM and 197 nM for hmGlu4/Gqi5 and rmGlu4 GIRK, respectively. Valiglurax is a central nervous system (CNS) penetrant. Valiglurax can be used in research of Parkinson's disease.
  • HY-133589
    Fulvine

    		Others Metabolic Disease Cardiovascular Disease
    Fulvine is a pyrrolizidine alkaloid isolated from the seeds of Crotalaria fulva. Fulvine is hepatotoxic and can be used to induce hypertensive pulmonary vascular disease in vivo.
  • HY-139004
    SGC-CK2-1

    		Casein Kinase Neurological Disease
    SGC-CK2-1 is a highly potent, ATP-competitive, and cell-active CK2 chemical probe with exclusive selectivity for both human CK2 isoforms, with IC50s of 36 and 16 nM for CK2α and CK2α′respectively in the nanoBRET assay. SGC-CK2-1 can be used for the research of neurodegenerative diseases.
  • HY-N7950
    16-Oxoalisol A

    		Others Metabolic Disease
    16-Oxoalisol A is a triterpene in Rhizoma Alismatis. Rhizoma Alismatis is a commonly used traditional Chinese medicine (TCM). Rhizoma Alismatis can be used for the research of urinary tract diseases.
  • HY-P99190
    Eldelumab

    BMS-936557; MDX-1100

    		 CXCR Inflammation/Immunology
    Eldelumab (BMS-936557) is a humanised anti-CXCL10 (IP-10) monoclonal antibody (IgG1 type). Eldelumab selectively binds to CXCL10 and blocks CXCL10-induced calcium flux and cell migration. Eldelumab can be used in studies of autoimmune and auto-inflammatory diseases such as rheumatoid arthritis, ulcerative colitis and crohn's disease.
  • HY-B0143A
    Niacin hydrochloride

    Nicotinic acid hydrochloride; Vitamin B3 hydrochloride

    		 Endogenous Metabolite Apoptosis Cancer Metabolic Disease Cardiovascular Disease
    Niacin (Vitamin B3; Nicotinic acid) hydrochloride is an orally active B3 vitamin that is an essential nutrient for humans. Niacin hydrochloride plays a key role in energy metabolism, cell signaling cascades regulating gene expression and apoptosis. Niacin hydrochloride is also used in the study of cardiovascular diseases.
  • HY-147584
    BTK-IN-14

    		Btk Cancer Inflammation/Immunology
    BTK-IN-14 is a potent inhibitor of BTK. BTK plays an important role in signaling mediated by B cell antigen receptor (BCR) and Fcγreceptor (FcγR) in B cells and myeloid cells, respectively. BTK-IN-14 has the potential for the research of related diseases, especially autoimmune diseases, inflammatory diseases or cancer (extracted from patent WO2022057894A1, compound 1).
  • HY-P99292
    Fontolizumab

    HuZAF; Anti-Human IFNG Recombinant Antibody

    		 IFNAR Inflammation/Immunology
    Fontolizumab (HuZAF) is a humanized monoclonal anti-IFN-gamma antibody. Fontolizumab is an immunosuppressive agent. Fontolizumab can be used in research of Crohn’s disease.
  • HY-75992
    trans-Doxercalciferol

    		VD/VDR Others
    trans-Doxercalciferol is an isomer of Doxercalciferol. Doxercalciferol is a Vitamin D2 analog, acts as an activator of Vitamin D receptor, and prevent renal disease.
  • HY-146958
    MAO-B-IN-8

    		Monoamine Oxidase Neurological Disease
    MAO-B-IN-8 is a potent reversible MAO-B inhibitor and an inhibitor of microglial production of neuroinflammatory mediator. MAO-B-IN-8 can be used for neurodegenerative disease research.
  • HY-147938
    AChE-IN-19

    		Cholinesterase (ChE) Amyloid-β Neurological Disease
    AChE-IN-19 (compound A15) is a highly potent AChE inhibitor with an IC50 value of 0.56 μM, also inhibits Aβ aggregation. AChE-IN-19 has potent neuroprotective activities and nearly no toxicity on SH-SY5Y cells. AChE-IN-19 can be used for researching Alzheimer's disease.
  • HY-116565
    Usmarapride

    SUVN-D4010

    		 5-HT Receptor Neurological Disease
    Usmarapride (SUVN-D4010) is a potent, selective, orally active and brain penetrant 5-HT4 receptor partial agonist (EC50=44 nM). Usmarapride (SUVN-D4010) can be used for the research of cognitive deficits associated with Alzheimer's disease.
  • HY-148475
    NF-κB-IN-7

    		NF-κB Cancer Infection Metabolic Disease Inflammation/Immunology Cardiovascular Disease
    NF-κB-IN-7 (compound 1B) is a potent NF-κB inhibitor. NF-κB-IN-7 can be used for the research of cancer, inflammation, autoimmune diseases, diabetes and diabetes complications, infections, cardiovascular disease and defective reperfusion injury.
  • HY-19660
    Inogatran

    H-314-27

    		 Thrombin Cardiovascular Disease
    Inogatran (H-314-27) is a synthetic thrombin inhibitor, developed for the possible treatment and prophylaxis of arterial and venous thrombotic diseases.
  • HY-108237
    Naxagolide

    (+)-PHNO; Dopazinol

    		 Dopamine Receptor Neurological Disease
    Naxagolide ((+)-PHNO; Dopazinol) is a potent dopamine D2 (Dopamine Receptor) agonist. Naxagolide has the potential for the research of parkinson's disease (PD).
  • HY-147581
    BTK-IN-11

    		Btk Cancer Inflammation/Immunology
    BTK-IN-11 is a potent inhibitor of BTK. BTK plays an important role in signaling mediated by B cell antigen receptor (BCR) and Fcγreceptor (FcγR) in B cells and myeloid cells, respectively. BTK-IN-11 has the potential for the research of related diseases, especially autoimmune diseases, inflammatory diseases or cancer (extracted from patent WO2022063101A1, compound Z2).
  • HY-121392
    GR 125743

    		5-HT Receptor Neurological Disease Cardiovascular Disease
    GR 125743 is a selective 5-HT1B/1D receptor antagonist, with pKis of 8.85 and 8.31 for wild-type h5-HT1B and wild-type h5-HT1D, respectively. GR 125743 is used for the research of Parkinson's disease and cardiovascular diseases.
  • HY-106579S
    Tiaprofenic acid-d3

    		COX Inflammation/Immunology
    Tiaprofenic acid-d3 is a deuterium labeled Tiaprofenic acid. Tiaprofenic acid is a nonsteroidal anti-inflammatory agent (NSAID) mainly used in the treatment of rheumatic diseases[1].
  • HY-100723
    THK-523

    		Amyloid-β Neurological Disease
    THK-523 has demonstrated its high affinity and selectivity for tau pathology both in vitro and in vivo. 18F-THK523 is a potent tau imaging radiotracer.  18F-THK523 is a potent in vivo tau imaging ligand for Alzheimer's disease.
  • HY-148132
    GSK-3β inhibitor 11

    		GSK-3 Neurological Disease
    GSK-3β inhibitor 11 (compound 21) is a glycogen synthase kinase-3β (GSK-3β) inhibitor (IC50=10.02 μM). GSK-3β inhibitor 11 can be used in neurodegenerative disease research.
  • HY-108681
    680C91

    		Others Cancer Inflammation/Immunology Neurological Disease
    680C91 is an orally active, selective tryptophan 2,3-dioxygenase (TDO) inhibitor with a Ki of 51 nM. TDO is the key enzyme of tryptophan catabolism. 680C91 can be used for the research of cancer immunotherapy and Alzheimer’s Disease.
  • HY-120314
    GEA 3162

    		Others Inflammation/Immunology
    GEA 3162, oxatriazol derivative, is a NO-releasing compound. GEA 3162 can be used for the research of Inflammation diseases.
  • HY-145155
    Calpain-2-IN-1

    		Proteasome Neurological Disease
    Calpain-2-IN-1 (Formula 1A) is a isoform-specific calpain-2 inhibitor with Kis of 181 nM and 7.8 nM for calpain-1, and calpain-2, respectively. Calpain-2-IN-1 can be used for the research of neurodegenerative diseases and other diseases of synaptic function.
  • HY-122958
    Peucedanocoumarin III

    		α-synuclein Neurological Disease
    Peucedanocoumarin III is an inhibitor of α-synuclein and Huntington protein aggregates that enhances the clearance of nuclear and cytoplasmic β23 aggregates and prevents cytotoxicity induced by disease-associated proteins (i.e., mutant Huntington proteins and α-synuclein). Peucedanocoumarin III may be used in Parkinson's disease research.
  • HY-111338
    Tacrine

    		Cholinesterase (ChE) Neurological Disease
    Tacrine is a potent acetylcholinesterse (AChE) inhibitor (IC50=109 nM), also acting as a CYP1A2 substrate agent. Tacrine exhibits certain hepatotoxicity in some individuals. Tacrine can be used for researching Alzheimer's disease (AD).
  • HY-12866B
    (R)-Larotrectinib

    (R)-LOXO-101; (R)-ARRY-470

    		 Trk Receptor Cancer Infection Inflammation/Immunology
    (R)-Larotrectinib is a potent TRK inhibitor with an IC50 value of 28.5 nM for TrkA. (R)-Larotrectinib can be used for researching cancer, inflammatory and certain infectious diseases
  • HY-137553
    β-Aminoarteether

    SM934 free base

    		 NOD-like Receptor (NLR) Inflammation/Immunology
    β-Aminoarteether (SM934 free base) is an Artemisinin derivative with orally active. β-Aminoarteether can be used for inflammation and autoimmune disease research, such as lupus diseases.
  • HY-122957
    Huperzine C

    		Cholinesterase (ChE) Neurological Disease
    Huperzine C is an alkaloid isolated from Huperzia serrate. Huperzine C is an acetylcholinesterase (AChE) inhibotor, with an IC50 of 0.6 μM. Huperzine C can be used for the research of Alzheimer’s disease.
  • HY-N10742
    Maritimetin

    		Reactive Oxygen Species Cardiovascular Disease
    Maritimein is an aurone that can be isolated from Coreopsis tinctoria. Maritimein shows strong diphenyl(2,4,6-trinitrophenyl)iminoazanium (DPPH) radical-scavenging activity with an IC50 value of 4.12 μM. Maritimein can be used for the research of cardiovascular disease.
  • HY-P3908
    FITC-β-Ala-Amyloid β-Protein (1-42) (ammonium)

    		Amyloid-β Neurological Disease
    FITC-β-Ala-Amyloid β-Protein (1-42) ammonium is a FITC tagged Aβ1-42 monomer peptide. Aβ1-42 plays a key role in the pathogenesis of Alzheimer’s disease.
  • HY-15800
    CZC-25146 hydrochloride

    		LRRK2 Inflammation/Immunology Neurological Disease
    CZC-25146 hydrochloride is a potent LRRK2 inhibitor with IC50 values of 4.76 nM and 6.87 nM for wild-type LRRK2 and G2019S LRRK2, respectively. CZC-25146 hydrochloride inhibits PLK4, GAK, TNK1, CAMKK2 and PIP4K2C as well. CZC-25146 hydrochloride prevents mutant LRRK2-induced injury of neurons in vitro. CZC-25146 hydrochloride exhibits relatively favorable pharmacokinetic properties in mice. CZC-25146 hydrochloride can increase normal α-1-antitrypsin (AAT) secretion and reduce inflammatory cytokines. CZC-25146 hydrochloride can be used to research Parkinson's disease and liver diseases.
  • HY-132596
    Tivanisiran

    SYL1001

    		 Small Interfering RNA (siRNA) TRP Channel Neurological Disease
    Tivanisiran (SYL1001) is a siRNA used for the study of dry eye disease. Tivanisiran was designed to silence transient receptor potential vanilloid 1 (TRPV1).
  • HY-P3392
    Zilganersen

    ION373

    		 FAP Neurological Disease
    Zilganersen (ION373) is a glial fibrillary acidic protein (GFAP) inhibitor, an antisense oligonucleotide. Zilganersen can be used in Alexander disease (AxD) research.
  • HY-N2807
    Acanthoside B

    		Others Inflammation/Immunology Neurological Disease
    Acanthoside B is a potential bioactive lignan with anti-inflammatory and anti-amnesic activities. Acanthoside B can be used for alzheimer's disease and lung inflammation research
  • HY-B1039
    Ambroxol

    NA-872

    		 Glucosidase Autophagy Metabolic Disease Neurological Disease
    Ambroxol (NA-872), an active metabolite of the proagent Bromhexine, has potent expectorant effects. Ambroxol is a glucocerebrosidase (GCase) chaperone and increases glucocerebrosidase activity. Ambroxol induces lung autophagy and has the potential for Parkinson disease and neuronopathic Gaucher disease research.
  • HY-B1039A
    Ambroxol hydrochloride

    NA-872 hydrochloride

    		 Glucosidase Autophagy Metabolic Disease Neurological Disease
    Ambroxol hydrochloride (NA-872 hydrochloride), an active metabolite of the proagent Bromhexine, has potent expectorant effects. Ambroxol hydrochloride is a glucocerebrosidase (GCase) chaperone and increases glucocerebrosidase activity. Ambroxol hydrochloride induces lung autophagy and has the potential for Parkinson disease and neuronopathic Gaucher disease research.
  • HY-143614
    THR-β agonist 3

    		Others Metabolic Disease
    THR-β agonist 3 is a potent agonist of THR-β. THR-β agonist 3 has the potential for the research of metabolic diseases such as obesity, hyperlipidemia, hypercholesterolemia, diabetes and other conditions such as steatosis and non-alcoholic steatohepatitis (NASH), atherosclerosis and other related conditions and diseases (extracted from patent WO2021129827A1, compound 6).
  • HY-143613
    THR-β agonist 2

    		Others Metabolic Disease
    THR-β agonist 2 is a potent agonist of THR-β. THR-β agonist 2 has the potential for the research of metabolic diseases such as obesity, hyperlipidemia, hypercholesterolemia, diabetes and other conditions such as steatosis and non-alcoholic steatohepatitis (NASH), atherosclerosis and other related conditions and diseases (extracted from patent WO2021121210A1, compound 3).
  • HY-150728
    AChE-IN-22

    		Cholinesterase (ChE) Neurological Disease
    AChE-IN-22 (compound 10q) is a selective acetylcholinesterase (AChE) inhibitor against AChE and BuChE with the IC50 values of 0.88 μM and 10 μM, respectively. AChE-IN-22 can bind to both the CAS (catalytic active site) and PAS (peripheral anionic site) of AChE and has the potential for the research of Alzheimer's disease.
  • HY-142917
    THR-β agonist 4

    		Others Metabolic Disease
    THR-β agonist 4 is a potent agonist of THR-β. THR-β agonist 4 has the potential for the research of metabolic diseases such as obesity, hyperlipidemia, hypercholesterolemia, diabetes and other conditions such as steatosis and non-alcoholic steatohepatitis (NASH), atherosclerosis and other related conditions and diseases (extracted from patent WO2021143706A1, compound 72).
  • HY-116565A
    Usmarapride free base

    SUVN-D4010 free base

    		 5-HT Receptor Neurological Disease
    Usmarapride (SUVN-D4010) free base is a potent, selective, orally active and brain penetrant 5-HT4 receptor partial agonist (EC50=44 nM). Usmarapride (SUVN-D4010) free base can be used for the research of cognitive deficits associated with Alzheimer's disease.
  • HY-101357A
    CP 93129 dihydrochloride

    		5-HT Receptor Neurological Disease
    CP 93129 dihydrochloride is a potent 5HT1B receptor agonist. CP 93129 dihydrochloride has the potential for parkinson's disease research.
  • HY-138935
    Iclepertin

    BI-425809

    		 GlyT Neurological Disease
    Iclepertin (BI-425809) is a potent, selective and orally active glycine transporter 1 (GlyT1) inhibitor. Iclepertin is inactive against GlyT2. Iclepertin can be used for Alzheimer disease and schizophrenia research.
  • HY-151387
    A2AAR antagonist 1

    		Others Neurological Disease
    A2AAR antagonist 1 (compound 21a) is an A2AAR (adenosine A2A receptor) antagonist with a Ki value of 20 nM. A2AAR antagonist 1 shows high ligand efficiency, and it can be used for the research of neurodegenerative diseases.
  • HY-W104304
    2-(3-Trifluoromethylphenyl)glycine hydrochloride

    		Vasopressin Receptor Cardiovascular Disease
    2-(3-Trifluoromethylphenyl)glycine hydrochloride is a precursor of substituted 2-acetamido-5-aryl-l, 2,4-triazolones. Substituted 2-acetamido-5-aryl-l, 2,4-triazolones are dual V1a/V2 receptor antagonists and can be used in cardiovascular disease research.
  • HY-15608
    MPTP hydrochloride

    		Dopamine Receptor Apoptosis Neurological Disease Cancer
    MPTP hydrochloride is a brain penetrant dopamine neurotoxin, inducing Parkinson’s Disease. MPTP hydrochloride, a precusor of MPP +, induces apoptosis.
  • HY-120576
    ML169

    VU0405652

    		 mAChR Neurological Disease
    ML169 (VU0405652) is a potent, selective and brain penetrant positive allosteric modulator (PAM) of M1 mAChR, with an EC50 of 1.38 µM. ML169 is a MLPCN probe and can be used for Alzheimer’s disease.
  • HY-N10283
    Neoechinulin C

    		Endogenous Metabolite Neurological Disease
    Neoechinulin C, an echinulin-related indolediketopiperazine alkaloid, protects the neuronal cells against paraquat-induced damage in a Parkinson’s disease model.
  • HY-142949
    ALK5-IN-7

    		TGF-β Receptor Cancer Inflammation/Immunology
    ALK5-IN-7 is a potent inhibitor of ALK5. Transforming growth factor beta (TGF-β) is a multifunctional cytokine that is involved in regulating cell proliferation, differentiation and apoptosis through complex receptor signaling pathways on the cell surface in an autocrine, paracrine and endocrine manner. ALK5-IN-7 has the potential for the research of TGF-β-related diseases and conditions, including but not limited to tumors, fibrotic diseases, inflammatory diseases, autoimmune diseases, etc (extracted from patent WO2021129621A1, compound 4).
  • HY-142950
    ALK5-IN-6

    		TGF-β Receptor Cancer Inflammation/Immunology
    ALK5-IN-6 is a potent inhibitor of ALK5. Transforming growth factor beta (TGF-β) is a multifunctional cytokine that is involved in regulating cell proliferation, differentiation and apoptosis through complex receptor signaling pathways on the cell surface in an autocrine, paracrine and endocrine manner. ALK5-IN-6 has the potential for the research of TGF-β-related diseases and conditions, including but not limited to tumors, fibrotic diseases, inflammatory diseases, autoimmune diseases, etc (extracted from patent WO2021129621A1, compound 1).
  • HY-P1913
    Calcitonin Gene Related Peptide (CGRP) II, rat

    		CGRP Receptor Cardiovascular Disease
    Calcitonin Gene Related Peptide (CGRP) II, rat, a CGRP receptor activator, is a potent and long-lasting vasodilator. Calcitonin Gene Related Peptide (CGRP) II can be used in the research of cardiovascular diseases.
  • HY-13206
    MTEP hydrochloride

    		mGluR Neurological Disease
    MTEP hydrochloride is a potent, non-competitive and highly selective mGluR5 antagonist, with an IC50 of 5 nM and a Ki of 16 nM. MTEP hydrochloride shows antidepressant and anxiolytic-like effects. MTEP hydrochloride can be used for Parkinson's disease research.
  • HY-13206A
    MTEP

    		mGluR Neurological Disease
    MTEP is a potent, non-competitive and highly selective mGluR5 antagonist, with an IC50 of 5 nM and a Ki of 16 nM. MTEP shows antidepressant and anxiolytic-like effects. MTEP can be used for Parkinson's disease research.
  • HY-B0143
    Niacin

    Nicotinic acid; Vitamin B3

    		 Autophagy Endogenous Metabolite Cancer Metabolic Disease Cardiovascular Disease
    Niacin (Vitamin B3) is an orally active water-soluble B3 vitamin that is an essential nutrient for humans. Niacin (Vitamin B3) plays a key role in energy metabolism, cell signaling cascades regulating gene expression and apoptosis. Niacin (Vitamin B3) is also used in the study of cardiovascular diseases.
  • HY-15800A
    CZC-25146

    		LRRK2 Inflammation/Immunology Neurological Disease
    CZC-25146 is a potent and orally active LRRK2 inhibitor with IC50 values of 4.76 nM and 6.87 nM for wild-type LRRK2 and G2019S LRRK2, respectively. CZC-25146 inhibits PLK4, GAK, TNK1, CAMKK2 and PIP4K2C as well. CZC-25146 prevents mutant LRRK2-induced injury of neurons in vitro. CZC-25146 exhibits relatively favorable pharmacokinetic properties in mice. CZC-25146 can increase normal α-1-antitrypsin (AAT) secretion and reduce inflammatory cytokines. CZC-25146 can be used to research Parkinson's disease and liver diseases.
  • HY-146742
    PPARγ agonist 2

    		PPAR Metabolic Disease
    PPARγ agonist 2 is a potent PPARγ partial agonist and can be used for metabolic disease research.
  • HY-12947
    GNE-3511

    		MAP3K Neurological Disease
    GNE-3511 is an orally active bioavailable and brain-penetrant dual leucine zipper kinase (DLK) inhibitor with a Ki of 0.5 nM. GNE-3511 can cross the blood-brain-barrier and can be used for the research of neurodegenerative diseases.
  • HY-112555
    PDE7-IN-2

    		Phosphodiesterase (PDE) Neurological Disease
    PDE7-IN-2 (compound 2) is a potent PDE7 (phosphodiesterase 7) inhibitor with IC50 value of 2.1 µM. PDE7-IN-2 has the potential for the research of parkinson’s disease.
  • HY-B0623A
    Ropinirole hydrochloride

    SKF 101468 hydrochloride

    		 Dopamine Receptor Neurological Disease
    Ropinirole (SKF 101468) hydrochloride is an orally active, potent D3/D2 receptor agonist with a Ki of 29 nM for D2 receptor. Ropinirole hydrochloride has pEC50s of 7.4, 8.4 and 6.8 for hD2, hD3 and hD4 receptors, respectively. Ropinirole hydrochloride has no affinity for the D1 receptors. Ropinirole hydrochloride has the potential for Parkinson's disease.
  • HY-B0623
    Ropinirole

    SKF 101468

    		 Dopamine Receptor Neurological Disease
    Ropinirole (SKF 101468) is an orally active, potent D3/D2 receptor agonist with a Ki of 29 nM for D2 receptor. Ropinirole has pEC50s of 7.4, 8.4 and 6.8 for hD2, hD3 and hD4 receptors, respectively. Ropinirole has no affinity for the D1 receptors. Ropinirole has the potential for Parkinson's disease.
  • HY-111935
    3,3'-Diethyl-9-methylthiacarbocyanine iodide

    		Microtubule/Tubulin Neurological Disease
    3,3'-Diethyl-9-methylthiacarbocyanine iodide is a cyanine dye, also a tau aggregation inhibitor, with an IC50 value of 0.28 μM for tau. 3,3'-Diethyl-9-methylthiacarbocyanine iodide can cause misfunction of the microtubule cytoskeleton. 3,3'-Diethyl-9-methylthiacarbocyanine iodide can be used for researching Alzheimer’s disease.
  • HY-139066
    Punicic acid

    Trichosanic acid

    		 Others Metabolic Disease
    Punicic acid is a bioactive compound of pomegranate seed oil. Punicic acid is an isomer of conjugated α-linolenic acid and a ω-5 polyunsaturated fatty acid. Punicic acid has the potential for the research of various chronic diseases.
  • HY-116020
    FAUC 365

    		Dopamine Receptor Neurological Disease
    FAUC 365 is a highly dopamine D3 receptor-selective antagonist with Ki values of 0.5 nM, 340, 2600, and 3600 nM at D3, D4.4, D2short, and D2Long receptors, respectively. FAUC 365 can be used for the research of schizophrenia, and Parkinson's disease.
  • HY-100642S
    3-O-Methyltolcapone-d7

    Ro 40-7591 d7

    		 COMT Neurological Disease
    3-O-Methyltolcapone-d7 is a deuterium labeled 3-O-Methyltolcapone. 3-O-Methyltolcapone is a metabolite of Tolcapone. Tolcapone is an orally active, reversible, selective and potent COMT inhibitor. Tolcapone crosses the blood-brain barrier, and can be used for treatment of Parkinson's disease[1][2].
  • HY-A0009
    Galanthamine hydrobromide

    Galantamine hydrobromide

    		 Cholinesterase (ChE) nAChR Neurological Disease
    Galanthamine hydrobromide (Galantamine hydrobromide) is a selective, reversible, competitive, alkaloid AChE inhibitor, with an IC50 of 0.35 µM. Galanthamine hydrobromide is a potent allosteric potentiating ligand (APL) of human α3β4, α4β2, α6β4 nicotinic receptors ( nAChRs). Galanthamine hydrobromide is developed for the research of Alzheimer's disease (AD).
  • HY-145906
    D4R antagonis-2

    		Dopamine Receptor Neurological Disease
    D4R antagonist-2 is a potent and selective D4R antagonist with an IC50 of 6.52 µM. D4R antagonist-2 displays very favorable in vitro PK parameters and has good brain penetration. D4R antagonist-2 has the potential for the research of Parkinson’s disease.
  • HY-145988
    COX-2-IN-11

    		COX Inflammation/Immunology
    COX-2-IN-11 (compound 7b2) is a potent and selective inhibitor of COX-2. COX-2-IN-11 has the potential for the research of inflammation diseases.
  • HY-137789
    Tazofelone

    LY 213829

    		 COX Cancer
    Tazofelone (LY 213829) is a cyclooxygenase-II (COX-II) inhibitor. Tazofelone transform into sulfoxide and quinol metabolites is primarily mediated by CYP3A. Tazofelone can be used for the research of inflammatory bowel disease.
  • HY-P1913A
    Calcitonin Gene Related Peptide (CGRP) II, rat TFA

    		CGRP Receptor Cardiovascular Disease
    Calcitonin Gene Related Peptide (CGRP) II, rat TFA, a CGRP receptor activator, is a potent and long-lasting vasodilator. Calcitonin Gene Related Peptide (CGRP) II TFA can be used in the research of cardiovascular diseases.
  • HY-110325
    PF-04885614

    		Sodium Channel Neurological Disease
    PF-04885614 is a potent NaV1.8 inhibitor, extracted from patent US2018328915. PF-04885614 has potential for neurological and neurodevelopmental diseases treatment.
  • HY-P99022
    Gantenerumab

    		Amyloid-β Neurological Disease
    Gantenerumab is a fully human anti-amyloid-β (Aβ) IgG1 monoclonal antibody demonstrates sustained cerebral amyloid-β binding. Gantenerumab can be used for Alzheimer's disease research.
  • HY-136341
    7,8-Dihydroneopterin

    		Apoptosis NO Synthase Endogenous Metabolite Inflammation/Immunology Neurological Disease
    7,8-Dihydroneopterin, an inflammation marker, induces cellular apoptosis in astrocytes and neurons via enhancement of nitric oxide synthase (iNOS) expression. 7,8-Dihydroneopterin can be used in the research of neurodegenerative diseases.
  • HY-12452
    DPN

    Diarylpropionitrile

    		 Estrogen Receptor/ERR Apoptosis Autophagy Neurological Disease
    DPN (Diarylpropionitrile) is a non-steroidal estrogen receptor β (ERβ) selective ligand, with an EC50 of 0.85 nM. DPN has neuroprotective effects in a number of neurological diseases.
  • HY-150049
    γ-Secretase modulator 13

    		Amyloid-β Neurological Disease
    γ-Secretase modulator 13 (compound 4) is a gamma-secretase modulator (GSMs) that inhibits the production of the aggregated amyloid β-peptide Aβ42 with an IC50 value of 163 nM. γ-Secretase modulator 13 can be used in the study of Alzheimer's disease.
  • HY-W004284
    Heptadecanoic acid

    		Endogenous Metabolite Cancer Metabolic Disease Cardiovascular Disease
    Heptadecanoic acid is an odd chain saturated fatty acid (OCS-FA). Heptadecanoic acid is associated with several diseases, including the incidence of coronary heart disease, prediabetes and type 2 diabetes as well as multiple sclerosis.
  • HY-15470
    GW791343 trihydrochloride

    		P2X Receptor Neurological Disease
    GW791343 trihydrochloride is a potent human P2X7 receptor negative allosteric modulator (exhibits species-specific activity), produces a non-competitive antagonist effect on human P2X7 receptor, with a pIC50 of 6.9-7.2. GW791343 trihydrochloride can enhance ATP rhythm. GW791343 trihydrochloride can be used in study of neurological disease.
  • HY-15469
    GW791343 dihydrochloride

    		P2X Receptor Neurological Disease
    GW791343 dihydrochloride is a potent human P2X7 receptor negative allosteric modulator (exhibits species-specific activity), produces a non-competitive antagonist effect on human P2X7 receptor, with a pIC50 of 6.9-7.2. GW791343 dihydrochloride can enhance ATP rhythm. GW791343 dihydrochloride can be used in study of neurological disease.
  • HY-128128
    ASN04421891

    		Others Neurological Disease
    ASN04421891 is a potent GPR17 receptor modulator, with an EC50 of 3.67 nM in [35S]GTPγS binding assay. ASN04421891 can be used for neurodegenerative diseases research.
  • HY-103374
    Phenserine

    (-)-Eseroline phenylcarbamate; (-)-Phenserine

    		 Cholinesterase (ChE) Amyloid-β Neurological Disease
    Phenserine ((-)-Eseroline phenylcarbamate) is a derivative of Physostigmine and is a potent, noncompetitive, long-acting and selective AChE inhibitor. Phenserine reduces β-amyloid precursor protein (APP) and β-amyloid peptide (Aβ) formation. Phenserine improves cognitive performance and attenuates the progression of Alzheimer's disease.
  • HY-W263279
    (E)-Guanabenz

    (E)-Wy-8678

    		 Adrenergic Receptor Neurological Disease Cardiovascular Disease
    (E)-Guanabenz ((E)-Wy-8678) is an orally active central α2-adrenoceptor agonist. (E)-Guanabenz has antihypertensive activity, acts via stimulating central α2-adrenoceptors, and reducing net sympathetic outflow into the periphery. (E)-Guanabenz also directly binds to and inhibits GADD34, and has neuroprotective activity. (E)-Guanabenz can be used for researching hypertension and Parkinson disease.
  • HY-146137
    Transthyretin-IN-1

    		Transthyretin (TTR) Neurological Disease
    Transthyretin-IN-1 (Compound 1d) is a transthyretin (TTR) fibril formation inhibitor. Transthyretin-IN-1 can be used for Alzheimer’s disease research.
  • HY-150702
    MAGLi 432

    		MAGL Inflammation/Immunology Neurological Disease
    MAGLi 432 is a non-covalent, potent, highly selective, and reversible MAGL inhibitor. MAGLi 432 binds with high affinity to the MAGL active site, with IC50 values of 4.2 nM (human enzyme) and 3.1 nM (mouse enzyme). MAGLi 432 can be used in the research of chronic inflammation, blood–brain barrier dysfunction, neurological disorders such as multiple sclerosis, Alzheimer’s disease and Parkinson’s disease.
  • HY-135902
    Synucleozid

    NSC 377363

    		 DNA/RNA Synthesis Neurological Disease
    Synucleozid (NSC 377363) is a potent inhibitor of the SNCA mRNA that encodes α-synuclein protein. Synucleozid selectively targets the α-synuclein mRNA 5′ UTR at the designed IRE site, decreases the amount of SNCA mRNA loaded into polysomes and thereby inhibits SNCA translation. Synucleozid has the potential for the investigation of Parkinson’s disease.
  • HY-135902A
    Synucleozid hydrochloride

    NSC 377363 hydrochloride

    		 DNA/RNA Synthesis Neurological Disease
    Synucleozid hydrochloride (NSC 377363 hydrochloride) is a potent inhibitor of the SNCA mRNA that encodes α-synuclein protein. Synucleozid selectively targets the α-synuclein mRNA 5′ UTR at the designed IRE site, decreases the amount of SNCA mRNA loaded into polysomes and thereby inhibits SNCA translation. Synucleozid has the potential for the investigation of Parkinson’s disease.
  • HY-153476
    GIP/GLP-1 dual receptor agonist-1

    		GCGR Metabolic Disease
    GIP/GLP-1 dual receptor agonist-1 (compound 4) is a GIP/GLP-1 receptor agonist. GIP/GLP-1 dual receptor agonist-1 can be used in the research of metabolic disorders and fatty liver diseases, including nonalcoholic steatohepatitis (NASH) and nonalcoholic fatty liver disease (NAFLD).
  • HY-148385
    Ganglioside GM2

    		Others Cancer
    Ganglioside GM2 is a human tumor antigen (OFA-I-1). Ganglioside GM2 is the major lysosomal storage compound of Tay-Sachs disease.
  • HY-N10488
    BChE-IN-11

    		Cholinesterase (ChE) Neurological Disease
    BChE-IN-11 (compound 10) is a potent, selective and non-competitive BChE (butyrylcholinesterase) inhibitor, with an IC50 of 2.1 μM. BChE-IN-11 can be used for Alzheimer's disease (AD) research.
  • HY-P99821
    Ravagalimab

    ABBV-323

    		 TNF Receptor Inflammation/Immunology
    Ravagalimab (ABBV-323) is a CD40 antagonist (EC50: 3.7 nM). Ravagalimab can be used for research of Crohn's disease.
  • HY-143485
    IRAK4-IN-9

    		IRAK Cancer Inflammation/Immunology
    IRAK4-IN-9 (compound 73) is a potent IRAK4 inhibitor with an IC50 of 1.5 nM. IRAK4-IN-9 blocks MyD88 dependent signaling. IRAK4-IN-9 has the potential for the research of inflammatory diseases, autoimmune diseases, and cancer.
  • HY-143486
    IRAK4-IN-10

    		IRAK Cancer Inflammation/Immunology
    IRAK4-IN-10 (compound 75) is a potent IRAK4 inhibitor with an IC50 of 1.5 nM. IRAK4-IN-10 blocks MyD88 dependent signaling. IRAK4-IN-9 has the potential for the research of inflammatory diseases, autoimmune diseases, and cancer.
  • HY-18681
    Voxelotor

    GBT 440

    		 Others Cardiovascular Disease
    Voxelotor (GBT 440) is a potent inhibitor of haemoglobin S (HbS) polymerization. Voxelotor has the potential for sickle cell disease (SCD) treatment.
  • HY-P99485
    Brazikumab

    AMG 139; MEDI2070

    		 Interleukin Related Inflammation/Immunology
    Brazikumab (AMG 139) is a human IgG2 monoclonal antibody, selectively binds the p19 subunit of IL-23, with a KD of 0.138 nM for human IL-23. Brazikumab can be used for the research of Crohn's disease.
  • HY-111372
    Finerenone

    BAY 94-8862

    		 Mineralocorticoid Receptor Cardiovascular Disease
    Finerenone (BAY 94-8862) is a third-generation, selective, and orally available nonsteroidal mineralocorticoid receptor (MR) antagonist (IC50=18 nM). Finerenone displays excellent selectivity versus glucocorticoid receptor (GR), androgen receptor (AR), and progesterone receptor (>500-fold). Finerenone has the potential for cardiorenal diseases research, such as type 2 diabetes mellitus and chronic kidney disease.
  • HY-150050
    gamma-secretase modulator 5

    		Amyloid-β Neurological Disease
    gamma-secretase modulator 5 (compound 22d) is a brain-penetrant gamma-secretase modulator (GSMs) that inhibits the production of the aggregated amyloid β-peptide Aβ42 with an IC50 value of 60 nM. gamma-secretase modulator 5 can be used in the study of Alzheimer's disease.
  • HY-151539
    TH470

    		LIM Kinase (LIMK) Neurological Disease
    TH470 is a highly selective LIMK1/2 (LIM kinase1/2) inhibitor (LIMK1 IC50=9.8 nM; LIMK2 IC50=13 nM), and can be used in orphan disease research.
  • HY-15280
    GSK2292767

    		PI3K Inflammation/Immunology
    GSK2292767 is a potent and selective inhibitor of PI3Kδ, with a pIC50 of 10.1. GSK2292767 showing greater than 500-fold selective over the other PI3K isoforms. GSK2292767 can be used for the research of respiratory disease.
  • HY-139974
    BChE-IN-2

    		Cholinesterase (ChE) Neurological Disease
    BChE-IN-2 (compound 22) is a potent inhibitor of BChE with a Ki of 0.099 μM. BChE-IN-2 is a pyrimidine and pyridine derivative. BChE-IN-2 has the potential for the research of Alzheimer’s disease (AD) .
  • HY-151210
    MAO-B-IN-17

    		Monoamine Oxidase Neurological Disease
    MAO-B-IN-17 is a selective monoamine oxidase B (MAO-B) inhibitor with the IC50 value of 5.08 μM. MAO-B-IN-17 can be used in Parkinson’s disease research.
  • HY-147644
    α-Synuclein inhibitor 3

    		Others Neurological Disease
    α-Synuclein inhibitor 3 (Compound 7g) is a α-synuclein (α -Syn) aggregation inhibitor. α-Synuclein inhibitor 3 can be used for Parkinson’s disease research.
  • HY-P3648
    Ala-Ala-Pro-Val-chloromethylketone

    AAPV-CMK

    		 Elastase Inflammation/Immunology
    Ala-Ala-Pro-Val-chloromethylketone is an irreversible human neutrophil elastase (NE) inhibitor for use in the study of chronic inflammatory airway diseases.
  • HY-111313
    JNJ-26070109

    		Cholecystokinin Receptor Metabolic Disease
    JNJ-26070109 is a high-affinity, competitive, orally bioactive, and selective cholecystokinin 2 (CCK2) receptor antagonist with good pharmacokinetic properties, with pKis of 8.49, 7.99, and 7.70 for human, rat, and dog CCK2 receptors, respectively. The dual function of CCK2 receptors in regulating gastric acid secretion and growth of the gastrointestinal mucosa make this an attractive and novel target for the research of gastroesophageal reflux disease.
  • HY-150585
    BuChE-IN-5

    		Amyloid-β Cholinesterase (ChE) Tau Protein Neurological Disease
    BuChE-IN-5 (compound 25b) is a potent BuChE inhibitor with an IC50 value of 1.94 μM. BuChE-IN-5 efficiently inhibits aggregation Aβ and tau protein in Escherichia coli. BuChE-IN-5 also has free radical scavenging capacity and antioxidant activity. BuChE-IN-5 can be used for researching Alzheimer’s disease.
  • HY-132593
    Rovanersen

    WVE-120101

    		 Huntingtin Neurological Disease
    Rovanersen (WVE-120101) is an antisense oligonucleotide that specifically targets mutated mRNA copies of the huntington (HTT) gene without affecting healthy mRNA of HTT gene, thereby preventing the production of faulty Huntingtin protein. Rovanersen can be used for huntington’s disease research.
  • HY-112855
    PF-06454589

    		LRRK2 Neurological Disease
    PF-06447475 is a highly potent, selective, brain penetrant LRRK2 kinase inhibitor with IC50 values of 3 nM and 11 nM for WT LRRK and G2019S LRRK2, respectively. PF-06447475 can be used for parkinson's disease (PD) research.
  • HY-151348
    BACE1-IN-11

    		Beta-secretase Neurological Disease
    BACE1-IN-11 is a BACE1 inhibitor. BACE1-IN-11 has the BACE1 inhibitory activity with an IC50 value of 72 μM. BACE1-IN-11 can be used for the research of Alzheimer’s disease (AD) .
  • HY-14415
    SR8278

    		REV-ERB Metabolic Disease Neurological Disease
    SR8278 is a REV-ERBα antagonist and inhibits the REV-ERBα transcriptional repression activity with an EC50 of 0.47 μM. SR8278 is used to regulate the metabolism in organisms and study biological rhythm. SR8278 also can be used for the research of Duchenne muscular dystrophy and Alzheimer's disease.
  • HY-14418
    VU0361737

    ML-128

    		 mGluR Neurological Disease
    VU0361737 (ML-128) is a potent, selective and CNS penetrant positive allosteric modulator of metabotropic glutamate receptor 4 (mGluR4 PAM), with EC50s of 240 nM and 110 nM for human and rat mGluR4 receptors, respectively. VU0361737 has neuroprotective effect. VU0361737 is potential for Parkinson's disease research.
  • HY-143221
    AS-Inclisiran

    		Ser/Thr Protease Cardiovascular Disease
    AS-Inclisiran is the antisense of Inclisiran. Inclisiran (ALN-PCSsc) is a double-stranded small interfering RNA (siRNA) molecule that inhibits the transcription of PCSK-9. Inclisiran can be used for hyperlipidemia and cardiovascular disease (CVD) research.
  • HY-N10356
    4,27-Dimethyl withaferin A

    		Others Neurological Disease
    4,27-Dimethyl withaferin A is a synthetic analog of withanolide natural products. 4,27-Dimethyl withaferin A has the potential for the research of neurodegenerative diseases (extracted from patent WO2015077780A1).
  • HY-13993B
    Ro 25-6981 hydrochloride

    		iGluR Neurological Disease
    Ro 25-6981 hydrochloride is a potent, selective and activity-dependent NR2B subunit specific NMDA receptor antagonist. Ro 25-6981 hydrochloride shows anticonvulsant and anti-parkinsonian activity. Ro 25-6981 hydrochloride has the potential for the research of parkinson's disease (PD).
  • HY-13993
    Ro 25-6981

    		iGluR Neurological Disease
    Ro 25-6981 is a potent, selective and activity-dependent NR2B subunit specific NMDA receptor antagonist. Ro 25-6981 shows anticonvulsant and anti-parkinsonian activity. Ro 25-6981 has the potential for the research of parkinson's disease (PD).
  • HY-143475
    POP-IN-2

    		Prolyl Endopeptidase (PREP) Cancer Neurological Disease
    POP-IN-2 (Compound 7k) is a potent, covalent prolyl oligopeptidase (POP) inhibitor with a Ki of 6 nM. POP-IN-2 can be used for studying neurodegenerative diseases and cancer.
  • HY-143474
    Y-29794

    		Prolyl Endopeptidase (PREP) Cancer Neurological Disease
    Y-29794 (Compound 2) is a potent, covalent prolyl oligopeptidase (POP) inhibitor with a Ki of 0.95 nM. Y-29794 can be used for studying neurodegenerative diseases and cancer.
  • HY-151173
    XO/COX/LOX-IN-1

    		Xanthine Oxidase Lipoxygenase COX Cancer Metabolic Disease Inflammation/Immunology
    XO/COX/LOX-IN-1 (compound 7i) is a potent xanthine oxidase/cyclooxygenases/lipoxygenases (XO/COX/LOX) inhibitor. XO/COX/LOX-IN-1 can be used in studies of inflammation, cancer and metabolic diseases.
  • HY-N11081
    Hexanorcucurbitacin D

    		Others Cardiovascular Disease
    Hexanorcucurbitacin D is a cucurbitacin. Hexanorcucurbitacin D can be isolated from Trichosanthes cucumeroides roots. Hexanorcucurbitacin D can be used for the research of cardiovascular disease (CVD).
  • HY-N10490
    Blestrin D

    		Cholinesterase (ChE) Neurological Disease
    Blestrin D is a potent butyrylcholinesterase (BChE) mixed-type inhibitor with an IC50 value of 8.1 μM. Blestrin D can be isolated from Bletilla striata. Blestrin D can be used for the research of Alzheimer's disease (AD).
  • HY-14338A
    Idalopirdine Hydrochloride

    Lu AE58054 Hydrochloride

    		 5-HT Receptor Neurological Disease
    Idalopirdine Hydrochloride (Lu AE58054 Hydrochloride) is a potent, selective 5-HT6 receptor antagonist with a Ki value of 0.83 nM. Idalopirdine Hydrochloride may be used in studies of Alzheimer's disease and schizophrenia, among other related disorders.
  • HY-14338
    Idalopirdine

    Lu AE58054

    		 5-HT Receptor Neurological Disease
    Idalopirdine (Lu AE58054 ) is a potent, selective 5-HT6 receptor antagonist with a Ki value of 0.83 nM. Idalopirdine may be used in studies of Alzheimer's disease and schizophrenia, among other related disorders.
  • HY-134661A
    CVN424

    		GPR6 Neurological Disease
    CVN424 is an orally active and selective GPR6 inverse agonist with a Ki of 9.4 nM and an EC50 of 38 nM. CVN424 is brain-penetrant and has the potential for Parkinson disease research.
  • HY-132591
    Inclisiran

    ALN-PCSsc

    		 Small Interfering RNA (siRNA) Ser/Thr Protease Cardiovascular Disease
    Inclisiran (ALN-PCSsc) is a double-stranded small interfering RNA (siRNA) molecule that inhibits the transcription of PCSK-9. Inclisiran can be used for hyperlipidemia and cardiovascular disease (CVD) research.
  • HY-15295
    Vonoprazan Fumarate

    TAK-438

    		 Proton Pump Metabolic Disease
    Vonoprazan Fumarate (TAK-438), a proton pump inhibitor (PPI), is a potent and orally active potassium-competitive acid blocker (P-CAB), with antisecretory activity. Vonoprazan Fumarate inhibits H +,K +-ATPase activity in porcine gastric microsomes with an IC50 of 19 nM at pH 6.5. Vonoprazan Fumarate is developed for the research of acid-related diseases, such as gastroesophageal reflux disease and peptic ulcer disease.
  • HY-152235
    HDAC6-IN-15

    		HDAC Cancer Neurological Disease
    HDAC6-IN-15 is a selective histone deacetylase 6 (HDAC6) inhibitor. HDAC6-IN-15 has potent inhibitory activity for HDAC6 with IC50 value of 38.2 nM. HDAC6-IN-15 can be used for the research of cancer and neurodegenerative diseases.
  • HY-P99185
    Bapineuzumab

    		Amyloid-β Neurological Disease
    Bapineuzumab is an anti-β-amyloid protein (APP) monoclonal antibody. Bapineuzumab can be used for the research of Alzheimer’s disease (AD).
  • HY-121826
    Naronapride

    ATI-7505

    		 5-HT Receptor Metabolic Disease Inflammation/Immunology
    Naronapride (ATI-7505) is a potent prokinetic 5-HT4 receptor agonist. Naronapride can be used for gastrointestinal diseases research.
  • HY-13993A
    Ro 25-6981 Maleate

    		iGluR Neurological Disease
    Ro 25-6981 Maleate is a potent, selective and activity-dependent NR2B subunit specific NMDA receptor antagonist. Ro 25-6981 Maleat shows anticonvulsant and anti-parkinsonian activity. Ro 25-6981 Maleate has the potential for the research of parkinson's disease (PD).
  • HY-146039
    AChE-IN-15

    		Cholinesterase (ChE) Neurological Disease
    AChE-IN-15 (Compound 3d) is a reversible human acetylcholinesterase (huAChE) (IC50=6.8 μM) and human butyrylcholinesterase (huBChE) (IC50=16.1 μM) inhibitor. AChE-IN-15 shows significant antioxidant potency, AChE-IN-15 can be used for the research of Alzheimer’s disease.
  • HY-11052A
    Trap-101 hydrochloride

    		Opioid Receptor Neurological Disease
    Trap-101 hydrochloride is a potent, selective and competitive antagonist of NOP receptors over classical opioid receptors. Trap-101 stimulates GTPγ 35S binding to CHOhNOP membranes with pKi values of 8.65, 6.60, 6.14 and <5 for NOP, μ-, κ-, and δ-opioid receptors, respectively. Trap-101 attenuates motor deficits in a rat model of parkinson's disease and can be used for the research of nervous system diseases.
  • HY-150003
    Aβ1–42 aggregation inhibitor 1

    		Cholinesterase (ChE) Amyloid-β Neurological Disease
    Aβ1-42 aggregation inhibitor 1 inhibits AChE (acetylcholinesterase) and BuChE (butyrylcholinesterase) with the IC50 value of 2.64 μM and 1.29 μM, respectively. Aβ1-42 aggregation inhibitor 1 inhibits self-mediated Aβ1-42 aggregation by 51.29% at a concentration of 25 μM. Aβ1-42 aggregation inhibitor 1 has the potential for the research of anti-Alzheimer's disease.
  • HY-120596
    PPARδ/γ agonist 1 sodium

    		PPAR Neurological Disease
    PPARδ/γ agonist 1 sodium is a chemically unique and brain penetrant dual PPAR delta/gamma agonist. PPARδ/γ agonist 1 sodium can be used for the research of Alzheimer’s disease.
  • HY-144058
    JAK-IN-18

    		JAK Inflammation/Immunology
    JAK-IN-18 is a potent inhibitor of JAK. JAK-IN-18 is useful for the research of multiple diseases, particularly ocular, skin, and respiratory diseases (extracted from patent WO2018204238A1, compound 1).
  • HY-118342
    PQCA

    		mAChR Neurological Disease
    PQCA is a highly selective and potent muscarinic M1 receptor positive allosteric modulator. PQCA has an EC50 value of 49 nM and 135 nM on rhesus and human M1 receptor, respectively. PQCA is inactive for other muscarinic receptors. PQCA has potential to reduce the cognitive deficits associated with Alzheimer's disease.
  • HY-117822
    BRD0209

    		GSK-3 Neurological Disease
    BRD0209 is a potent, selective and dual inhibitor of GSK3α/β inhibitor (GSK3α IC50 = 19 nM; GSK3β IC50 = 5 nM). BRD0209 is also a reversible ATP-competitive inhibitor with fast-off kinetics (Ki = 4.2 nM, respectively). BRD0209 is a tricyclic pyrazolotetrahydroquinolinone compound. BRD0209 has the potential for the research of mood disorder diseases.
  • HY-134398
    Kinetin triphosphate

    6-Fu-ATP; KTP

    		 Others Neurological Disease
    Kinetin triphosphate(6-Fu-ATP; KTP) is an ATP analogue that regulates or enhances kinase function with higher catalytic efficiency than its endogenous substrate, ATP. Kinetin triphosphate can be used in Parkinson's disease research.
  • HY-P99405
    Prasinezumab

    PRX 002; RG 7935; RO 7046015

    		 α-synuclein Neurological Disease
    Prasinezumab (PRX 002) is a humanized IgG1 monoclonal antibody directed against aggregated α-synuclein. Prasinezumab has the potential for Parkinson's disease research.
  • HY-20457
    TL8-506

    		Toll-like Receptor (TLR) Inflammation/Immunology
    TL8-506 is a specific TLR8 agonist with an EC50 of 30 nM. TL8-506 can be used for the research of tuberculosis and autoimmune diseases.
  • HY-147564
    RET-IN-18

    		RET Cancer Neurological Disease
    RET-IN-18 is a pyridone compound. is a potent inhibitor of RET. RET-IN-18 is a potent inhibitor of RET. RET-IN-18 has the potential for the research of diseases related to irritable bowel syndrome (IBS) and other gastrointestinal disorders, as well as cancers, and neurodegenerative diseases (extracted from patent WO2022017524A1, compound 1).
  • HY-142778
    Lp-PLA2-IN-10

    		Phospholipase Metabolic Disease Neurological Disease
    Lp-PLA2-IN-10 is a potent inhibitor of lipoprotein-associated phospholipase A2 (Lp-PLA2). Lp-PLA2 previously known as platelet- activating factor acetylhydrolase (PAF-AH), is a phospholipase A2 enzyme involved in hydrolysis of lipoprotein lipids or phospholipids. Lp-PLA2-IN-10 has the potential for the research of neurodegenerative-related diseases such as Alzheimer's disease (AD), glaucoma, age-related macular degeneration (AMD), or cardiovascular diseases including atherosclerosis (extracted from patent WO2022001881A1, compound 4).
  • HY-144057
    JAK-IN-17

    		JAK Inflammation/Immunology
    JAK-IN-17 is a potent inhibitor of JAK. JAK-IN-17 is useful for the research of multiple diseases, particularly ocular, skin, and respiratory diseases (extracted from patent WO2021185305A1, compound 9-1).
  • HY-130795
    GSK-3β inhibitor 2

    		GSK-3 Neurological Disease
    GSK-3β inhibitor 2 (Compound 3) is a potent, selective and orally active GSK-3β inhibitor with an IC50 of 1.1 nM. GSK-3β inhibitor 2 can cross the blood-brain barrier. GSK-3β inhibitor 2 has the potential for Alzheimer's disease.
  • HY-16747
    Maralixibat chloride

    SHP625 chloride; LUM001 chloride; Lopixibat chloride

    		 Apical Sodium-Dependent Bile Acid Transporter Metabolic Disease
    Maralixibat (SHP625) chloride is an orally active ileal bile acid transporter (IBAT) inhibitor. Maralixibat chloride can be used for the research of rare cholestatic liver diseases including Alagille syndrome (ALGS), progressive familial intrahepatic cholestasis (PFIC) and biliary atresia.
  • HY-W020050
    Cystamine (dihydrochloride）

    		Caspase Glutaminase Apoptosis Cancer Neurological Disease
    Cystamine (dihydrochloride) is the disulfide form of the free thiol, cysteamine. Cystamine is an orally active transglutaminase (Tgase) inhibitor. Cystamine also has inhibition activity for caspase-3 with an IC50 value of 23.6 μM. Cystamine can be used for the research of severals diseases including Huntington's disease (HD) .
  • HY-18286
    NCGC00229600

    		TSH Receptor Endocrinology
    NCGC00229600 is an allosteric inverse agonist of thyrotropin receptor (TSHR). NCGC00229600 inhibits both TSH and stimulating antibody activation of TSHRs endogenously expressed in Graves' disease.
  • HY-147243
    Ansornitinib

    ANG-3070

    		 VEGFR PDGFR Inflammation/Immunology Cardiovascular Disease
    Ansornitinib is an orally active dual kinase inhibitor that inhibits platelet-derived growth factor receptor (PDGFR) and vascular endothelial growth factor receptor (VEGFR2). Ansornitinib can be used as an antifibrotic agent in lung, liver, kidney, and gastrointestinal fibrotic diseases.
  • HY-10096
    TCS2002

    		GSK-3 Neurological Disease
    TCS2002 (Compound 9b) is a highly selective, orally bioavailable and potent GSK-3β inhibitor with the IC50 of 35 nM. TCS2002 shows good pharmacokinetic profiles including favorable BBB penetration. TCS2002 can be used for the research of Alzheimer’s disease.
  • HY-146345
    Antiviral agent 18

    		Antibiotic Infection
    Antiviral agent 18 (Compound 5) is an anti-infection agent. Antiviral agent 18 results in good antiviral activity against murine norovirus. Antiviral agent 18 has the potential for the research of infectious and malignant diseases.
  • HY-147387
    DSS30

    		CDK Amyloid-β Inflammation/Immunology
    DSS30 is a P25/CDK5 inhibitor that reduces β-amyloid (Aβ) secretion by inhibiting amyloid precursor protein lyase 1 (BACEl) phosphorylation. DSS30 can be used in the study of neurodegenerative diseases such as Alzheimer's disease.
  • HY-P3140
    α-Synuclein (61-75)

    		α-synuclein Neurological Disease
    α-Synuclein (61-75) is the 61-75 fragment of α-Synuclein. α-Synuclein is an abundant neuronal protein that is highly enriched in presynaptic nerve terminals. α-Synuclein is a potential biomarker for Parkinson's disease (PD).
  • HY-142919
    μ opioid receptor agonist 2

    		Opioid Receptor Neurological Disease
    μ opioid receptor agonist 2 （Compound H-3）is an optically pure oxaspiro ring substituted pyrrolopyrazole derivative, acts as a MOR receptor agonist and can be used for the research of pain and pain related diseases.
  • HY-142918
    μ opioid receptor agonist 1

    		Opioid Receptor Neurological Disease
    μ opioid receptor agonist 1 （Compound H-1a）is an optically pure oxaspiro ring substituted pyrrolopyrazole derivative, acts as a MOR receptor agonist and can be used for the research of pain and pain related diseases.
  • HY-N8658
    Epinodosin

    		Others Infection Inflammation/Immunology
    Epinodosin is a diterpenoid. Epinodosin has moderate cytotoxicity against HL-60 cells with IC50 value of 10.4 μM. Epinodosin can be used for the research of inflammatory diseases.
  • HY-124775
    (S)-C33

    		Phosphodiesterase (PDE) Neurological Disease
    (S)-C33 is a potent and selective PDE9 (phosphodiesterase-9) inhibitor, with an IC50 of 11 nM. (S)-C33 can be used for central nervous system diseases and diabetes research.
  • HY-109001
    Alicapistat

    ABT-957

    		 Proteasome Neurological Disease
    Alicapistat (ABT-957) is an orally active selective inhibitor of human calpains 1 and 2 for the potential application of Alzheimer's disease (AD). Alicapistat mitigates the metabolic liability of carbonyl reduction and inhibits calpain 1 with an IC50 value of 395 nM.
  • HY-136459
    NMDA receptor antagonist 2

    		iGluR Neurological Disease
    NMDA receptor antagonist 2 is a potent and orally active NR2B subtype-selective NMDA antagonist with an IC50 and a Ki of 1.0 nM and 0.88 nM, respectively. NMDA receptor antagonist 2 is used for the study of neuropathic pain and Parkinson’s disease.
  • HY-P3507
    Dalazatide

    ShK-186

    		 Potassium Channel Metabolic Disease Inflammation/Immunology
    Dalazatide (ShK-186) is a specific Kv1.3 potassium channel peptide inhibitor. Dalazatide can be used in the study of autoimmune diseases such as multiple sclerosis (MS), lupus erythematosus, psoriasis, rheumatoid arthritis, type 1 diabetes and inflammatory bowel disease.
  • HY-149010
    NXPZ-2

    		Keap1-Nrf2 Neurological Disease
    NXPZ-2 is an orally active Keap1-Nrf2 protein–protein interaction (PPI) inhibitor with a Ki value of 95 nM, EC50 value of 120 and 170 nM. NXPZ-2 can dose-dependently ameliorate Aβ[1-42]-Induced cognitive dysfunction, improve brain tissue pathological changes in Alzheimer’s disease (AD) mouse by increasing neuron quantity and function. NXPZ-2 can inhibit oxidative stress by increasing Nrf2 expression levels and promoting its cytoplasm to nuclear translocation, which is helpful for Keap1-Nrf2 PPI inhibitors and AD associated disease research.
  • HY-N0690
    Schisandrin C

    Schizandrin-C; Wuweizisu-C

    		 Apoptosis Virus Protease Molecular Glues Cancer
    Schisandrin C (Schizandrin-C) is a phytochemical lignan isolated from Schizandra chinensis. Schisandrin C has diverse biological activities, including anticancer, anti-inflammatory and antioxidant effects. Schisandrin C is a molecular glue. Schisandrin C can be used for cancer, alzheimer’s disease, and liver diseases research. Schisandrin C induces cell apoptosis.
  • HY-N8440
    Gibberellin A4

    		Others Infection
    Gibberellin A4 is a natural compound that can be isolated from Sphaceloma manihoticola. Gibberellin A4 is a causal agent of cassava superelongation disease.
  • HY-120441
    CAY10590

    GK115

    		 Phospholipase Prostaglandin Receptor Inflammation/Immunology
    CAY10590 (GK115) is an inhibitor of secreted phospholipase A2 (sPLA2) and can be used for the research of chronic inflammatory kidney diseases.
  • HY-134968
    TTBK1-IN-1

    		Tau Protein Neurological Disease
    TTBK1-IN-1 is a potent, selective and brain-penetrant tau tubulin kinase 1 (TTBK1) inhibitor with an IC50 of 2.7 nM. TTBK1-IN-1 can be used for the research of alzheimer’s disease and related tauopathies.
  • HY-P3140A
    α-Synuclein (61-75) (TFA)

    		α-synuclein Neurological Disease
    α-Synuclein (61-75) TFA is the 61-75 fragment of α-Synuclein. α-Synuclein is an abundant neuronal protein that is highly enriched in presynaptic nerve terminals. α-Synuclein is a potential biomarker for Parkinson's disease (PD).
  • HY-143313
    Protease-Activated Receptor-1 antagonist 1

    		Protease Activated Receptor (PAR) Cardiovascular Disease
    Protease-Activated Receptor-1 antagonist 1 (Compound 13) is a protease-activated receptor-1 (PAR-1) antagonist with the IC50 of 3 nM by FLIPR technology. Protease-Activated Receptor-1 antagonist 1 can be used for the research of thrombotic cardiovascular, myocardial infarction, and peripheral arterial disease.
  • HY-128511
    Piridoxilate

    Piridoxylate

    		 Others Cardiovascular Disease
    Piridoxilate (Piridoxylate), a glyoxylate derivative, is an anti-anoxic agent. Piridoxilate can be used in research on vascular diseases and coronary occlusion.
  • HY-N6906
    Oleuroside

    		Others Neurological Disease
    Oleuroside is a phenolic secoiridoid in olive. Oleuroside can protect against mitochondrial dysfunction in models of early Alzheimer's disease and brain ageing.
  • HY-B0311A
    Carbidopa monohydrate

    (S)-(-)-Carbidopa monohydrate

    		 Aryl Hydrocarbon Receptor Cancer Neurological Disease
    Carbidopa ((S)-(-)-Carbidopa) monohydrate, a peripheral decarboxylase inhibitor, can be used for the research of Parkinson's disease. Carbidopa monohydrate is a selective aryl hydrocarbon receptor (AhR) modulator. Carbidopa monohydrate inhibits pancreatic cancer cell and tumor growth.
  • HY-B0311
    Carbidopa

    (S)-(-)-Carbidopa

    		 Aryl Hydrocarbon Receptor Cancer Neurological Disease
    Carbidopa ((S)-(-)-Carbidopa), a peripheral decarboxylase inhibitor, can be used for the research of Parkinson's disease. Carbidopa is a selective aryl hydrocarbon receptor (AhR) modulator. Carbidopa inhibits pancreatic cancer cell and tumor growth.
  • HY-143300
    BRD4-BD1-IN-2

    		Epigenetic Reader Domain Cancer Cardiovascular Disease
    BRD4-BD1-IN-2 is a selective BRD4-BD1 inhibitor, with an IC50 of 2.51 µM (20-times greater than that of BD2). BRD4-BD1-IN-2 can be used in studies of cancer and cardiovascular diseases.
  • HY-B0955
    Oxethazaine

    Oxetacaine

    		 HBV Neurological Disease
    Oxethazaine (Oxetacaine), a precursor of phentermine acidic, is an acid-resistent and orally active analgesic agent. Oxethazaine (Oxetacaine) has the potential for the relief of pain associated with peptic ulcer disease or esophagitis.
  • HY-N10489
    BChE-IN-12

    		Cholinesterase (ChE) Neurological Disease
    BChE-IN-12 (compound 12) is a potent butyrylcholinesterase (BChE) non-competitive inhibitor with an IC50 value of 2.3 μM. BChE-IN-12 can be isolated from Bletilla striata. BChE-IN-12 can be used for the research of Alzheimer's disease (AD).
  • HY-N10486
    BChE-IN-10

    		Cholinesterase (ChE) Neurological Disease
    BChE-IN-10 (compound 6) is a potent butyrylcholinesterase (BChE) mixed-type inhibitor with an IC50 value of 6.4 μM. BChE-IN-10 can be isolated from Bletilla striata. BChE-IN-10 can be used for the research of Alzheimer's disease (AD).
  • HY-P3507A
    Dalazatide TFA

    ShK-186 TFA

    		 Potassium Channel Metabolic Disease Inflammation/Immunology
    Dalazatide (ShK-186) TFA is a specific Kv1.3 potassium channel peptide inhibitor. Dalazatide TFA can be used in the study of autoimmune diseases such as multiple sclerosis (MS), lupus erythematosus, psoriasis, rheumatoid arthritis, type 1 diabetes and inflammatory bowel disease.
  • HY-P3780
    Cys-Gly-Lys-Lys-Gly-Amyloid β-Protein (36-42)

    		Amyloid-β Neurological Disease
    Cys-Gly-Lys-Lys-Gly-Amyloid β-Protein (36-42) is the 36-42 fragment of Amyloid β-Protein. β-amyloid, a polypeptide made up of 36-43 amino acids, is the main component of amyloid plaques found in the brains of people with Alzheimer's disease. β-amyloid oligomers (Aβos) plays A key role in the progression of Alzheimer's disease (AD) by inducing neuronal damage and cognitive impairment.
  • HY-N3345
    Macrocarpal B

    		Bacterial Infection
    Macrocarpal B is an antibacterial compounds. Macrocarpal B can be isolated from the branch of Eucalyptus globulus. Macrocarpal B can be used for the research of periodontal disease.
  • HY-B0341
    Nicorandil

    SG-75

    		 Potassium Channel Cardiovascular Disease
    Nicorandil (SG-75) is a potent potassium channel activator and targets vascular nucleoside diphosphate-dependent K + channels and cardiac ATP-sensitive K + channels (KATP). Nicorandil is a nicotinamide ester with vasodilatory and cardioprotective effects and has the potential for angina and forischemic heart diseases.
  • HY-15381
    Fingolimod phosphate

    FTY720 phosphate

    		 LPL Receptor Infection Inflammation/Immunology Neurological Disease
    Fingolimod phosphate (FTY720 phosphate) is an orally active sphingosine 1-phosphate (S1P) receptor agonist. Fingolimod phosphate can promote the neuroprotective effects of microglia. Fingolimod phosphate can be used for the research of multiple sclerosis and neurologic diseases.
  • HY-B0160
    Lafutidine

    FRG-8813

    		 Histamine Receptor Metabolic Disease Endocrinology
    Lafutidine (FRG-8813) is a histamine H2-receptor antagonist (H2RA), with proven gastric mucosal protective effects. Lafutidine can be used for the research of gastroesophageal reflux disease.
  • HY-149102
    LE 28

    		Fluorescent Dye Legumain Cancer Inflammation/Immunology
    LE 28 is a selective and activity-dependent legumain probe. LE 28 becomes fluorescent only upon binding active legumain. LE 28 can be used for research of cancers and inflammatory diseases.
  • HY-130609A
    Aβ42-IN-1 free base

    		γ-secretase Neurological Disease
    Aβ42-IN-1 free base (compound 1v) is an orally active, high brain exposure γ-secretase modulator. Aβ42-IN-1 free base potently reduces Aβ42 levels with an IC50 value of 0.091 µM, and significantly reduces brain Aβ42 levels in mice. Aβ42-IN-1 free base is a promising compound for the treatment of Alzheimer’s disease.
  • HY-151963
    PPARγ/GR modulator 1

    		PPAR Glucocorticoid Receptor Metabolic Disease
    PPARγ/GR modulator 1 is an orally active dual agonist of PPARγ and glucocorticoid receptor (GR), with Kis of 3.3 and 33.6 μM, respectively. PPARγ/GR modulator 1 can be used for the research of metabolic diseases, such as diabetes.
  • HY-143275
    HL-8

    		PI3K Cancer
    HL-8 is a PROTAC molecule targeting PI3K kinase. HL-8 has a significant and complete degradation effect on PI3K kinase at a concentration of 10 μM within 8 h. HL-8 has the potential for the research of cancer diseases.
  • HY-P99859
    Donanemab

    LY3002813

    		 Amyloid-β Neurological Disease
    Donanemab (LY3002813) is a humanized IgG1 monoclonal antibody directed at an N‐terminal pyroglutamate amyloid beta (Aβ) epitope. Donanemab has the potential for early Alzheimer's disease research.
  • HY-101277
    Vadadustat

    PG-1016548; AKB-6548

    		 HIF/HIF Prolyl-Hydroxylase Cardiovascular Disease
    Vadadustat (PG-1016548) is a titratable, oral hypoxia-inducible factor prolyl hydroxylase (HIF-PH) inhibitor. Vadadustat is an erythropoiesis-stimulating agent and has the potential for anemia treatment in chronic kidney disease in vivo.
  • HY-150223
    GalNAc unconjugated/naked Inclisiran

    		Small Interfering RNA (siRNA) Ser/Thr Protease Cardiovascular Disease
    GalNAc unconjugated/naked Inclisiran is a double-stranded small interfering RNA (siRNA) without GalNAc conjugation. GalNAc unconjugated/naked Inclisiran inhibits the transcription of PCSK-9, and can be used for hyperlipidemia and cardiovascular disease (CVD) research.
  • HY-19948
    Leucomethylene blue mesylate

    TRx0237 mesylate; Methylene blue leuco base mesylate

    		 Amyloid-β Neurological Disease
    Leucomethylene blue (TRx0237) mesylate, an orally active second-generation tau protein aggregation inhibitor (Ki of 0.12 μM), could be used for the study of Alzheimer's Disease. Leucomethylene blue mesylate is a common reduced form of Methylene Blue, Methylene Blue is a member of the thiazine class of dyes.
  • HY-151405
    Z164597606

    		Cholinesterase (ChE) Neurological Disease
    Z164597606 is a selective BChE inhibitor (IC50: 1.3 and 1.7 μM for eqBChE and hBChE). Z164597606 forms a π-π stacking interaction with the amino acid Trp82 of hBChE. Z164597606 can be used for the research of Alzheimer’s disease (AD).
  • HY-145578
    Linaprazan glurate

    X842

    		 Others Inflammation/Immunology
    Linaprazan glurate inhibits exogenously or endogenously stimulated gastric acid secretion. Linaprazan glurate exhibits several advantageous properties, such as fast onset, high in vivo potency and/or long duration of action. Linaprazan glurate is useful in the research of gastrointestinal inflammatory diseases and peptic ulcer diseases (extracted from patent WO2010063876A1).
  • HY-B0715
    Pentoxifylline

    BL-191; PTX; Oxpentifylline

    		 Phosphodiesterase (PDE) Autophagy HIV Cardiovascular Disease Cancer
    Pentoxifylline (BL-191), a haemorheological agent, is an orally active non-selective phosphodiesterase (PDE) inhibitor, with immune modulation, anti-inflammatory, hemorheological, anti-fibrinolytic and anti-proliferation effects. Pentoxifylline can be used for the research of peripheral vascular disease, cerebrovascular disease and a number of other conditions involving a defective regional microcirculation.
  • HY-145845
    HDAC1/MAO-B-IN-1

    		HDAC Monoamine Oxidase Neurological Disease
    HDAC1/MAO-B-IN-1 is a potent, selective and cross the blood-brain barrier HDAC1/MAO-B inhibitor with IC50 values of 21.4 nM and 99.0 nM for HDAC1 and MAO-B, respectively. HDAC1/MAO-B-IN-1 has the potential for the research of Alzheimer’s disease.
  • HY-103442
    CGP52411

    DAPH

    		 EGFR Amyloid-β Cancer Neurological Disease
    CGP52411 (DAPH) is a high selective, potent, orally active and ATP-competitive EGFR inhibitor with an IC50 of 0.3 μM. CGP52411 blocks the toxic influx of Ca 2+ ions into neuronal cells, and dramatic inhibits and reverses the formation of β-amyloid (Aβ42) fibril aggregates associated with Alzheimer's disease.
  • HY-121508
    (E/Z)-IT-603

    		NF-κB Cancer Inflammation/Immunology
    (E/Z)-IT-603 is a mixture of E-IT-603 and Z-IT-603 (IT-603). IT-603 is a c-Rel inhibitor with an IC50 of 3 μM. IT-603 has anti-tumor activity. (E/Z)-IT-603 is a promising modulator of T-cell responses in the context of graft-versus-host disease (GVHD) and malignant diseases.
  • HY-139725
    CDK5-IN-1

    		CDK Metabolic Disease
    CDK5-IN-1, a potent CDK5 inhibitor, is against CDK5 activity less than 10 nM. CDK5-IN-1 is used for kidney diseases research.
  • HY-124244
    PPARδ/γ agonist 1

    		PPAR Neurological Disease
    PPARδ/γ agonist 1 is a potent dual PPAR delta/gamma inhibitor. PPARδ/γ agonist 1 can be used for Alzheimer’s disease research.
  • HY-14280
    Entacapone

    		COMT Neurological Disease
    Entacapone is a potent, reversible, peripherally acting and orally active catechol-O-methyltransferase (COMT) inhibitor. Entacapone inhibits COMT from rat brain, erythrocytes and liver with IC50 values of 10 nM, 20 nM, and 160 nM, respectively. Entacapone is selective for COMT over other catecholamine metabolizing enzymes, including MAO-A, MAO-B, phenolsulphotransferase M (PST-M) and PST-P (IC50s>50 µM). Entacapone can be used for the research of Parkinson's disease. Entacapone serves as a inhibitor of FTO demethylation with an IC50 of 3.5 μM, can be used for the research of metabolic disorders.
  • HY-144074
    LRRK2-IN-4

    		LRRK2 Neurological Disease
    LRRK2-IN-4 is a potent, selective, CNS-penetran and orally active leucine-rich repeat kinase 2 (LRRK2) inhobitor with an IC50 of 2.6 nM. LRRK2-IN-4 has the potential for the research of Parkinson’s disease.
  • HY-148112
    Casein kinase 1δ-IN-1

    		Casein Kinase Neurological Disease
    Casein kinase 1δ-IN-1 (compound 822) is an inhibitor of casein kinase 1 delta (CK1δ), exhibits inhibition of greater than 5%. Casein kinase 1δ-IN-1 can be used for neurodegenerative disorders such as Alzheimer's disease research.
  • HY-121538
    CUDA

    		Epoxide Hydrolase PPAR Cardiovascular Disease
    CUDA is a potent inhibitor of soluble epoxide hydrolase (sEH), with IC50s of 11.1 nM and 112 nM for mouse sEH and human sEH, respectively. CUDA selectively increases peroxisome proliferator-activated receptor (PPAR) alpha activity. CUDA may be valuable for the research of cardiovascular disease.
  • HY-116090
    Conoidin A

    		Parasite Infection Neurological Disease Cardiovascular Disease
    Conoidin A is a cell permeable inhibitor of T. gondii enzyme peroxiredoxin II (TgPrxII) with nematicidal properties. Conoidin A covalently binds to the peroxidatic Cys47 of TgPrxII, irreversibly inhibiting its hyperperoxidation activity with an IC50 of 23 µM. Conoidin A also inhibits hyperoxidation of mammalian PrxI and PrxII (but not PrxIII). Conoidin A has antioxidant, neuroprotective effects and can be used for the research of ischaemic heart disease.
  • HY-145443
    Fludarabine-Cl

    		Others Cancer
    Fludarabine-Cl has inhibition effect on RNA adenosine deaminase 1(ADAR1), and can be used for preventing and/or researching cancer or tumor-related diseases.
  • HY-15452
    Selisistat

    EX-527

    		 Sirtuin Cancer Inflammation/Immunology
    Selisistat (EX-527) is a potent and selective SirT1 (Sir2 in Drosophila melanogaster) inhibitor with an IC50 of 123 nM for SirT1. Selisistat alleviates pathology in multiple animal and cell models of Huntington's disease.
  • HY-17623C
    (R)-Tegoprazan

    (R)-CJ-12420; (R)-RQ-00000004

    		 Proton Pump Metabolic Disease
    (R)-Tegoprazan (example 3), a benzimidazole derivative, is a potent kidney H +/K +-ATPase inhibitor with an IC50 of 98 nM of canine kidney Na +/K +-ATPase. (R)-Tegoprazan has the potential for gastrointestinal diseases research.
  • HY-N8598
    Caulophine

    		Others Cardiovascular Disease
    Caulophine is a fluoroketone alkaloid isolated from Caulophyllum robustum MAXIM. Caulophine has antioxidant activity and the ability to protect cardiomyocytes from oxidative and ischemic damage, providing potential value for coronary heart disease research.
  • HY-139293
    PF-07059013

    		Others Cardiovascular Disease
    PF-07059013 is an orally active and potent noncovalent modulator of sickled hemoglobin (HbS). PF-07059013 specifically binds to Hb with nanomolar affinity and displays strong partitioning into red blood cells (RBCs). PF-07059013 can be used for sickle cell disease (SCD) research.
  • HY-P99609
    Exidavnemab

    ABBV-0805; BAN-0805

    		 α-synuclein Neurological Disease
    Exidavnemab (ABBV-0805; BAN-0805) is a human IgG4 monoclonal antibody that selectively targets soluble human α-synuclein aggregates with a KD value of 18.5 pM and a KD value of 2.2 μM for α-synuclein monomers. Exidavnemab is used in Parkinson's disease research.
  • HY-W094474
    Lithium chloride hydrate

    hydrate/monohydrateortrihydrate

    		 GSK-3 Apoptosis Infection Neurological Disease
    Lithium chloride hydrate, an orally active mood stabilizer, is a potent virus inhibitor and effective immunomodulatory agent. Lithium chloride hydrate has antidepressant activity by inhibiting GSK3β and promoting neurogenesis. Lithium chloride hydrate alleviates cognition dysfunction and the symptoms of acute mania and depression. Lithium chloride hydrate can also be used for research of virus infection and Alzheimer's disease.
  • HY-N10397
    Maceneolignan H

    		CCR Inflammation/Immunology
    Maceneolignan H (Compound 8) is a neolignane compound isolated from the arils of Myristica fragrans. Maceneolignan H is a selective CCR3 antagonist (EC50 = 1.4 μM). Maceneolignan H has the potential for the research of allergic diseases.
  • HY-P99678
    Izokibep

    ABY-035

    		 Interleukin Related Inflammation/Immunology
    Izokibep (ABY-035) is a selective and antibody mimetic interleukin 17A (IL-17A) inhibitor with high potency and long half-life. Izokibep can be used for the research of ankylosing spondylitis, atherosclerosis and skin disease.
  • HY-66010A
    Cinepazide

    		Calcium Channel Cardiovascular Disease
    Cinepazide is a piperazine derivative and acts as a weak calcium channel blocker. Cinepazide is a potent vasodilator and can be used for the research of cerebrovascular diseases, including ischemic stroke, brain infarct et. al.
  • HY-13720A
    Pergolide mesylate

    Pergolide methanesulfonate; LY127809

    		 Dopamine Receptor Neurological Disease
    Pergolide mesylate (Pergolide methanesulfonate), an Ergoline derivative, is a potent and orally active dopamine D1 and D2 receptors agonist. Pergolide mesylate can be used for Parkinson's disease and hyperprolactinaemia research.
  • HY-145585
    Onfasprodil

    		iGluR Neurological Disease
    Onfasprodil is negative allosteric modulator of NR2B. Onfasprodil in combination with GABA receptor regulator has the potential for the research of Alzheimer's disease (extracted from patent CN111481543A).
  • HY-P0198B
    [D-Arg25]-Neuropeptide Y (human)

    		Neuropeptide Y Receptor Metabolic Disease Neurological Disease
    [D-Arg25]-Neuropeptide Y (human) ([D-Arg25] NPY) is a Y1 receptor selective agonist. Neuropeptide Y (human) is involved in Alzheimer's disease (AD) and protects rat cortical neurons against β-Amyloid toxicity.
  • HY-70081A
    Sumanirole maleate

    U-95666E; PNU-95666

    		 Dopamine Receptor Neurological Disease
    Sumanirole maleate (U-95666E; PNU-95666E) is a highly selective D2 receptor full agonist with an ED50 of about 46 nM. Sumanirole was developed for the treatment of Parkinson's disease and restless leg syndrome.
  • HY-145708
    Dual AChE-MAO B-IN-2

    		Cholinesterase (ChE) Monoamine Oxidase Neurological Disease
    Dual AChE-MAO B-IN-2 is a potent AChE and MAO B dual inhibitor with IC50s of 0.12 µM and 0.01 µM for b>AChE and MAO B, respectively. Dual AChE-MAO B-IN-2 has the potential for the research of Alzheimer’s disease.
  • HY-P3709
    TRAF6 peptide

    		E1/E2/E3 Enzyme Neurological Disease
    TRAF6 peptide is a specific TRAF6-p62 inhibitor. TRAF6 peptide potently abrogates NGF-dependent TrkA ubiquitination. TRAF6 peptide has good research potential in neurological diseases such as alzheimer's disease (AD), parkinson's, ALS, head trauma, epilepsy and stroke.
  • HY-107757
    GMQ

    		Sodium Channel Neurological Disease
    GMQ is a ASIC (acid-sensing ion) channel activator with an EC50 value of 1.83 mM for ASIC3 at pH 7.4. GMQ opens only ASIC3 but no other ASICs at pH 7.4. GMQ can be used for neurological disease research.
  • HY-109193
    Tovinontrine

    IMR-687

    		 Phosphodiesterase (PDE) Cardiovascular Disease
    Tovinontrine (IMR-687) is a highly potent and selective phosphodiesterase-9 (PDE9) inhibitor specifically for the treatment of sickle cell disease. IC50s are 8.19 nM and 9.99 nM for PDE9A1 and PDE9A2, respectively.
  • HY-148133
    GSK-3β inhibitor 12

    		GSK-3 Neurological Disease
    GSK-3β inhibitor 12 (compound 15) is an inhibitor of GSK-3β. GSK-3β inhibitor 12 inhibits 49.11% and 37.11% activity of 25 μM and 50 μM GSK-3β, respectively. GSK-3β inhibitor 12 can be used for the research of neurodegenerative diseases.
  • HY-131417
    cis-ACCP

    		MMP Cancer Infection Inflammation/Immunology Cardiovascular Disease
    cis-ACCP is an orally active antimetastatic matrix metalloproteinase-2 (MMP-2) selective inhibitor. cis-ACCP can inhibit MMP-2 and MMP-9 with IC50 values of 4 μM and 20 μM, respectively. cis-ACCP can be used for the research of a variety of chronic diseases.
  • HY-133011
    nAChR agonist 1

    		nAChR Neurological Disease
    nAChR agonist 1 is a potent, brain-permeable, and orally efficacious positive allosteric modulator of α7 nicotinic acetylcholine receptor (α7 nAChR). nAChR agonist 1 has the EC50 of 0.32 µM in a Ca 2+ mobilization assay (PNU-282987-induced, FLIPR based) in human IMR-32 neuroblastoma cells that endogenously express α7 nAChR. nAChR agonist 1 can be develpoped for the treatment of Alzheimer’s disease.
  • HY-143464
    BChE-IN-4

    		Cholinesterase (ChE) Neurological Disease
    BChE-IN-4 is a potent and cross the blood-brain barrier BChE inhibitor. BChE-IN-4 attenuates learning and memory deficits caused by cholinergic deficit in mouse model. BChE-IN-4 has the potential for the research of alzheimer’s disease.
  • HY-141511
    Coppersensor 1

    		Fluorescent Dye Cancer Neurological Disease
    Coppersensor-1 (CS1) is a membrane-permeable fluorescent dye. Coppersensor-1 has a picomolar affinity for Cu + with high selectivity over competing cellular metalions. Coppersensor-1 as a probe, can selective and sensitive detection of copper(I) ions (Cu +) in biological samples, including live cells. Coppersensor-1 can be used for the research of imaging of severe diseases such as cancer, cardiovascular disorders and neurogenerative diseases. Storage: protect from light.
  • HY-103165
    PSB-0788

    		Adenosine Receptor Cancer Infection
    PSB-0788 is a new selective high-affinity A2B antagonist with IC50 value of 3.64 nM and Ki value of 0.393 nM, respeactively. PSB-0788 can be used for the research for chronic inflammatory lung diseases.
  • HY-N10487
    Bleformin A

    		Cholinesterase (ChE) Neurological Disease
    Bleformin A is a potent BChE inhibitor with an IC50 value of 5.2 μM. Bleformin A is a nature product that could be isolated from Bletilla striata. Bleformin A can be used for research of Alzheimer's disease (AD).
  • HY-147135
    TEAD-IN-3

    		YAP Cancer
    TEAD-IN-3 (compound I-177) is a potent TEAD transcription factor inhibitor. TEAD-IN-3 can be used for the research of proliferative diseases (such as cancer) .
  • HY-145640
    Vimnerixin

    AZD4721; RIST4721

    		 CXCR Inflammation/Immunology
    Vimnerixin (AZD4721) is the potent and orally active antagonist of acidic CXC chemokine receptor 2 (CXCR2). Vimnerixin has the potential for the research of inflammatory disease.
  • HY-151281
    ALK5-IN-31

    		TGF-β Receptor Cancer
    ALK5-IN-31 (compound Ex-08) is a selective ALK-5 inhibitor (IC50≤10 nM), inhibits TGF-β-induced SMAD signaling. ALK5-IN-31 has the potential to inhibit growth of tumour in vivo. ALK5-IN-31 can be used in study of proliferative diseases such as cancer, fibrotic diseases, and systemic sclerosis.
  • HY-151275
    ALK5-IN-28

    		TGF-β Receptor TGF-beta/Smad Cancer
    ALK5-IN-28 (compound Ex-05) is a selective ALK-5 inhibitor (IC50≤10 nM), inhibits TGF-β-induced SMAD signaling. ALK5-IN-28 has the potential to inhibit growth of tumour in vivo. ALK5-IN-28 can be used in study of proliferative diseases such as cancer, fibrotic diseases, and systemic sclerosis.
  • HY-151282
    ALK5-IN-32

    		TGF-β Receptor TGF-beta/Smad Cancer
    ALK5-IN-32 (compound EX-09) is a selective ALK-5 inhibitor (10 nM<IC50<100 nM), inhibits TGF-β-induced SMAD signaling. ALK5-IN-32 has the potential to inhibit growth of tumour in vivo. ALK5-IN-32 can be used in study of proliferative diseases such as cancer, fibrotic diseases, and systemic sclerosis.
  • HY-153011
    ROCK-IN-5

    		ROCK ERK GSK-3 Neurological Disease Cardiovascular Disease
    ROCK-IN-5 (compound I-B-37) is a potent inhibitor of ROCK, ERK, GSK, and AGC protein kinases. ROCK-IN-5 has the potential for proliferative, cardiac and neurodegenerative diseases research.
  • HY-N10443
    Mammea A/BA

    		Parasite Apoptosis Autophagy Reactive Oxygen Species Infection
    Mammea A/BA has potent activity against Trypanosoma cruzi (T. cruzi). Mammea A/BA induces mitochondrial dysfunction, reactive oxygen species (ROS) production and DNA fragmentation, and increases number of acidic vacuoles. Mammea A/BA can induce apoptosis, autophagy and necrosis. Mammea A/BA can be used for researching chagas disease.
  • HY-118952
    PF-06456384

    		LRRK2 Neurological Disease
    PF-06447475 is a highly potent, selective, brain penetrant LRRK2 kinase inhibitor with IC50 values of 3 nM and 11 nM for WT LRRK and G2019S LRRK2, respectively. PF-06447475 can be used for parkinson's disease (PD) research.
  • HY-118952A
    PF-06456384 trihydrochloride

    		LRRK2 Neurological Disease
    PF-06447475 trihydrochloride is a highly potent, selective, brain penetrant LRRK2 kinase inhibitor with IC50 values of 3 nM and 11 nM for WT LRRK and G2019S LRRK2, respectively. PF-06447475 trihydrochloride can be used for parkinson's disease (PD) research.
  • HY-44809A
    Izilendustat hydrochloride

    		HIF/HIF Prolyl-Hydroxylase Cancer Inflammation/Immunology
    Izilendustat (hydrochloride) is a potent inhibitor of prolyl hydroxylase which stabilizes hypoxia inducible factor- 1 alpha (HIF- lα), as well as hypoxia inducible factor-2 (HIF-2). Izilendustat (hydrochloride) has the potential for the research of HIF- lα related diseases including Peripheral Vascular Disease (PVD), Coronary Artery Disease (CAD), heart failure, ischemia, anemia, colitis, and other inflammatory bowel diseases (extracted from patent WO2011057115A1/WO2011057112A1/WO2011057121A1).
  • HY-N5077
    Sinapine

    		Cholinesterase (ChE) P-glycoprotein Cancer Inflammation/Immunology Neurological Disease
    Sinapine is an alkaloid isolated from seeds of the cruciferous species. Sinapine exhibits anti-inflammatory, anti-oxidant, anti-tumor, anti-angiogenic and radio-protective effects. Sinapine is also an acetylcholinesterase (AChE) inhibitor and can be used for the research of Alzheimer’s disease, ataxia, myasthenia gravis, and Parkinson’s disease.
  • HY-P3845
    (Gly22)-Amyloid β-Protein (1-42)

    		Amyloid-β Neurological Disease
    (Gly22)-Amyloid β-Protein (1-42) is a peptide fragment of amyloid β-protein (Aβ). Amyloid β-protein is the primary component of both vascular and parenchymal amyloid deposits in Alzheimer's disease. Mutation of Glu22 to Gly22 in Aβ can increase aggregation.
  • HY-139560
    KDM2B-IN-1

    		Histone Demethylase Cancer Inflammation/Immunology
    KDM2B-IN-1 is a histone demethylase (kdm2b) inhibitor and can be used for hyperproliferative diseases research.
  • HY-136449
    Bromchlorbuterol hydrochloride

    		Adrenergic Receptor Inflammation/Immunology
    Bromchlorbuterol hydrochloride is an active β-adrenergic agonist (β-agonist) and can be used for the research of pulmonary disease and asthma.
  • HY-147321
    3'-DMTr-dG(iBu)

    		Tau Protein HBV Infection Neurological Disease
    3'-DMTr-dG(iBu) is a nucleoside for the synthesis of nucleic acid, such as antiviral agents used in the research of viral infection (HBV, HDV), and oligonucleotides against Alzheimer’s disease and other tauopathies.
  • HY-146272
    Vasopressin V2 receptor antagonist 1

    		Vasopressin Receptor Metabolic Disease
    Vasopressin V2 receptor antagonist 1 (Compound 4g) is a vasopressin V2 receptor (V2R) antagonist with a Ki of 3.8 nM. Vasopressin V2 receptor antagonist 1 can be used for autosomal dominant polycystic kidney disease (ADPKD) research.
  • HY-N0702
    Tenuifolin

    		Beta-secretase Cholinesterase (ChE) Neurological Disease
    Tenuifolin is a triterpene isolated from Polygala tenuifolia Willd, has neuroprotective effects. Tenuifolin reduces Aβ secretion by inhibiting β-secretase. Tenuifolin improves learning and memory in aged mice by decreasing AChE activity and has the potential for Alzheimer’s disease (AD) treatment.
  • HY-13204
    Biperiden hydrochloride

    KL 373 hydrochloride

    		 mAChR Neurological Disease
    Biperiden (KL 373) hydrochloride is a non-selective muscarinic receptor antagonist that competitively binds to M1 muscarinic receptors, thereby inhibiting acetylcholine and enhancing dopamine signaling in the central nervous system. Biperiden hydrochloride has the potential for the research of Parkinson's disease and other related psychiatric disorders.
  • HY-135825
    TFEB activator 1

    		Autophagy Neurological Disease
    TFEB activator 1 is an orally effective, mTOR-independent activator of TFEB. TFEB activator 1 significantly promotes the nuclear translocation of Flag-TFEB with an EC50 of 2167 nM. TFEB activator 1 enhances autophagy without inhibiting the mTOR pathway and has the potential for neurodegenerative diseases treatment.
  • HY-13204A
    Biperiden

    KL 373

    		 mAChR Neurological Disease
    Biperiden (KL 373) is a non-selective muscarinic receptor antagonist that competitively binds to M1 muscarinic receptors, thereby inhibiting acetylcholine and enhancing dopamine signaling in the central nervous system. Biperiden has the potential for the research of Parkinson's disease and other related psychiatric disorders.
  • HY-146757
    RIPK1-IN-13

    		RIP kinase Inflammation/Immunology
    RIPK1-IN-13 (Compound 8) is a potent inhibitor of RIPK1 with an IC50 value of 1139 nM. RIPK1-IN-13 blocks the activation of the necroptosis pathway via the inhibition of RIPK1. RIPK1-IN-13 has the potential for the research of inflammation diseases.
  • HY-147527
    CDK8-IN-5

    		CDK Inflammation/Immunology
    CDK8-IN-5 is a potent CDK8 inhibitor with an IC50 of 72 nM. CDK8-IN-5 shows anti-inflammatory activities with 43% IL-10 enhancement rate. CDK8-IN-5 has the potential for the research of inflammatory bowel disease.
  • HY-143615
    RET-IN-10

    		RET Cancer
    RET-IN-10 is a potent inhibitor of RET. RET loss of function mutations leads to Hirschsprung's disease, while its gain of function mutations is associated with a variety of human tumors. RET-IN-10 has the potential for the research of cancer diseases (extracted from patent WO2021135938A1, compound 18).
  • HY-14399
    Itanapraced

    CHF5074; CSP-1103

    		 γ-secretase Apoptosis Neurological Disease
    Itanapraced (CHF5074) is an orally active γ-secretase modulator and a non-steroidal anti-inflammatory derivative. Itanapraced reduces Aβ42 and Aβ40 secretion with IC50 values of 3.6 and 18.4 μM, respectively. Itanapraced inhibits cell apoptosis of hippocampal neurons induced by oxygen and glucose deprivation (OGD). Itanapraced can be used for the research of Alzheimer's disease.
  • HY-B0972
    Cinchophen

    		Bacterial Inflammation/Immunology
    Cinchophen is a potent and orally active non-steroidal anti-inflammatory agent, has analgesic and antimicrobial effects. Cinchophen can be used for the research of arthritis and some liver diseases.
  • HY-131728
    GPR35 agonist 3

    		GPR35 Metabolic Disease Inflammation/Immunology Neurological Disease Cardiovascular Disease
    GPR35 agonist 3 is a synthetic GPR35 agonist with an EC50value of 1.4 μM. GPR35 agonist 3 can be used for the research of various diseases, such as gastric cancer, type 2 diabetes, cardiovascular diseases, immune system and peripheral nervous system.
  • HY-N7887
    Cassiaside

    		Beta-secretase Inflammation/Immunology Neurological Disease
    Cassiaside is a naphthopyrone glucoside, shows mixed-type inhibition against BACE1 (IC50=4.45 μM; Ki=9.85 μM). Cassiaside possesses potential anti- Alzheimer's disease (AD) activity.
  • HY-P9967
    Aducanumab

    BIIB037

    		 Amyloid-β Neurological Disease
    Aducanumab (BIIB037), a human monoclonal antibody selective for aggregated forms of amyloid beta (Aβ). Aducanumab shows brain penetration, and can be used for Alzheimer's disease (AD) research.
  • HY-113643
    Levemopamil hydrochloride

    		Calcium Channel 5-HT Receptor Neurological Disease
    Levemopamil hydrochloride is a blood-brain barrier penetrable calcium channel blocker and a 5-HT2 antagonist. Levemopamil hydrochloride can be used for temporary occlusion and neurological disease research.
  • HY-150205
    Succinate/succinate receptor antagonist 1

    		Others Inflammation/Immunology
    Succinate/succinate receptor antagonist 1 (compound 7a) is a succinate/succinate receptor antagonist. Succinate/succinate receptor antagonist 1 blocks succinate signaling in gingival tissue. Succinate/succinate receptor antagonist 1 inhibits the activation of succinate receptor 1 (SucnRl) with an IC50 value of 20 μΜ. Succinate/succinate receptor antagonist 1 can be used for the research of periodontal disease.
  • HY-144619
    TLR7/8 antagonist 2

    		Toll-like Receptor (TLR) Inflammation/Immunology
    TLR7/8 antagonist 2 (Compound 15) is a potent and orally active agonist of TLR7/8 with IC50s of 4.9 and 0.6 nM, respectively. Inappropriate activation of TLR7 and TLR8 is linked to several autoimmune diseases, such as lupus erythematosus. TLR7/8 antagonist 2 has the potential for the research of autoimmune diseases.
  • HY-N7560
    Safranal

    		Others Inflammation/Immunology Neurological Disease
    Safranal is an orally active main component of Saffron (Crocus sativus) and is responsible for the unique aroma of this spice. Safranal has neuroprotective and anti-inflammatory effects and has the potential for Parkinson’s disease research.
  • HY-14280A
    Entacapone sodium salt

    		COMT Neurological Disease
    Entacapone sodium salt is a potent, reversible, peripherally acting and orally active catechol-O-methyltransferase (COMT) inhibitor. Entacapone sodium salt inhibits COMT from rat brain, erythrocytes and liver with IC50 values of 10 nM, 20 nM, and 160 nM, respectively. Entacapone sodium salt is selective for COMT over other catecholamine metabolizing enzymes, including MAO-A, MAO-B, phenolsulphotransferase M (PST-M) and PST-P (IC50s>50 µM). Entacapone sodium salt can be used for the research of Parkinson's disease. Entacapone sodium salt serves as as a inhibit of FTO demethylation with an IC50 of 3.5 μM, can be used for the research of metabolic disorders.
  • HY-153224
    GLPG2534

    		IRAK Inflammation/Immunology
    GLPG2534 is an orally active and selective IRAK4 inhibitor, with IC50 values of 6.4 nM and 3.5 nM for human and mouse IRAK4. GLPG2534 can be used for the research of inflammatory skin diseases.
  • HY-N4113
    Glycycoumarin

    		Keap1-Nrf2 AMPK Cancer
    Glycycoumarin is a potent antispasmodic agent. Glycycoumarin is a major bioactive coumarin of licorice and exhibits antispasmodic activity. Glycycoumarin also has hepatoprotective effect. Glycycoumarin can be used for the research of abdominal pain and liver diseases.
  • HY-N11641
    Methyl ganoderate A acetonide

    		Cholinesterase (ChE) Neurological Disease
    Methyl ganoderate A acetonide, a lanostane triterpene, is a natural product that could be isolated from the fruiting bodies of Ganoderma lucidum. Methyl ganoderate A acetonide is a potent AChE inhibitor with an IC50 value of 18.35 μM. Methyl ganoderate A acetonide can be used in research of Alzheimer’s disease (AD).
  • HY-N5077B
    Sinapine hydroxide

    		Cholinesterase (ChE) P-glycoprotein Cancer Inflammation/Immunology Neurological Disease
    Sinapine hydroxide is an alkaloid isolated from seeds of the cruciferous species. Sinapine hydroxide exhibits anti-inflammatory, anti-oxidant, anti-tumor, anti-angiogenic and radio-protective effects. Sinapine hydroxide is also an acetylcholinesterase (AChE) inhibitor and can be used for the research of Alzheimer’s disease, ataxia, myasthenia gravis, and Parkinson’s disease.
  • HY-U00341
    ST4206

    		Adenosine Receptor Neurological Disease
    ST4206 is a potent and orally active adenosine A2A receptor antagonist, with Kis of 12 nM and 197 nM for adenosine A2A receptor and adenosine A1 receptor, respectively. ST4206 has the potential for Parkinson׳s disease research.
  • HY-109052
    Atabecestat

    JNJ-54861911

    		 Beta-secretase Neurological Disease
    Atabecestat (JNJ-54861911) is a potent brain-penetrant and orally active β-site amyloid precursor protein cleaving enzyme 1 (BACE1) inhibitor, achieves robust and high CSF Aβ reduction. Atabecestat s tolerated and displays a sustained pharmacokinetic (PK) and pharmacodynamic (PD) characteristics. Atabecestat has the potential for Alzheimer's Disease treatment.
  • HY-N3734
    Deoxyneocryptotanshinone

    		Beta-secretase Phosphatase Neurological Disease
    Deoxyneocryptotanshinone, a natural tanshinone, is a high affinity BACE1 (Beta-secretase) inhibitor with an IC50 value of 11.53 μM. Deoxyneocryptotanshinone shows a promising dose-dependent inhibition of protein tyrosine phosphatase 1B (PTP1B) with an IC50 value of 133.5 μM. Deoxyneocryptotanshinone can be used for Alzheimer's disease research.
  • HY-15545
    AZD-4818

    		CCR Endocrinology Inflammation/Immunology Neurological Disease
    AZD-4818 is a potent antagonist of chemokine CCR1. AZD-4818 can be used for researching chronic obstructive pulmonary disease (COPD) .
  • HY-P99471
    Bepranemab

    UCB 0107

    		 Tau Protein Neurological Disease
    Bepranemab (UCB 0107) is a humanized, full-length IgG4 monoclonal antibody that binds to a central tau epitope (amino acids 235-250). Bepranemab can be used for Alzheimer’s disease (AD) research.
  • HY-66010
    Cinepazide Maleate

    MD-67350

    		 Calcium Channel Cardiovascular Disease
    Cinepazide Maleate (MD-67350) is a piperazine derivative and acts as a weak calcium channel blocker. Cinepazide Maleate is a potent vasodilator and can be used for the research of cerebrovascular diseases, including ischemic stroke, brain infarct et. al.
  • HY-148191
    CL-197

    		HIV Protease Cancer Infection Inflammation/Immunology Cardiovascular Disease
    CL-197 is an orally active and long-acting purine anti-HIV nucleoside reverse transcriptase inhibitor (NRTI). CL-197 has potential effect on the research of viral, oncological and cerebrovascular diseases.
  • HY-151389
    BChE-IN-14

    		Cholinesterase (ChE) Neurological Disease
    BChE-IN-14 (compound 19c) is a selective butyrylcholinesterase (BChE) inhibitor with IC50s of 0.23 and 0.011 μM for eqBChE and hBChE, respectively. BChE-IN-14 shows good blood brain barrier permeation and primary cell safety. BChE-IN-14 is able to restore cognitive impairment in vivo, it can be used for the research of Alzheimer’s disease.
  • HY-17368
    Rivastigmine

    S-Rivastigmine

    		 Cholinesterase (ChE) Neurological Disease
    Rivastigmine (S-Rivastigmine) is an orally active and potent cholinesterase (ChE) inhibitor and inhibits butyrylcholinesterase (BChE) and acetylcholinesteras (AChE) with IC50s of 0.037 μM , 4.15 μM, respectively. Rivastigmine can pass the blood brain barrier (BBB). Rivastigmine is a parasympathomimetic or cholinergic agent used for the research of mild to moderate dementia of the Alzheimer's type and dementia due to Parkinson's disease.
  • HY-150058
    Bocconoline

    		Others Neurological Disease
    Bocconoline is a potent early endosome antigen 1 (EEA1) inhibitor. Bocconoline can be isolated from Macleaya cordata. Bocconoline can be used for the research of Parkinson’s disease (PD).
  • HY-B0247
    Torsemide

    Torasemide

    		 Others Metabolic Disease Cardiovascular Disease
    Torsemide (Torasemide) is an orally active loop diuretic. Torsemide has anti-aldosterone and vasodilatory effects. Torsemide also can be used for the research of heart failure, renal disease and hepatic cirrhosis.
  • HY-148264
    HIF-2α-IN-7

    		HIF/HIF Prolyl-Hydroxylase Cancer Infection Metabolic Disease Inflammation/Immunology
    HIF-2α-IN-7 is a hypoxia inducible factor 2α (HIF-2α) inhibitor. HIF-2α-IN-7 can inhibit HIF-2α with an EC50 value of 6 nM. HIF-2α-IN-7 can be used for the research of various types of diseases including cancer, liver disease, inflammatory disease, pulmonary diseases and iron load disorders.
  • HY-120577
    BA 41899

    		Others Cardiovascular Disease
    BA 41899 is a purely calcium-sensitizing agent. BA 41899 is completely devoid of phosphodiesterase (PDE) III inhibitory activity or any other known inotropic mechanism. BA 41899 can be used for the research of cardiovascular diseases, such as congestive heart failure (CHF).
  • HY-146344
    Antiviral agent 17

    		Antibiotic Infection
    Antiviral agent 17 (Compound 4) is an anti-infection agent. Antiviral agent 17 retains its antiviral effect in a human replicon assay (EC50 = 0.015 μM). Antiviral agent 17 results in good antiviral activity against murine norovirus. Antiviral agent 17 has the potential for the research of infectious and malignant diseases.
  • HY-151952
    NLRP3-IN-12

    		NOD-like Receptor (NLR) Inflammation/Immunology
    NLRP3-IN-12 is a specific NLRP3 inflammasome inhibitor. NLRP3-IN-12 reduces the release of IL-1β by targeting the NLRP3 protein, with an IC50 of 0.45 μM. NLRP3-IN-12 can be used for the research of inflammatory bowel disease.
  • HY-149006
    CK156

    		DAPK Inflammation/Immunology Cancer
    CK156 is a highly selective death-associated protein kinase (DAPK) inhibitor with IC50s of 182 nM,34 μM, and 39 μM in the DRAK1 NanoBRET assay for DRAK1, CK2a1, and CK2a2, respectively. CK156 can be used for the research of autoimmune and inflammatory diseases.
  • HY-103308
    TRAM-39

    		Potassium Channel Neurological Disease
    TRAM-39 is a selective blocker of intermediate conductance Ca2+-activated K+ (IKCa) channels. TRAM-39 inhibits KCa3.1 channel with an IC50 value of 60 nM. TRAM-39 can be used for the research of ataxia, epilepsy, memory disorders, schizophrenia and Parkinson’s disease.
  • HY-137472
    SAR502250

    		GSK-3 Neurological Disease
    SAR502250 is a potent, selective, ATP competitive, orally active and brain-penetrant inhibitor of GSK3, with an IC50 of 12 nM for human GSK-3β. SAR502250 displays antidepressant-like activity. SAR502250 can be used for the research of Alzheimer’s disease (AD).
  • HY-134968A
    (R)-TTBK1-IN-1

    		Tau Protein Neurological Disease
    (R)-TTBK1-IN-1 is a potent, selective and brain-penetrant tau tubulin kinase 1 (TTBK1) inhibitor. (R)-TTBK1-IN-1 is an enantiomer of TTBK1-IN-1 (HY-134968). (R)-TTBK1-IN-1 can be used in the research of alzheimer’s disease and related tauopathies.
  • HY-N1428C
    Ferric citrate

    Iron(III) citrate; Zerenex

    		 Antibiotic Reactive Oxygen Species Metabolic Disease
    Ferric citrate (Iron(III) citrate), an orally active iron supplement, is an efficacious phosphate binder. Ferric citratee can be used for iron deficiency anemia and chronic kidney disease (CKD) research.
  • HY-N1179
    Tanshinone IIB

    		Apoptosis Neurological Disease Cardiovascular Disease
    Tanshinone IIB is a major active constituent of the roots of Salvia miltiorrhiza (Danshen) widely used for the research of stroke and coronary heart disease in Asian countries. Tanshinone IIB has a neuroprotective effect via inhibition of apoptosis.
  • HY-P1051
    β-Amyloid (12-28)

    Amyloid β-Protein (12-28)

    		 Amyloid-β Neurological Disease
    β-Amyloid (12-28) (Amyloid β-Protein (12-28)) is a peptide fragment of β-amyloid protein (β1-42). β1-42, a 42 amino acid protein , is the major component of senile plaque cores. β-Amyloid (12-28) shows aggregation properties. β-Amyloid (12-28) has the potential for Alzheimer’s disease research.
  • HY-12176B
    Aliskiren fumarate

    CGP 60536 fumarate; CGP60536B fumarate; SPP 100 fumarate

    		 Renin Autophagy Cancer Cardiovascular Disease
    Aliskiren fumarate is an orally active, highly potent and selective renin inhibitor, with IC50 of 1.5 nM. Aliskiren fumarate can be used for the research of hypertension, cardiovascular diseases and cancer cachexia.
  • HY-12176
    Aliskiren

    CGP 60536; CGP60536B; SPP 100

    		 Renin Autophagy Cardiovascular Disease Cancer
    Aliskiren is an orally active, highly potent and selective renin inhibitor, with IC50 of 1.5 nM. Aliskiren can be used for the research of hypertension, cardiovascular diseases and cancer cachexia.
  • HY-N3702
    Dehydroabietinol

    		Syk Inflammation/Immunology
    Dehydroabietinol is an abietane diterpenoid. Dehydroabietinol has kinase inhibition activity for spleen tyrosine kinase (SYK) with an IC50 value of 46.4 μM. Dehydroabietinol can be used for the research of immune-mediated disease.
  • HY-149243
    BChE-IN-16

    		Cholinesterase (ChE) Neurological Disease
    BChE-IN-16 (compound 87) is a highly potent BChE inhibitor with an IC50 of 3.8 nM for hBChE. BChE-IN-16 has low cytotoxicity, potential CNS permeability, unique adaptability and can be used in Alzheimer's disease (AD) research.
  • HY-142670
    Lp-PLA2-IN-5

    		Phospholipase Metabolic Disease Neurological Disease
    Lp-PLA2-IN-5 is a potent inhibitor of lipoprotein-associated phospholipase A2 (Lp-PLA2). Lp-PLA2 previously known as platelet- activating factor acetylhydrolase (PAF-AH), is a phospholipase A2 enzyme involved in hydrolysis of lipoprotein lipids or phospholipids. Lp-PLA2-IN-5 has the potential for the research of diseases associated with the activity of Lp-PLA2, for example atherosclerosis, Alzheimer's disease (extracted from patent WO2021228159A1, compound 32).
  • HY-142669
    Lp-PLA2-IN-4

    		Phospholipase Metabolic Disease Neurological Disease
    Lp-PLA2-IN-4 is a potent inhibitor of lipoprotein-associated phospholipase A2 (Lp-PLA2). Lp-PLA2 previously known as platelet- activating factor acetylhydrolase (PAF-AH), is a phospholipase A2 enzyme involved in hydrolysis of lipoprotein lipids or phospholipids. Lp-PLA2-IN-4 has the potential for the research of diseases associated with the activity of Lp-PLA2, for example atherosclerosis, Alzheimer's disease (extracted from patent WO2021228159A1, compound 38).
  • HY-148071
    Epocholeone

    		Others Others
    Epocholeone is a growth regulator. Epocholeone can control fungal or physiological diseases of crops.
  • HY-14179
    PPQ-102

    CFTR Inhibitor

    		 CFTR Others
    PPQ-102 (CFTR Inhibitor) is a reversible CFTR inhibitor that completely inhibits CFTR chloride currents (IC50 ~90 nM). PPQ-102 is not affected by membrane potential-dependent cell allocation or blocking efficiency (uncharged at physiological pH) and effectively prevents cyst enlargement in polycystic kidney disease.
  • HY-147529
    mGluR2 modulator 3

    		mGluR Neurological Disease
    mGluR2 modulator 3 (compound 1) is a potent mGluR2 positive allosteric modulator with an EC50 value of 0.87 μM. mGluR2 modulator 3 has activity in psychosis disease models such as methamphetamine-induced hyperactivity and mescaline-induced scratching in mice.
  • HY-14202
    Lazabemide hydrochloride

    Ro 19-6327 hydrochloride

    		 Monoamine Oxidase Neurological Disease
    Lazabemide hydrochloride (Ro 19-6327 hydrochloride) is a selective, reversible inhibitor of monoamine oxidase B (MAO-B) (IC50=0.03 μM) but less active for MAO-A (IC50>100 μM). Lazabemide  inhibits monoamine uptake at high concentrations, the IC50 values are 86 μM, 123 μM and >500 μM for noradrenalin, serotonin and dopamine uptake, respectively. Lazabemide can be used for the research of parkinson and alzheimer′s disease.
  • HY-14201
    Lazabemide

    Ro 19-6327

    		 Monoamine Oxidase Neurological Disease
    Lazabemide (Ro 19-6327) is a selective, reversible inhibitor of monoamine oxidase B (MAO-B) (IC50=0.03 μM) but less active for MAO-A (IC50>100 μM). Lazabemide  inhibits monoamine uptake at high concentrations, the IC50 values are 86 μM, 123 μM and >500 μM for noradrenalin, serotonin and dopamine uptake, respectively. Lazabemide can be used for the research of parkinson and alzheimer′s disease.
  • HY-116228
    Cadrofloxacin

    Caderofloxacin; CS-940

    		 Bacterial Infection
    Cadrofloxacin (Caderofloxacin; CS-940), a orally active fluoroquinolone, is effective against aerobic/anaerobic Gram-positive and Gram-negative bacteria. Cadrofloxacin can be used for the research of infectious diseases.
  • HY-151388
    hMAO-B/MB-COMT-IN-1

    		Monoamine Oxidase COMT Neurological Disease
    hMAO-B/MB-COMT-IN-1 is a dual MAO-B/MB-COMT inhibitor (IC50s: 2.5 μΜ for hMAO-B, 3.84 μΜ for MB-COMT). hMAO-B/MB-COMT-IN-1 protects cells against oxidative damage. hMAO-B/MB-COMT-IN-1 can be used in the research of neurodegeneration disease, such as Parkinson’s Disease (PD).
  • HY-151390
    hMAO-B/MB-COMT-IN-2

    		Monoamine Oxidase COMT Neurological Disease
    hMAO-B/MB-COMT-IN-2 is a dual MAO-B/MB-COMT inhibitor (IC50s: 4.27 μΜ for hMAO-B, 2.69 μΜ for MB-COMT). hMAO-B/MB-COMT-IN-2 protects cells against oxidative damage. hMAO-B/MB-COMT-IN-2 can be used in the research of neurodegeneration disease, such as Parkinson’s Disease (PD).
  • HY-153593
    BET bromodomain inhibitor 3

    		Epigenetic Reader Domain Cancer
    BET bromodomain inhibitor 3 is BET bromodomain inhibitor. BET bromodomain inhibitor 3 has inhibitory effect against BrdT with Ki value of > 40 µM. BET bromodomain inhibitor 3 can be used for the research of contraception, cancer, and heart disease.
  • HY-13733
    Procarbazine Hydrochloride

    		DNA Alkylator/Crosslinker Cancer
    Procarbazine Hydrochloride is an orally active alkylating agent, with anticancer activity. Procarbazine Hydrochloride can be used in Hodgkin's disease research.
  • HY-13733A
    Procarbazine

    		DNA Alkylator/Crosslinker Cancer
    Procarbazine is an orally active alkylating agent, with anticancer activity. Procarbazine can be used in Hodgkin's disease research.
  • HY-126362
    ML266

    		Glucosidase Others
    ML266 is glucocerebrosidase (GCase) molecule chaperone with IC50 of 2.5 µM. ML266 binds to GCase and transports of the mutant protein to the lysosome, and resume the activity of GCase. ML266 dose not inhibit the GCase enzyme’s action. ML266 has the potential for the research of gaucher disease.
  • HY-18137
    PF-04995274

    		5-HT Receptor Neurological Disease
    PF-04995274 is a potent, high-affinity, orally active and partial serotonin 4 receptor (5-HT4R) agonist. PF-04995274 has an EC50 range of 0.26-0.47 nM for human 5-HT4A/4B/4D/4E (Ki range of 0.15-0.46 nM), and has an EC50 range of 0.59-0.65 nM for rat 5-HT4S/4L/4E (Ki of 0.30 nM for rat 5-HT4S). PF-04995274 is brain penetrant and can be used for cognitive disorders associated with Alzheimer's disease.
  • HY-11044
    PF-03654746 Tosylate

    		Histamine Receptor Endocrinology Inflammation/Immunology Neurological Disease
    PF-03654746 Tosylate is a potent and selective histamine H3 receptor antagonist with high brain penetration. PF-03654746 Tosylate reduces allergen-induced nasal symptoms. PF-03654746 Tosylate has potential for treatment of human cognitive disorders, improves cognitive efficacy and disease-modifying effects in Alzheimer's disease (AD).
  • HY-117661
    SPHINX31

    		SRPK VEGFR Cancer Cardiovascular Disease
    SPHINX31 is a potent and selective SRPK1 inhibitor, with an IC50 of 5.9 nM. SPHINX31 inhibits phosphorylation of serine/arginine-rich splicing factor 1 (SRSF1). SPHINX31 also decreases the mRNA expression of pro-angiogenic VEGF-A165a isoform. SPHINX31 can be used to research neovascular eye disease.
  • HY-145428
    BT-GSI

    		Notch γ-secretase Cancer
    BT-GSI is a γ-secretase inhibitor (GSI) and a bone-targeted Notch inhibitor. BT-GSI has dual anti-myeloma and anti-resorptive properties, which can be used for the research of multiple myeloma and associated bone disease. BT-GSI inhibits tumor growth and osteolytic disease progression.
  • HY-144270
    Glucosylceramide synthase-IN-3

    		Glucosylceramide Synthase (GCS) Metabolic Disease Neurological Disease
    Glucosylceramide synthase-IN-3 (compound BZ1) is a potent, brain-penetrant and orally active glucosylceramide synthase (GCS) inhibitor with IC50s of 16 nM for human GCS.Glucosylceramide synthase-IN-3 can be used for Gaucher's disease research.
  • HY-B1487
    Procyclidine hydrochloride

    Tricyclamol hydrochloride; (±)-Procyclidine hydrochloride

    		 iGluR mAChR Neurological Disease
    Procyclidine (Tricyclamol, (±)-Procyclidine) hydrochloride , an anticholinergic agent, is a muscarinic receptor antagonist that also has the properties of an N-methyl-D-aspartate (NMDA) antagonist. Procyclidine hydrochloride can be used in studies of Parkinson's disease and related psychiatric disorders such as Soman-induced epilepsy.
  • HY-B1487A
    Procyclidine

    Tricyclamol; (±)-Procyclidine

    		 mAChR iGluR Neurological Disease
    Procyclidine (Tricyclamol; (±)-Procyclidine), an anticholinergic agent, is a muscarinic receptor antagonist that also has the properties of an N-methyl-D-aspartate (NMDA) antagonist. Procyclidine can be used in studies of Parkinson's disease and related psychiatric disorders such as Soman-induced epilepsy.
  • HY-P1051A
    β-Amyloid (12-28) (TFA)

    Amyloid β-Protein (12-28) (TFA); Amyloid Beta-Peptide (12-28) (human) TFA; β-Amyloid protein fragment(12-28) TFA

    		 Amyloid-β Neurological Disease
    β-Amyloid (12-28) (TFA) (Amyloid β-Protein (12-28) (TFA)) is a peptide fragment of β-amyloid protein (β1-42). β1-42, a 42 amino acid protein , is the major component of senile plaque cores. β-Amyloid (12-28) (TFA) shows aggregation properties. β-Amyloid (12-28) (TFA) has the potential for Alzheimer’s disease research.
  • HY-138281
    Complement factor D-IN-2

    		Complement System Inflammation/Immunology
    Complement factor D-IN-2 is an inhibitor of complement factor D extracted from patent WO2015130838A1, compound 190. Complement factor D-IN-2 targets factor D and inhibits the complement cascade at an early and essential point in the alternative complement pathway. Complement factor D-IN-2 can be used for the research of autoimmune diseases.
  • HY-144032
    Tyk2-IN-9

    		JAK Inflammation/Immunology
    Tyk2-IN-9 (Compound 26) is a selective Tyk-2 inhibitor with IC50s of 0.076 and 1.8 nM for TYK2-JH2 and JAK1-JH2, respectively. Tyk2-IN-9 can be used for the research of inflammatory or autoimmune disease.
  • HY-11017
    Rivastigmine tartrate

    ENA 713; SDZ-ENA 713

    		 Cholinesterase (ChE) Neurological Disease
    Rivastigmine tartrate (ENA 713; SDZ-ENA 713) is an orally active and potent cholinesterase (ChE) inhibitor and inhibits butyrylcholinesterase (BChE) and acetylcholinesteras (AChE) with IC50s of 0.037 μM, 4.15 μM, respectively. Rivastigmine tartrate can pass the blood brain barrier (BBB). Rivastigmine tartrate is a parasympathomimetic or cholinergic agent used for the research of mild to moderate dementia of the Alzheimer's type and dementia due to Parkinson's disease.
  • HY-146033
    HPV18-IN-1

    		HPV Cancer
    HPV18-IN-1 (Compound H1) is a potent inhibitor of HPV18. HPV18-IN-1 prevents cervical cancer cells from premature cell procession and abnormal proliferation. HPV18-IN-1 supresses E7-Rb-E2F cellular pathway and DNA methylation. HPV18-IN-1 has the potential for the research of cancer diseases.
  • HY-142779
    Lp-PLA2-IN-11

    		Phospholipase Metabolic Disease Neurological Disease
    Lp-PLA2-IN-11 is a potent inhibitor of lipoprotein-associated phospholipase A2 (Lp-PLA2). Lp-PLA2 previously known as platelet- activating factor acetylhydrolase (PAF-AH), is a phospholipase A2 enzyme involved in hydrolysis of lipoprotein lipids or phospholipids. Lp-PLA2-IN-11 has the potential for the research of diseases associated with the activity of Lp-PLA2, for example atherosclerosis, Alzheimer's disease (extracted from patent WO2014114249A1, compound E145).
  • HY-148092
    (S)-PM-43I

    		STAT Cancer Inflammation/Immunology
    (S)-PM-43I is a potent STAT6 inhibitor and can reduce STAT6 phosphorylation level. (S)-PM-43I can be used in allergic lung disease, allergic rhinitis, chronic pulmonary obstructive disease and cancer research[1].
  • HY-B1015
    Etosalamide

    Ethosalamide

    		 Others Inflammation/Immunology
    Etosalamide (Ethosalamide) is an antipyretic and analgesic agent. Etosalamide has anti-inflammatory activity and can be used for allergic disease research.
  • HY-103033
    T.cruzi-IN-1

    		Parasite Infection
    T.cruzi-IN-1 is a potent Trypanosoma cruzi inhibitor with an IC50 of 8 nM. T.cruzi-IN-1, a 4-trifluoromethyl substituted analog, has the potential for both the acute and chronic stages of Chagas disease.
  • HY-142059
    PDE5-IN-4

    		Phosphodiesterase (PDE) Metabolic Disease Cardiovascular Disease
    PDE5-IN-4 is a phosphodiesterase 5 inhibitor. PDE5-IN-4 can be used for the research of acute myocardial infarction and damage caused by reperfusion, gastrointestinal diseases, damage caused by diabetes, and liver failure.
  • HY-144324
    AChE-IN-6

    		Cholinesterase (ChE) Neurological Disease
    AChE-IN-6 (Compound 12a) is an optimal multifunctional ligand with significant inhibition of AChE (EeAChE, IC50 = 0.20 μM; HuAChE, IC50 = 37.02 nM) and anti-Aβ activity (IC50 = 1.92 μM for self-induced Aβ1-42 aggregation; IC50 = 1.80 μM for disaggregation of Aβ1-42 fibrils; IC50 = 2.18 μM for Cu2+-induced Aβ1-42 aggregation; IC50 = 1.17 μM for disaggregation of Cu2+-induced Aβ1-42 fibrils). AChE-IN-6 has the potential for the research of Alzheimer's disease.
  • HY-107901
    Pparδ agonist 1

    		PPAR Metabolic Disease Cardiovascular Disease
    Pparδ agonist 1 is a PPAR-δ agonist, with an EC50 of 5.06 nM, used in the research of PPAR-delta related diseases, such as mitochondrial diseases, muscular diseases, vascular diseases, demyelinating diseases and metabolic diseases.
  • HY-122052
    UK‑396082

    		Others Metabolic Disease
    UK‑396082 is a potent thrombin activated fibrinolytic inhibitor (TAFI) inhibitor. UK‑396082 increases plasmin activity and induces a parallel decrease in ECM levels. UK‑396082 can be used in research of chronic kidney disease (CKD).
  • HY-137122
    3-Pyridine toxoflavin

    		PIN1 Inflammation/Immunology
    3-Pyridine toxoflavin (compound 49) is a PIN1 inhibitor. 3-Pyridine toxoflavin can be used for the research of immune disease proliferative disorder.
  • HY-120274
    Balcinrenone

    AZD9977

    		 Mineralocorticoid Receptor Metabolic Disease Cardiovascular Disease
    Balcinrenone (AZD9977) is a potent, selective, and orally active mineralocorticoid receptor (MR) modulator. Balcinrenone is used for heart failure, and chronic kidney disease research.
  • HY-146035
    AChE-IN-14

    		Cholinesterase (ChE) Histamine Receptor Neurological Disease
    AChE-IN-14 (compound 5) is a potent cholinesterase inhibitor with IC50s of 0.46 , 0.48, and 0.44 μM for electric eel acetylcholinesterase (eeAChE), human recombinant acetylcholinesterase (hAChE), and equine serum butyrylcholinesterase (eqBuChE), respectively. AChE-IN-14 exhibits high affinity toward human H3 receptor (H3R; Ki= 159.8 nM). AChE-IN-14 can be used for the research of Alzheimer’s disease.
  • HY-12282
    GNE-9605

    		LRRK2 Neurological Disease
    GNE-9605 is a potent, orally active, selective Leucine-rich repeat kinase 2 (LRRK2) inhibitor with an IC50 value of 18.7 nM. GNE-9605 inhibits LRRK2 Ser1292 autophosphorylation. GNE-9605 can be used in research of Parkinson's disease (PD) .
  • HY-120970
    Bis(7)-tacrine dihydrochloride

    		Cholinesterase (ChE) GABA Receptor iGluR Neurological Disease
    Bis(7)-tacrine dihydrochloride is a dimeric AChE inhibitor derived from tacrine. Bis(7)-tacrine dihydrochloride prevents glutamate-induced neuronal apoptosis by blocking NMDA receptors. Bis(7)-tacrine dihydrochloride is a potent GABAAreceptor antagonist. Bis(7)-tacrine dihydrochloride has the potential for the research of Alzheimer's disease .
  • HY-13204B
    Biperiden lactate

    KL 373 lactate

    		 mAChR Neurological Disease
    Biperiden (KL 373) lactate is an orally active non-selective muscarinic receptor antagonist that competitively binds to M1 muscarinic receptors. Biperiden (KL 373) lactate inhibits acetylcholine and enhances dopamine signaling in the central nervous system. Biperiden (KL 373) lactate has the potential for the research of Parkinson's disease and other related psychiatric disorders.
  • HY-N10701
    AChE/BChE-IN-11

    		Cholinesterase (ChE) Neurological Disease
    AChE/BChE-IN-11 (compound 1) is a potent is a dual AChE and BChE inhibitor with IC50 values of 70 and 71 μM for AChE and BChE, respectively. AChE/BChE-IN-11 is a natural product that could be isolated from the leaf of artichoke . AChE/BChE-IN-11 can be used in research of Alzheimer’s disease (AD) research.
  • HY-144316
    ZLWH-23

    		Cholinesterase (ChE) GSK-3 Neurological Disease
    ZLWH-23 is a selective AChE inhibitor (IC50=0.27 μM) with GSK-3β inhibitory property (IC50=6.78 μM). ZLWH-23 possesses selectivity for AChE over BChE (IC50=20.82 μM) and for GSK-3β over multi-kinases. ZLWH-23 has the potential for the research of Alzheimer's disease.
  • HY-148141
    JPE-1375

    		Complement System Inflammation/Immunology
    JPE-1375 is a complement C5a receptor 1 (C5aR1) antagonist. JPE-1375 effectively inhibits polymorphonuclear leukocyte mobilization (EC50=6.9 µM) and reduces TNF levels (EC50=4.5 µM) in mice. JPE-1375 can be used in studies of autoimmune and inflammatory diseases.
  • HY-144087
    TYK2-IN-11

    		JAK Inflammation/Immunology
    TYK2-IN-11 (Compound 5B) is a selective Tyk-2 inhibitor with IC50s of 0.016 and 0.31 nM for TYK2-JH2 and JAK1-JH2, respectively. TYK2-IN-11 can be used for the research of inflammatory or autoimmune disease.
  • HY-16361A
    Omigapil maleate

    CGP3466B; CGP3446 maleate; TCH346 maleate

    		 Apoptosis Metabolic Disease Neurological Disease
    Omigapil maleate, an orally bioavailable GAPDH nitrosylation inhibitor, abrogates Aβ1-42-induced tau acetylation, memory impairment, and locomotor dysfunction in mice. Omigapil maleate has the potential for the research of Alzheimer's disease. Omigapil maleate (CGP3446B maleate) is a apoptosis inhibitor. Omigapil maleate can be used for the research of congenital muscular dystrophy (CMD).
  • HY-10563
    Sarpogrelate

    MCI-9042 free acid

    		 5-HT Receptor Infection
    Sarpogrelate (MCI-9042) is a new, specific orally active 5-HT2 receptor antagonist, Sarpogrelate increases platelet aggregation and has hemostasis effect, and can be used for the research of Buerger’s disease.
  • HY-148068
    STING agonist-20

    		STING Cancer Inflammation/Immunology
    STING agonist-20 (compound 95) is a potent STING agonist used in the synthesis of XMT-2056. STING agonist-20 can be used as a vaccine adjuvant in the study of cancer and other inflammatory, immune diseases.
  • HY-70069
    GSK256066 Trifluoroacetate

    		Phosphodiesterase (PDE) Inflammation/Immunology
    GSK256066 Trifluoroacetate is a selective and high-affinity phosphodiesterase 4 (PDE) inhibitor, with an IC50 of 3.2 pM for PDE4B. GSK256066 Trifluoroacetate is developed for the research of chronic obstructive pulmonary disease.
  • HY-114231B
    ELX-02 disulfate

    NB-124 disulfate

    		 Others Metabolic Disease
    ELX-02 disulfate (NB-124 disulfate) is an investigational, advanced synthetic eukaryotic ribosome selective glycoside (ERSG). ELX-02 disulfate is being developed as a therapy for genetic diseases caused by nonsense mutations.
  • HY-114231C
    ELX-02 sulfate

    NB-124 sulfate

    		 Others Metabolic Disease
    ELX-02 sulfate (NB-124 sulfate) is an investigational, advanced synthetic eukaryotic ribosome selective glycoside (ERSG). ELX-02 sulfate is being developed as a therapy for genetic diseases caused by nonsense mutations.
  • HY-145581
    Mitiperstat

    AZD4831

    		 Glutathione Peroxidase Cardiovascular Disease
    Mitiperstat (AZD4831) is the potent inhibitor of myeloperoxidase (MPO). Mitiperstat is particularly useful in the research of prophylaxis of cardiovascular disorders such as heart failure and coronary artery disease related conditions (extracted from patent US20160152623A1).
  • HY-151152
    AChE-IN-24

    		Cholinesterase (ChE) Neurological Disease
    AChE-IN-24 is a potent AChE inhibitor and can penetrate the BBB. AChE-IN-24 has the mighty inhibitory activity to hAChE with an IC50 value of 0.053 μM. AChE-IN-24 can be used for the research of Alzheimer s disease (AD).
  • HY-111263
    NIAD-4

    		Amyloid-β Neurological Disease
    NIAD-4 is a fluorophore for optical imaging of amyloid-β (Aβ) in the central nervous system (CNS) for Alzheimer’s disease (AD). NIAD-4 binds to the same Aβ site with the binding affinity (Ki) of 10 nM. Storage: protect from light.
  • HY-142777
    Lp-PLA2-IN-9

    		Phospholipase Neurological Disease
    Lp-PLA2-IN-9 (compound 17), a tetracyclic pyrimidinone compound, is a potent Lp-PLA2 inhibitor with a pIC50 of 10.1 for rhLp-PLA2. Lp-PLA2-IN-9 has the potential for neurodegenerative related diseases research.
  • HY-142774
    Lp-PLA2-IN-6

    		Phospholipase Neurological Disease
    Lp-PLA2-IN-6 (compound 18), a tetracyclic pyrimidinone compound, is a potent Lp-PLA2 inhibitor with a pIC50 of 10.0 for rhLp-PLA2. Lp-PLA2-IN-6 has the potential for neurodegenerative related diseases research.
  • HY-A0270
    Diphenidol

    		Others Neurological Disease
    Diphenidol is an orally active antiemetic. Diphenidol reduces abnormal neuropathic pain and TNF-α overexpression in rats following chronic compression injury. Diphenidol also has local anaesthetic activity and inhibits sodium currents. Diphenidol can be used in studies of meniere′s disease, anti-vertigo, antiemetic and analgesia.
  • HY-109001A
    (1S,2R)-Alicapistat

    (1S,2R)-ABT-957

    		 Proteasome Neurological Disease
    (1S,2R)-Alicapistat ((1S,2R)-ABT-957) is an orally active selective inhibitor of human calpains 1 and 2 for the potential application of Alzheimer's disease (AD). (1S,2R)-Alicapistat mitigates the metabolic liability of carbonyl reduction and inhibits calpain 1 with an IC50 value of 395 nM.
  • HY-12176A
    Aliskiren hydrochloride

    CGP 60536 hydrochloride; CGP60536B hydrochloride; SPP 100 hydrochloride

    		 Renin Autophagy Cancer Cardiovascular Disease
    Aliskiren (CGP 60536; CGP60536B; SPP 100) hydrochloride is an orally active and selective renin inhibitor, with IC50 of 1.5 nM. Aliskiren hydrochloride can be used for the research of hypertension, cardiovascular diseases and cancer cachexia -.
  • HY-W001601
    Budipine

    		iGluR Neurological Disease
    Budipine is an anti-parkinson agent. Budipine also is a substrate of P-glycoprotein (P-gp), is mediated the uptake into the brain by P-gp. Budipine also is N-methyl-d-aspartate (NMDA) antagonist, and has indirect dopaminergic effects through an improved dopamine release, the inhibition of monoamine oxidase type B (MAO-B). Budipine can be used for the research of CNS disorders include Parkinson disease.
  • HY-144266
    Glucosylceramide synthase-IN-1

    		Glucosylceramide Synthase (GCS) Metabolic Disease Neurological Disease
    Glucosylceramide synthase-IN-1 (T-036) a potent, brain-penetrant and orally active glucosylceramide synthase (GCS) inhibitor with IC50s of 31 nM and 51 nM for human GCS and mouse GCS, respectively. Glucosylceramide synthase-IN-1 can be used for Gaucher's disease research.
  • HY-P3761
    Ac-Tyr-Val-Lys-Asp-aldehyde

    		Caspase Others
    Ac-Tyr-Val-Lys-Asp-aldehyde is a caspase-1 inhibitor, can be used for disease research including anemia-associated to chronic diseases, chemotherapy-induced anemia and Diamond-Blackfan anemia.
  • HY-10469
    GSK256066

    		Phosphodiesterase (PDE) Inflammation/Immunology
    GSK256066 is a selective and high-affinity phosphodiesterase 4 (PDE4) inhibitor, with an IC50 of 3.2 pM for PDE4B. GSK256066 is developed for the research of chronic obstructive pulmonary disease.
  • HY-144669
    ALDH1A3-IN-2

    		Aldehyde Dehydrogenase (ALDH) Cancer
    ALDH1A3-IN-2 (Compound 15) is a potent inhibitor of ALDH1A3 with an IC50 of 1.29 μM. Aldehyde dehydrogenases (ALDHs) are overexpressed in various tumor types including prostate cancer. ALDH1A3-IN-2 has the potential for the research of cancer diseases.
  • HY-144671
    ALDH3A1-IN-2

    		Aldehyde Dehydrogenase (ALDH) Cancer
    ALDH3A1-IN-2 (Compound 19) is a potent inhibitor of ALDH3A1 with an IC50 of 1.29 μM. Aldehyde dehydrogenases (ALDHs) are overexpressed in various tumor types including prostate cancer. ALDH3A1-IN-2 has the potential for the research of cancer diseases.
  • HY-151928
    JNK3 inhibitor-3

    		JNK Neurological Disease
    JNK3 inhibitor-3 (compound 15g) is a selective, BBB permeable and orally active c-Jun N-terminal kinase 3 (JNK3) inhibitor. JNK3 inhibitor-3 has inhibitory activities to JNK1, JNK2 and JNK3 with IC50 values of 147.8, 44.0 and 4.1 nM, respectively. JNK3 inhibitor-3 significantly improves the memory in mouse dementia model. JNK3 inhibitor-3 can be used for the research of Alzheimer’s disease.
  • HY-10035
    TTA-P2

    T-Type calcium channel inhibitor

    		 Calcium Channel Neurological Disease
    TTA-P2 (T-Type calcium channel inhibitor) is a potent inhibitor of T-Type calcium channel. TTA-P2 penetrates well the CNS and blocks the native T-type currents in deep cerebellar nuclear neurons, the window current is completely abolished both for wild-type and mutant Cav3.1 channels. TTA-P2 has the potential for the research of neurology disease.
  • HY-146151
    γ-Secretase modulator 12

    		γ-secretase Amyloid-β Neurological Disease
    γ-Secretase modulator 12 (Compound 1a) is a γ-secretase modulator that can selectively decrease amyloid-β42 (Aβ42) levels (IC50 of 0.39 µM). γ-Secretase modulator 12 can be used for Alzheimer’s disease research. γ-Secretase modulator 12 has a good brain/plasma ratio (Kp, brain = 0.72) in mice.
  • HY-N10384
    AChE-IN-17

    		Cholinesterase (ChE) Neurological Disease
    AChE-IN-17 (compound 1) is a potent AChE inhibitor with an IC50 value of 28.98 μM. AChE-IN-17 can significantly prevent H2O2-induced PC12 cell death, exhibiting excellent neuroprotective effect. AChE-IN-17 can be used for researching neurodegenerative diseases (NDs).
  • HY-143438
    2-PAT

    		Monoamine Oxidase Neurological Disease
    2-PAT, an analogue of Rasagiline and Selegiline, a reversible MAO-A inhibitor with an IC50 of 0.721 µM. 2-PAT is an inactivator of MAO-B with an IC50 of 14.6 µM. 2-PAT has the potential for Parkinson’s disease and depression research.
  • HY-115910
    Y13g

    		Cholinesterase (ChE) Interleukin Related Neurological Disease
    Y13g is the potent inhibitor of both AChE and IL-6. Interleukin-6 (IL-6) and acetylcholinesterase (AChE) are two important targets implicated in progression of Alzheimer's Disease (AD). Y13g reverses the STZ-induced memory deficit, and shows histopathology similarly as in normal animals.
  • HY-124729
    BL-918

    		ULK Autophagy Neurological Disease
    BL-918 is an orally active UNC-51-like kinase 1 (ULK1) activator with an EC50 of 24.14 nM. BL-918 exerts its cytoprotective autophagic effect by targeting ULK complex. BL-918 has the potential for Parkinson’s disease (PD) treatment.
  • HY-152112
    AChE/BChE/MAO-B-IN-2

    		Monoamine Oxidase Cholinesterase (ChE) Neurological Disease
    AChE/BChE/MAO-B-IN-2 is a potent AChE, BChE, and MAO-B enzymes inhibitor with IC50 values of 48.2 nM, 83.9 nM, and 31.2 nM, respectively. AChE/BChE/MAO-B-IN-2 has significant antioxidant activity, and can be used for Parkinson’s disease research.
  • HY-B0384
    Temocapril hydrochloride

    		Angiotensin-converting Enzyme (ACE) Cardiovascular Disease
    Temocapril hydrochloride is an orally active angiotensin-converting enzyme (ACE) inhibitor. Temocapril hydrochloride can be used for the research of hypertension, congestive heart failure, acute myocardial infarction, insulin resistance, and renal diseases.
  • HY-100713
    Temocapril

    		Angiotensin-converting Enzyme (ACE) Cardiovascular Disease
    Temocapril is an orally active angiotensin-converting enzyme (ACE) inhibitor. Temocapril can be used for the research of hypertension, congestive heart failure, acute myocardial infarction, insulin resistance, and renal diseases.
  • HY-146346
    HD-TAC7

    		PROTACs HDAC Inflammation/Immunology
    HD-TAC7 is a potent PROTAC HDAC degrader with IC50 values of 3.6 μM, 4.2 μM and 1.1 μM for HDAC1, HDAC2 and HDAC3, respectively. HD-TAC7 can decreases NF-κB p65 in RAW 264.7 macrophages. HD-TAC7 can be used for the research of inflammatory diseases like asthma and chronic obstructive pulmonary disease (COPD).
  • HY-151483
    TK-129

    		Histone Demethylase Cardiovascular Disease
    TK-129 is an orally active, low-toxicity, potent KDM5B inhibitor (with high affinity; IC50=44 nM). TK-129 exerts cardioprotective effects by inhibiting KDM5B and blocking the KDM5B-associated Wnt pathway. TK-129 reduces ang II-induced activation of cardiac fibroblasts in vitro and reduces isoprenaline-induced myocardial remodelling and fibrosis in vivo. TK-129 can be used in studies of cardiovascular disease.
  • HY-110157
    AC-186

    		Estrogen Receptor/ERR Neurological Disease
    AC-186 is a selective non-steroidal estrogen receptor β (ERβ) agonist with EC50s of 6 nM and 5000 nM for ERβ and ERα, respectively. AC-186 shows gender specific neuroprotection in a Parkinson’s Disease rat model.
  • HY-150069
    UBX1325

    		Bcl-2 Family Apoptosis Metabolic Disease
    UBX1325 is an Bcl-xL inhibitor that promotes apoptosis in senescent cells. UBX1325 is a potent anti-aging agent that can be used in studies of age-related eye diseases such as diabetic macular oedema (DME), age-related macular degeneration (AMD) and diabetic retinopathy (DR).
  • HY-136584
    2,2,14,14-Tetramethyl-8-oxopentadecanedioic acid

    		Others Metabolic Disease Cardiovascular Disease
    2,2,14,14-Tetramethyl-8-oxopentadecanedioic acid is a ketone compound extracted from patent WO2002030860A2, compound example II-9. 2,2,14,14-Tetramethyl-8-oxopentadecanedioic acid can be used for the research of cardiovascular diseases, dyslipidemias, dysproteinemias, and glucose metabolism disorders.
  • HY-W193545A
    EGR240

    		Others Cancer Inflammation/Immunology
    EGR240 is a branched-chain amino acid aminotransferase 1 (BCAT1) inhibitor. EGR240 can be used for the research of cancer, rheumatoid arthritis, and bone disease.
  • HY-144373
    IL-17 modulator 6

    		Interleukin Related Inflammation/Immunology
    IL-17 modulator 6 (compound 61) is a potent Interleukin 17 (IL-17) modulator (pIC50=9.1). IL-17 modulator 6 has the ability to inhibit IL-17 and can be used for the research of inflammatory and autoimmune diseases.
  • HY-D1168
    Oil Red O

    		Fluorescent Dye Metabolic Disease
    Oil Red O is a fat-soluble diazol dye, with a maximum absorption at 518 nm. Oil Red O stains neutral lipids and cholesteryl esters but not biological membranes. Oil Red O can be used for detecting and quantifying hepatic steatosis in mouse liver biopsies. Oil Red O staining efficiently helps to visualize the radical changes that occur in tissues as metabolic disease occurs and progresses.
  • HY-116100
    (E/Z)-HA155

    		Phosphodiesterase (PDE) Cancer Inflammation/Immunology Neurological Disease
    (E/Z)-HA155 is a potent autotaxin (ATX) type I inhibitor. (E/Z)-HA155 can be used for researching cancer, fibrotic diseases, inflammation, pain and angiogenesis.
  • HY-151488
    CypD-IN-4

    		Sirtuin Cancer Metabolic Disease Neurological Disease
    CypD-IN-4 is a potent and subtype-selective cyclophilin D (CypD) inhibitor. CypD-IN-4 has CypD affinity with an IC50 value of 0.057 μM. CypD-IN-4 can be used for the research of several diseases including oxidative stress, neurodegenerative disorders, liver diseases, aging, autophagy and diabetes.
  • HY-151487
    CypD-IN-3

    		Sirtuin Cancer Metabolic Disease Neurological Disease
    CypD-IN-3 is a potent and subtype-selective cyclophilin D (CypD) inhibitor. CypD-IN-3 has CypD affinity with an IC50 value of 0.01 μM. CypD-IN-3 can be used for the research of several diseases including oxidative stress, neurodegenerative disorders, liver diseases, aging, autophagy and diabetes.
  • HY-B1365
    Prednicarbate

    		Glucocorticoid Receptor Inflammation/Immunology
    Prednicarbate is a topical corticosteroid agent. Prednicarbate can be used for the research of inflammatory skin diseases, such as atopic dermatitis.
  • HY-N3383
    Ligustroside

    Ligstroside

    		 Mitochondrial Metabolism Neurological Disease
    Ligustroside (Ligstroside), a secoiridoid derivative, has outstanding performance on mitochondrial bioenergetics in models of early Alzheimer's disease (AD) and brain ageing by mechanisms that may not interfere with Aβ production. Ligustroside significantly inhibits nitric oxide production in lipopolysaccharide-activated RAW264.7 macrophages.
  • HY-143260
    GSK-3β inhibitor 6

    		GSK-3 Cancer Metabolic Disease Inflammation/Immunology
    GSK-3β inhibitor 6 is a potent GSK-3β inhibitor with an IC50 value of 24.4 μM. GSK-3β inhibitor 6 shows high hepatocyte glucose uptake (38%). GSK-3β inhibitor 6 can be used in the research of numerous diseases like diabetes, inflammation, cancer, Alzheimer's disease, and bipolar disorder.
  • HY-115744
    Mercaptoethylguanidine (MEG) (dihydrobromide)

    		NO Synthase Inflammation/Immunology
    Mercaptoethylguanidine (MEG) dihydrobromide is selective inhibitor of the inducible nitric oxide synthase and peroxynitrite scavenger. Mercaptoethylguanidine (MEG) dihydrobromide has the potential for inflammatory bowel diseases research.
  • HY-P1206
    CH 275

    		Somatostatin Receptor Neurological Disease
    CH 275 is a peptide analog of somatostatin and binds preferably to somatostatin receptor 1 (sst1) with a Ki of 52 nM. CH 275 acts as a potent and selective sst1 agonist (IC50=30.9 nM) and also displays IC50 values of 345 nM, >1 μM, >10 μM, >10 μM for human sst3, sst4, sst2 and sst5, respectively. CH 275 can be used for the research of alzheimer’s disease.
  • HY-D0205A
    Carbocisteine

    S-(Carboxymethyl)-L-cysteine

    		 Enterovirus Infection Inflammation/Immunology
    Carbocisteine, a mucolytic agent, can be used for the research of chronic obstructive pulmonary disease (COPD).
  • HY-P3410
    Trichomide A

    		SHP2 Phosphatase Inflammation/Immunology
    Trichomide A is a potent activator of SHP2. Trichomide A is a natural cyclodepsipeptide. Trichomide A displays immunosuppressive activity against activated T lymphocyte–mediated immune responses in Con A-activated T cells. Trichomide A have the potential for the research of immune-related skin diseases.
  • HY-110237
    BX430

    		P2X Receptor Calcium Channel Cardiovascular Disease
    BX430 is a potent and selective noncompetitive allosteric human P2X4 receptor channels antagonist with an IC50 of 0.54 μM. BX430 has species specificity. BX430 is used for chronic pain and cardiovascular disease.
  • HY-12177
    Aliskiren hemifumarate

    CGP 60536 hemifumarate; CGP60536B hemifumarate; SPP 100 hemifumarate

    		 Renin Autophagy Cardiovascular Disease Cancer
    Aliskiren (CGP 60536; CGP60536B; SPP 100) hemifumarate is an orally active and selective renin inhibitor, with IC50 of 1.5 nM. Aliskiren hemifumarate can be used for the research of hypertension, cardiovascular diseases and cancer cachexia.
  • HY-146405
    nAChR antagonist 1

    		nAChR Inflammation/Immunology Neurological Disease
    nAChR antagonist 1 (compound B15) is an excellent α7 nAChR antagonist with an IC50 value of 3.3 μM. nAChR antagonist 1 can be used for researching schizophrenia, Alzheimer’s disease and inflammatory disorders.
  • HY-121765
    Dacisteine

    N,S-Diacetyl-L-cysteine

    		 Endogenous Metabolite Metabolic Disease
    Dacisteine (N,S-Diacetyl-L-cysteine) is a cysteine derivative and displays a less New Delhi metallo-beta-lactamase-1 (NDM-1) inhibitor with an IC50 value of 1000 μM. Dacisteine can be used for the treatment of cardiovascular and cerebrovascular diseases caused by platelet aggregation.
  • HY-125996
    NR1H4 activator 1

    		FXR Inflammation/Immunology
    NR1H4 activator 1 is a potent and selective Famesoid X Receptor (FXR) agonist, extracted from patent WO2018152171A1, example 4. NR1H4 activator 1 shows strong FXR agonistic potency with a EC50 value of 1 nM in a Human FXR (NR1H4) Assay. NR1H4 activator 1 has the potential for treatment of gastrointestinal disease.
  • HY-143792
    HTT-D3

    		P-glycoprotein Neurological Disease
    HTT-D3 is a potent and orally active huntingtin (HTT) splicing modulator. HTT-D3 acts by promoting the inclusion of a pseudoexon containing a premature termination codon (stop-codon psiExon), leading to HTT mRNA degradation and reduction of HTT levels. HTT-D3 reduces p-glycoprotein (P-gp) efflux, and can be uesd for Huntington's disease research.
  • HY-110279
    Ogerin

    		GPR68 Neurological Disease
    Ogerin is a selective GPR68 positive aliasing modulator (PAM) (pEC50=6.83) with a moderate antagonistic effect on A2A (Ki=220 nM). Ogerin inhibits the fear conditioning reflex in mice and also inhibits TGF-β-induced myofibroblast differentiation of fibroblasts from multiple organ systems. Ogerin can be used in the studies of fibrotic diseases and neurological disorders.
  • HY-B0520A
    Benztropine mesylate

    Benzatropine mesylate; Benzotropine mesylate; Benztropine methanesulfonate

    		 Dopamine Receptor mAChR Histamine Receptor Cancer Neurological Disease
    Benztropine mesylate (Benzatropine mesylate) is an orally active centrally acting anticholinergic agent that can be used for Parkinson's disease research. Benztropine mesylate is an anti-histamine agent and a dopamine re-uptake inhibitor. Benztropine mesylate is also a human D2 dopamine receptor allosteric antagonist. Benztropine mesylate also has anti-CSCs (cancer stem cells) effects.
  • HY-117516
    SR10067

    		REV-ERB Metabolic Disease Neurological Disease
    SR10067 is a potent, selective and brain penetrant REV-ERB agonist. SR10067 has high affinity for Rev-Erbβ and Rev-Erbα with IC50 values of 160 nM and 170 nM, respectively. SR10067 can be used for the research of metabolic diseases and neuropsychiatric disorders.
  • HY-147720A
    γ-Secretase modulator 11 hydrochloride

    		γ-secretase Neurological Disease
    γ-Secretase modulator 11 hydrochloride (compound 1o) is a potent and orally active γ-secretase modulator with an IC50 of 0.029 µM. γ-Secretase modulator 11 hydrochloride induces a robust reduction in brain Aβ42 levels. γ-Secretase modulator 11 hydrochloride rescues cognitive deficits exhibited by AD model mice. γ-Secretase modulator 11 hydrochloride has the potential for the research of alzheimer's disease.
  • HY-131036
    MAO-IN-M30 dihydrochloride

    		Monoamine Oxidase Neurological Disease
    MAO-IN-M30 dihydrochloride is an orally active, brain-permeable, and brain selective irreversible MAO-A (IC50=37 nM) and MAO-B (IC50=57 nM) inhibitor. MAO-IN-M30 dihydrochloride is a potent iron chelator and radical scavenger. MAO-IN-M30 dihydrochloride has a neuroprotective effect against Dexamethasone-induced brain cell apoptosis. MAO-IN-M30 dihydrochloride also exhibits neurorestorative activity in post MPTP and lactacystin models of Parkinson's disease.
  • HY-113489
    14,15-Epoxyeicosatrienoic acid

    14,15-EET

    		 Others Neurological Disease Cardiovascular Disease
    14,15-Epoxyeicosatrienoic acid (14,15-EET) is a metabolite of Arachidonic acid (HY-109590). 14,15-Epoxyeicosatrienoic acid is a potent inhibitor of in vivo platelet aggregation. 14,15-Epoxyeicosatrienoic acid facilitates astrocytic Aβ clearance. 14,15-Epoxyeicosatrienoic acid can be used for Alzheimer's Disease research.
  • HY-44809
    Izilendustat

    		HIF/HIF Prolyl-Hydroxylase Inflammation/Immunology Cardiovascular Disease
    Izilendustat is a potent inhibitor of prolyl hydroxylase which can stabilize hypoxia inducible factor- 1 alpha (HIF- lα) and hypoxia inducible factor-2 (HIF-2). Izilendustat has the potential for researching diseases that relate to the body’s inmmune response like colitis and other inflammatory bowel diseases (extracted from patent WO2011057115A1 and WO2011057121A1).
  • HY-137451A
    (E/Z)-Sivopixant

    (E/Z)-S-600918

    		 P2X Receptor Inflammation/Immunology
    (E/Z)-Sivopixant ((E/Z)-S-600918) is a potent P2X3 receptor antagonist with an IC50 of 4 nM. (E/Z)-Sivopixant can be used for respiratory diseases research.
  • HY-143726
    RIPK1-IN-8

    		RIP kinase Inflammation/Immunology
    RIPK1-IN-8 (example 16), an aminoimidazopyridine, is a potent and selective RIPK1 inhibitor with an IC50 of 4 nM. RIPK1-IN-8 has the potential for inflammatory diseases research.
  • HY-18679
    TC-N 22A

    		mGluR Neurological Disease
    TC-N 22A is a potent, selective, orally active and brain-permeable mGlu4 PAM with an EC50 of 9 nM in human mGlu4-expressing BHK cells. TC-N 22A is less active (EC50>10 μM) in agonist and PAM model at mGlu 1, 2, 3, 5, and 7 receptors. TC-N 22A has the potential for research of CNS disease in vivo.
  • HY-144031S
    Tyk2-IN-8

    		JAK Inflammation/Immunology
    Tyk2-IN-8 is a selective Tyk-2 inhibitor with an IC50 of 5.7 nM for TYK2-JH2. Tyk2-IN-8 inhibits JAK1-JH1 with IC50 of 3.0 nM. Tyk2-IN-8 can be used for the research of autoimmune disease[1].
  • HY-120947
    AV-105

    		Others Neurological Disease
    AV-105 is a Florbetapir ( 18F)-radiolabeled slyrylpyridine tosylate precursor extracted from patent WO2010078370A1, example 1.5. AV-105 can synthesize 18F-radiolabeled compounds, which are used for positron emission tomography (PET) imaging of neurodegenerative diseases of the brain.
  • HY-N10317
    Toddacoumalone

    		Phosphodiesterase (PDE) Inflammation/Immunology
    Toddacoumalone is a natural inhibitor of phosphodiesterase 4 (PDE4) with moderate potency and imperfect agent-like properties. Toddacoumalone has the potential for the research of inflammatory diseases such as psoriasis.
  • HY-16640
    TCJL37

    		JAK Inflammation/Immunology
    TCJL37 is a potent, selective, and orally bioavailable TYK2 inhibitor with a Ki of 1.6 nM. TCJL37 can be used for the research of inflammatory bowel diseases (IBD).
  • HY-111262
    ABT-384

    		11β-HSD Metabolic Disease Neurological Disease
    ABT-384 is a potent, selective 11-β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) inhibitor. ABT-384 exhibits high affinity (Ki 0.1-2.7 nM) against rodent, monkey, and human 11β-HSD1. ABT-384 blocks regeneration of active cortisol. ABT-384 can be used for the research of Alzheimer’s disease (AD).
  • HY-W281862
    Sequifenadine

    		Histamine Receptor Inflammation/Immunology
    Sequifenadine is a H1-antihistamine. Sequifenadine has the potential for the research of inflammatory eye disease with allergic symptoms.
  • HY-107676
    SIB-1553A

    		nAChR Neurological Disease
    SIB-1553A is an orally bioavailable nicotinic acetylcholine receptors (nAChRs) agonist, with selectivity for β4 subunit-containing nAChRs. SIB-1553A is also a selective neuronal nAChR ligand. SIB-1553A is a cognitive enhancer, and has therapeutic potential for the symptomatic treatment of Alzheimer’s disease and other cognitive disorders.
  • HY-B0202A
    Irbesartan hydrochloride

    SR-47436 hydrochloride; BMS-186295 hydrochloride

    		 Angiotensin Receptor Apoptosis Metabolic Disease Neurological Disease
    Irbesartan (SR-47436) hydrochloride is an orally active Ang II type 1 (AT1) receptor blocker (ARB). Irbesartan hydrochloride can relax the blood vessels, low blood pressure and increase the supply of blood and oxygen to the heart. Irbesartan hydrochloride can be used for the research of high blood pressure, heart failure, and diabetic kidney disease.
  • HY-115986
    MAO-B-IN-5

    		Monoamine Oxidase Neurological Disease
    MAO-B-IN-5 is a potent, selective and orally active MAO-B inhibitor with an IC50 of 0.204 µM. MAO-B-IN-5 has the potential for the research of Parkinson's disease (PD).
  • HY-148096
    STAT6-IN-1

    		STAT Cancer Inflammation/Immunology
    STAT6-IN-1 (compound 19a) is a STAT6 inhibitor with a high affinity for the SH2 domain of STAT6 (IC50=0.028 µM). STAT6-IN-1 can be used in studies of allergic lung disease, allergic rhinitis, chronic obstructive pulmonary disease or cancer.
  • HY-145919
    hGPR91 antagonist 3

    		Others Inflammation/Immunology Cardiovascular Disease
    hGPR91 antagonist 3 (Compound 5g) is a potent, selective, and orally active antagonist of hGPR91 (%F: 26). hGPR91 antagonist 3 has the potential for the research of hypertension, autoimmune disease and retinal angiogenesis.
  • HY-124751
    YTX-465

    		Stearoyl-CoA Desaturase (SCD) Neurological Disease
    YTX-465 is a stearoyl-CoA desaturase (Ole1/SCD) inhibitor. YTX-465 inhibits Ole1 and SCD1 with IC50s of 0.039 μM and 30.4 μM, respectively. YTX-465 can be used in the research of Parkinson’s disease and other synucleinopathies.
  • HY-139308
    T0467

    		Mitochondrial Metabolism Neurological Disease
    T0467 activates parkin mitochondrial translocation in a PINK1-dependent manner in vitro. T0467 do not induce mitochondrial accumulation of PINK1in dopaminergic neurons. T0467 is a potential compound for PINK1-Parkin signaling activation, and can be used for parkinson's disease and related disorders research.
  • HY-147565
    ATR-IN-13

    		ATM/ATR Cancer
    ATR-IN-13 (compound A9) is a potent ATR kinase inhibitor, with an IC50 of 2 nM. ATR-IN-13 can be used for ATR kinase mediated diseases research, such as proliferative diseases and cancer.
  • HY-110125
    ML-193

    CID 1261822

    		 GPR55 Neurological Disease
    ML-193 (CID 1261822) is a potent and selective antagonist of GPR55, with an IC50 of 221 nM. ML-193 shows more than 27-fold selectivity for GPR55 over GPR35, CB1 and CB2. ML-193 can improve the motor and the sensorimotor deficits of Parkinson’s disease (PD) rats.
  • HY-116815
    Lalistat 1

    		Bacterial Infection Neurological Disease
    Lalistat 1 is a potent, selective, and competitive inhibitor of lysosomal acid lipase (LAL) and against purified human LAL (phLAL) with an IC50 of 68 nM. Lalistat 1 is a inhibitor of immunoglobulin A1 protease (IgA1P) proteases for H. influenzae, has less effects on other serine hydrolases (trypsin or β-lactamase, etc.). Lalistat 1 can be used for the research of niemann-pick type C (NPC) disease.
  • HY-F0004
    β-Nicotinamide mononucleotide

    β-NM; NMN

    		 Endogenous Metabolite Cancer Neurological Disease
    β-nicotinamide mononucleotide (β-NM) is a product of the nicotinamide phosphoribosyltransferase (NAMPT) reaction and a key NAD + intermediate. The pharmacological activities of β-nicotinamide mononucleotide include its role in cellular biochemical functions, cardioprotection, diabetes, Alzheimer's disease, and complications associated with obesity.
  • HY-145430
    IL-17A modulator-1

    		Interleukin Related Cancer Inflammation/Immunology Neurological Disease
    IL-17A modulator-1 is a IL-17A modulator, extracted from patent WO2021239743+A1, example 9. IL-17A modulator-1 inhibits the biological action of IL-17A with a pIC50 of 8.2. IL-17A modulator-1 can be used for the research of diseases or disorders associated with modulation of IL-17A activity including diseases with an immune component or autoimmune pathol, cancer and neurodegenerative disorders.
  • HY-105321
    PBT 1033

    PBT 2

    		 Bacterial Neurological Disease
    PBT 1033 (PBT 2) is an orally active copper/zinc ionophore. PBT 1033 restores cognition in mouse models of Alzheimer's disease (AD). PB 1033 also has antibacterial activity against Gram-positive bacteria.
  • HY-149235
    PI3Kδ-IN-12

    		PI3K Inflammation/Immunology
    PI3Kδ-IN-12 (compound 13) is a PI3Kδ inhibitor (pIC50 = 5.8), with pKi values of 8.0/6.5/6.4/6.7 for PI3Kδ/γ/β/α, respectively. PI3Kδ-IN-12 can be used in the study of chronic respiratory diseases such as asthma and chronic obstructive pulmonary disease (COPD).
  • HY-150503
    KH-259

    		HDAC Neurological Disease
    KH-259 (compound 1) is a potent, selective and CNS-penetrant HDAC6 inhibitor, with an IC50 of 0.26 μM. KH-259 has antidepressant effects in mice through the inhibition of HDAC6 in the brain. KH-259 can be used for neurodegenerative diseases research.
  • HY-152110
    AChE/MAO-IN-2

    		Cholinesterase (ChE) Monoamine Oxidase Neurological Disease
    Dual AChE-MAO B-IN-5, indanone derivative, is a potent dual AChE/MAO-B inhibitior with IC50 values of 0.0224, 0.0412, and 0.1116 μM for AChE, MAO-B and MAO-A, respectively. Dual AChE-MAO B-IN-5 has antioxidant activity and prevents β-amyloid plaque aggregation. Dual AChE-MAO B-IN-5 can be used for Alzheimer’s disease (AD) research.
  • HY-107736
    AI-3

    		Others Cancer Inflammation/Immunology
    AI-3 is a potent ARE (antioxidant response element) activator. AI-3 increases the NQO1 at the transcript levels and protein expression levels. AI-3 has the potential for the research of oxidative stress related diseases.
  • HY-144790
    AChE-IN-12

    		Amyloid-β Cholinesterase (ChE) Monoamine Oxidase Neurological Disease
    AChE-IN-12 is a potent and blood-brain barrier (BBB) penetrant acetylcholinesterase (AChE) with IC50s of 0.41 μM and 1.88 μM for rat AChE and electric eel AChE. AChE-IN-12 is also a good antioxidant (ORAC = 3.3 eq), selective metal chelator and huMAO-B inhibitor (IC50 = 8.8 µM). AChE-IN-12 has remarkable inhibition of self- and Cu 2+-induced Aβ1-42 aggregation, as well as exhibits a good neuroprotective effect. AChE-IN-12 can be used for researching Alzheimer’s disease.
  • HY-N6625
    Chlorothalonil

    		Fungal Infection
    Chlorothalonil is a broad spectrum fungicide and is effective in protecting plants against fungal diseases caused mainly by Phytophthora infestans and Alternaria solani. Chlorothalonil is used for controlling of fungal foliar diseases of vegetables and crops.
  • HY-152227
    PROTAC TYK2 degradation agent1

    		PROTACs JAK Inflammation/Immunology
    PROTAC TYK2 degradation agent1 is a potent and subtype-selective TYK2 degrader. PROTAC TYK2 degradation agent1 has TYK2 degradation activity with DC50 value of 14 nM. PROTAC TYK2 degradation agent1 can be used for the research of autoimmune disease.
  • HY-122605
    TRPM4-IN-1

    CBA

    		 TRP Channel Cancer Cardiovascular Disease
    TRPM4-IN-1 (CBA) is a potent and selective inhibitor of the cation channel TRPM4, with an IC50 of 1.5 μM. TRPM4-IN-1 can be used for the research of cardiac diseases and prostate cancer.
  • HY-13995A
    Sevelamer hydrochloride

    		FXR Autophagy Others
    Sevelamer hydrochloride is an orally active and phosphate binding agent used for research of hyperphosphatemia with chronic kidney disease. Sevelamer hydrochloride consists of polyallylamine that is crosslinked with epichlorohydrin.
  • HY-145373
    BMS-986143

    		Btk Inflammation/Immunology
    BMS-986143 is an orally active, reversible BTK inhibitor with an IC50 of 0.26 nM. BMS-986143 also inhibits TEC, BLK, BMX, TXK FGR, YES1, ITK with IC50s of 3 nM, 5 nM, 7 nM, 10 nM, 15 nM,19 nM, 21 nM, respectively. BMS-986143 can be used for the research of autoimmune diseases.
  • HY-107447
    N-Deshydroxyethyl Dasatinib

    N-Deshydroxyethyl BMS-354825

    		 Drug Metabolite Cancer Inflammation/Immunology
    N-Deshydroxyethyl Dasatinib (N-Deshydroxyethyl BMS-354825) is a metabolite of Dasatinib, Dasatinib is a multi-kinase inhibitor that potently inhibits Bcr-Abl, Src family and platelet-derived growth factor receptor kinases. N-Deshydroxyethyl Dasatinib can be used in cancer and immune disease research.
  • HY-139973
    OAB-14

    		Amyloid-β Neurological Disease
    OAB-14, is a Bexarotene (HY-14171) derivative, improves Alzheimer's disease-related pathologies and cognitive impairments by increasing β-amyloid clearance in APP/PS1 mice. OAB-14 effectively ameliorates the dysfunction of the endosomal-autophagic-lysosomal pathway in APP/PS1 transgenic mice.
  • HY-122080
    Memoquin

    		Cholinesterase (ChE) Beta-secretase Amyloid-β Neurological Disease
    Memoquin is an anti-amyloid and anti-oxidant multi-target-directed ligand. Memoquin is an orally active inhibitor of BACE-1 and AChE with IC50 values of 108 and 1.55 nM, respectively. Memoquin is a cognitive enhancer that prevents the Aβ-induced neurotoxicity mediated by oxidative stress. Memoquin can be used for the research of Alzheimer’s disease (AD).
  • HY-148867
    UCM-1306

    2-(Fluoromethoxy)-4'-(S-methylsulfonimidoyl)-1,1'-biphenyl

    		 Dopamine Receptor Neurological Disease
    UCM-1306 is a potent and orally active human dopamine D1 receptor allosteric modulator (PAM). UCM-1306 increases the endogenous dopamine (DA) maximal effect both in human and mouse D1 receptors. UCM-1306 is not only for improving motor symptoms but also for addressing the key comorbid cognitive impairment associated with long-term Parkinson’s disease (PD).
  • HY-143261
    GSK-3β inhibitor 7

    		GSK-3 Cancer Metabolic Disease Inflammation/Immunology
    GSK-3β inhibitor 7 is a GSK-3β inhibitor with an IC50 value of 5.25 μM. GSK-3β inhibitor 7 is inserted into the ATP-binding binding pocket of GSK-3β and forms hydrogen-bond. GSK-3β inhibitor 7 shows high hepatocyte glucose uptake (83.5%), and can be used in the research of numerous diseases like diabetes, inflammation, cancer, Alzheimer's disease, and bipolar disorder.
  • HY-32340
    Lexacalcitol

    KH1060

    		 VD/VDR Cancer Inflammation/Immunology
    Lexacalcitol (KH1060), a vitamin D analog, is a potent regulator of cell growth and immune responses. Lexacalcitol can be used for the research of graft rejection, psoriasis, cancer and auto-immune diseases.
  • HY-139607
    SSAO inhibitor-1

    		Monoamine Oxidase Inflammation/Immunology
    SSAO inhibitor-1 is a semicarbazide-sensitive amine oxidase (SSAO) inhibitor. SSAO inhibitor-1 has anti-inflammatory activity and can be used for liver diseases research.
  • HY-116016
    Etilevodopa

    L-DOPA ethyl ester; Levodopa ethyl ester

    		 Dopamine Receptor Drug Metabolite Neurological Disease
    Etilevodopa (L-Dopa ethyl ester), an ethyl-ester proagent of Levodopa, is rapidly hydrolyzed to Levodopa and ethanol by nonspecific esterases in the gastrointestinal tract. Etilevodopa is used for the treatment of Parkinson disease (PD). Levodopa is the direct precursor of dopamine and is a suitable proagent as it facilitates CNS penetration and delivers dopamine.
  • HY-116016A
    Etilevodopa hydrochloride

    L-DOPA ethyl ester hydrochloride; Levodopa ethyl ester hydrochloride

    		 Dopamine Receptor Drug Metabolite Neurological Disease
    Etilevodopa (L-Dopa ethyl ester) hydrochloride, an ethyl-ester proagent of Levodopa, is rapidly hydrolyzed to Levodopa and ethanol by nonspecific esterases in the gastrointestinal tract. Etilevodopa hydrochloride is used for the treatment of Parkinson disease (PD). Levodopa is the direct precursor of dopamine and is a suitable proagent as it facilitates CNS penetration and delivers dopamine.
  • HY-N2908
    Atraric acid

    Methyl atrarate

    		 Androgen Receptor NO Synthase p38 MAPK NF-κB Cancer Inflammation/Immunology
    Atraric acid (Methyl atrarate) is a specific androgen receptor (AR) antagonist with anti-inflammatory and anticancer effects. Atraric acid represses the expression of the endogenous prostate specific antigen gene in both LNCaP and C4-2 cells. Atraric acid can also inhibit the synthesis of NO and cytokine, and suppress the MAPK-NFκB signaling pathway. Atraric acid can be used to research prostate diseases and inflammatory diseases.
  • HY-144446
    BuChE-IN-1

    		Cholinesterase (ChE) Neurological Disease
    BuChE-IN-1 (Compound 23) is a potent inhibitor of butyrylcholinesterase (BuChE). Butyrylcholinesterase (BuChE) is recently regarded as a biomarker in progressed Alzheimer’s disease (AD). BuChE-IN-1 shows low cytotoxicity and high blood brain barrier (BBB) permeability. BuChE-IN-1 is a promising BuChE inhibitor for the research of AD.
  • HY-139727
    S(-)-Bisoprolol

    		Adrenergic Receptor Cardiovascular Disease
    S(-)-Bisoprolol is a S(-)-enantiomer of Bisoprolol. Bisoprolol is a potent, selective and orally active β1-adrenergic receptor blocker. Bisoprolol has little activity on β2-receptor and has the potential for hypertension, coronary artery disease and stable ventricular dysfunction research.
  • HY-148795
    Ritivixibat

    		Apical Sodium-Dependent Bile Acid Transporter Metabolic Disease Cardiovascular Disease
    Ritivixibat is an inhibitor of ileal bile acid transporter (IBAT), as well as a bile acid modulator. Ritivixibat can be used for research of cardiovascular diseases, fatty acid metabolism and glucose utilization disorders, gastrointestinal diseases and liver diseases.
  • HY-151259
    TK4b

    		JAK Cancer
    TK4b is a Janus kinase (JAK) inhibitor with the IC50 values of 19.40 nM and 18.42 nM for JAK2 and JAK3, respectively. TK4b can be used in lymphoid-derived diseases and leukemia cancer research.
  • HY-151258
    TK4g

    		JAK Cancer
    TK4g is a Janus kinase (JAK) inhibitor with the IC50 values of 12.61 nM and 15.80 nM for JAK2 and JAK3, respectively. TK4g can be used in lymphoid-derived diseases and leukemia cancer research.
  • HY-B2089
    Cinitapride

    		Histamine Receptor Dopamine Receptor Metabolic Disease
    Cinitapride is an orally active 5-HT4 agonist and D2 antagonist. Cinitapride shows gastroprotective properties on mucosal injury. Cinitapride can be used in functional dyspepsia (FD) and gastroesophageal reflux disease (GERD) research.
  • HY-145150
    TRPC5-IN-1

    		TRP Channel Metabolic Disease
    TRPC5-IN-1 (Compound 6j) is a selective TRPC5 inhibitor with 50.5 % Inhibition for TRPC5 at 3 μM. TRPC5-IN-1 can be used for the research of chronic kidney disease (CKD).
  • HY-B1779
    Sucrose

    D-(+)-Saccharose

    		 Endogenous Metabolite Metabolic Disease Cancer
    Sucrose (D-(+)-Saccharose) is a disaccharide which is composed of two monosaccharides, glucose and fructose. Sucrose can be applied in some animal models, including metabolic disease, obesity, diet on preference, and diabetes, et al.
  • HY-113074
    Glycolithocholic acid 3-sulfate

    Glycolithocholate sulfate; Sulfolithocholylglycine; SLCG

    		 HIV Endogenous Metabolite Infection Inflammation/Immunology
    Glycolithocholic acid 3-sulfate (SLCG) is a cholic acid derivative and a metabolite of glycolithocholic acid. Glycolithocholic acid 3-sulfate inhibits replication of HIV-1 in vitro. Glycolithocholic acid 3-sulfate can be used for the research of HIV infection and gallbladder disease.
  • HY-12336
    NIBR189

    		EBI2/GPR183 Inflammation/Immunology
    NIBR189 is an EBI2 (Epstein-Barr virus-induced gene 2) antagonist. NIBR189 inhibits human and mouse EBI2 with IC50s of 11 and 16 nM, respectively. NIBR189 can be used for the research of autoimmune diseases.
  • HY-N3963
    Gomisin M2

    (+)-Gomisin M2

    		 HIV Cancer Infection Inflammation/Immunology Neurological Disease
    Gomisin M2 ((+)-Gomisin M2) is a lignan isolated from the fruits of Schisandra rubriflora with anti-HIV activity (EC50 of 2.4 μM). Gomisin M2 exhibits anti-cancer and anti-allergic activities and has the potential for Alzheimer’s disease research.
  • HY-P99238
    Rolinsatamab

    		Interleukin Related Cancer Inflammation/Immunology
    Rolinsatamab is a potent dual IL-4 and IL-13 inhibitor as a fully humanized bispecific monoclonal antibody. Rolinsatamab chimeric antigen receptor sequence T cell. Rolinsatamab can be used in research of immune disease.
  • HY-136561
    GRK5-IN-2

    		G Protein-coupled Receptor Kinase (GRK) Metabolic Disease
    GRK5-IN-2 (compound 707), a pyridine-based bicyclic compound, is a potent G-protein-coupled receptor kinase 5 (GRK5) inhibitor. GRK5-IN-2 regulates the expression and/or release of insulin and is useful for the metabolic disease research.
  • HY-151368
    AChE/BChE-IN-10

    		Cholinesterase (ChE) Neurological Disease
    AChE/BChE-IN-10 (Compound 7b) is a potent dual AChE and BChE inhibitor with IC50 values of 0.176, and 0.47 μM, respectively. AChE/BChE-IN-10 shows good blood brain barrier permeability. AChE/BChE-IN-10 can inhibit Aβ-aggregation and be used in Alzheimer’s disease (AD) research.
  • HY-145831
    sEH/AChE-IN-1

    		Cholinesterase (ChE) Inflammation/Immunology Neurological Disease
    sEH/AChE-IN-1 (Compound 12a) is a dual inhibitor of the enzymes soluble epoxide hydrolase (sEH) and acetylcholinesterase (AChE). sEH/AChE-IN-1 provides cumulative effects against neuroinflammation and memory impairment. sEH/AChE-IN-1 has the potential for the research of Alzheimer's disease (AD).
  • HY-150563
    Neuroinflammatory-IN-2

    		Monoamine Oxidase Amyloid-β Inflammation/Immunology Neurological Disease
    Neuroinflammatory-IN-2 is a potent anti-neuroinflammatory agent with an IC50 value of 10.30 μM for MAO-B, and 96.33% inhibition of Aβ1-42 aggregation at 25 μM. Neuroinflammatory-IN-2 has neuroprotective activity in H2O2-induced PC-12 cell injury. Neuroinflammatory-IN-2 also has biometal chelating abilities, antioxidant activity, anti-neuroinflammatory activity and appropriate BBB permeability. Neuroinflammatory-IN-2 can be used for researching Alzheimer’s disease.
  • HY-130437
    p-nitro-Pifithrin-α

    		MDM-2/p53 TGF-β Receptor Caspase Infection Metabolic Disease
    p-nitro-Pifithrin-α, a cell-permeable analog of pifithrin-α, is a potent p53 inhibitor. p-nitro-Pifithrin-α suppresses p53-mediated TGF-β1 expression in HK-2 cells. p-nitro-Pifithrin-α inhibits the activation of caspase-3 by Zika virus (ZIKV) strains. p-nitro-Pifithrin-α attenuates steatosis and liver injury in mice fed a high-fat diet [4]. non-alcoholic fatty liver disease.
  • HY-124476
    Cystamine

    		Caspase Glutaminase Apoptosis Cancer
    Cystamine is the disulfide form of the free thiol, cysteamine. Cystamine is an orally active transglutaminase (Tgase) inhibitor. Cystamine also has inhibition activity for caspase-3 with an IC50 value of 23.6 μM. Cystamine can be used for the research of severals diseases including Huntington's disease (HD) .
  • HY-132303
    MK-8262

    		CETP Metabolic Disease Cardiovascular Disease
    MK-8262 is an orally active and potent cholesteryl ester transfer protein (CETP) inhibitor with an IC50 of 53 nM and a log D of 5.3. MK-8262, a bistrifluoromethyl analogue, has the potential for coronary heart disease (CHD) correlated high-density lipoprotein (HDL) and low-density lipoprotein (LDL) research.
  • HY-146727
    JAK3-IN-11

    		JAK Inflammation/Immunology
    JAK3-IN-11 (Compound 12), a potent, noncytotoxic, irreversible, orally active JAK3 inhibitor with IC50 value of 1.7 nM, has excellent selectivity (>588-fold compared to other JAK isoforms), covalently bind to the ATP-binding pocket in JAK3. JAK3-IN-11 strongly inhibits JAK3-dependent signaling and T cell proliferation, is a promising tool for study autoimmune diseases.
  • HY-125016
    TT-10

    TAZ-K

    		 YAP Cardiovascular Disease
    TT-10 (TAZ-K) is an activator of YES-associated protein (YAP)-transcriptional enhancer factor domain (TEAD) activity. TT-10 can be used for the research of heart diseases accompanied by cardiomyocyte loss.
  • HY-12820
    Sibofimloc

    Antibiotic-202

    		 Bacterial Antibiotic Infection
    Sibofimloc (Antibiotic-202) is a first-in-class, gut-restricted, orally active FimH adhesion inhibitor extracted from patent WO2014100158A1, Compound Example 202. Sibofimloc has anti-bacterial infective activity. Sibofimloc is developed for inflammatory bowel disease (IBD).
  • HY-139727A
    S(-)-Bisoprolol fumarate

    		Adrenergic Receptor Cardiovascular Disease
    S(-)-Bisoprolol fumarate is a S(-)-enantiomer of Bisoprolol fumarate. Bisoprolol fumarate is a potent, selective and orally active β1-adrenergic receptor blocker. Bisoprolol has little activity on β2-receptor and has the potential for hypertension, coronary artery disease and stable ventricular dysfunction research.
  • HY-103234
    GYKI 52466

    		iGluR Neurological Disease
    GYKI 52466 is an orally active, highly selective and noncompetitive AMPA/kainate receptor antagonist with the IC50 values of 7.5 and 11μM, respectively. GYKI 52466 has good blood brain barrier permeability and anticonvulsant effect. GYKI 52466 can be used in Parkinson's disease research.
  • HY-103234A
    GYKI 52466 dihydrochloride

    		iGluR Neurological Disease
    GYKI 52466 dihydrochloride is an orally active, highly selective and noncompetitive AMPA/kainate receptor antagonist with the IC50 values of 7.5 and 11μM, respectively. GYKI 52466 dihydrochloride has good blood brain barrier permeability and anticonvulsant effect. GYKI 52466 dihydrochloride can be used in Parkinson's disease research.
  • HY-145832
    sEH/AChE-IN-2

    		Cholinesterase (ChE) Inflammation/Immunology Neurological Disease
    sEH/AChE-IN-2 (Compound 12b) is a dual inhibitor of the enzymes soluble epoxide hydrolase (sEH) and acetylcholinesterase (AChE). sEH/AChE-IN-2 provides cumulative effects against neuroinflammation and memory impairment. sEH/AChE-IN-2 has the potential for the research of Alzheimer's disease (AD).
  • HY-147859
    BChE-IN-8

    		Amyloid-β Neurological Disease
    BChE-IN-8 (compound 20) is an orally active, potent and BBB-penetrated BChE (butyrylcholinesterase) inhibitor, with IC50 values of 0.15 nM (eqBChE, equine serum BChE) and 45.2 nM (hBChE), respectively. High stability of BChE-IN-8 contributes to significantly improved blood concentration and tissue exposure. BChE-IN-8 can exert neuro-protecting and cognition improving properties through multiple modulations, including cholinergic system, Aβ aggregation, neuropeptide levels. BChE-IN-8 can be used for Alzheimer's disease (AD) research.
  • HY-B0731A
    Perospirone

    SM-9018 free base

    		 5-HT Receptor Dopamine Receptor Neurological Disease
    Perospirone (SM-9018 free base) is an orally active antagonist of 5-HT2A receptor (Ki=0.6 nM) and dopamine D2 receptor (Ki=1.4 nM), and also a partial agonist of 5-HT1A receptor (Ki=2.9 nM). Perospirone is an atypical antipsychotic agent and has the potential for schizophrenic disease research.
  • HY-130452
    NOS1-IN-1

    		NO Synthase Neurological Disease
    NOS1-IN-1 is a selective and cell-permeable nNOS inhibitor with a Ki of 120 nM. NOS1-IN-1 exhibits 2617-fold and 325-fold selectivity over eNOS (Ki=39 μM) and iNOS (Ki=325 μM) , respectively. NOS1-IN-1 can be used for the research of neurological disease, including cerebral palsy (CP).
  • HY-115497
    BRD5529

    		E1/E2/E3 Enzyme Infection Inflammation/Immunology
    BRD5529 is an effective dose-dependent CARD9-TRIM62 protein–protein interaction (PPI) inhibitor with an IC50 value of 8.6 μM. BRD5529 has potency and complete inhibition of CARD9 ubiquitinylation in vitro, also has favorable solubility. BRD5529 can be used for the research of inflammatory bowel disease (IBD) such as Crohn’s disease (CD) and ulcerative colitis (UC).
  • HY-15178
    Oglemilast

    GRC 3886

    		 Phosphodiesterase (PDE) Inflammation/Immunology
    Oglemilast (GRC 3886) is a potent and orally active phosphodiesterase-4 (PDE4) inhibitor with an IC50 of 0.5 nM for PDE4D3. Oglemilast inhibits pulmonary cell infiltration, including eosinophilia and neutrophilia in vitro and in vivo. Oglemilast has the potential for inflammatory airway diseases.
  • HY-N7698B
    Hexa-N-acetylchitohexaose

    		Others Cancer Inflammation/Immunology
    Hexa-N-acetylchitohexaose is an inducer of disease resistance in crop plants, which could elicit an increase of lignification-related and antioxidative enzymes in soybean plants. Hexa-N-acetylchitohexaose is a substrate of lysozyme. Hexa-N-acetylchitohexaose shows antitumor effect.
  • HY-A0027
    Fenspiride hydrochloride

    		Histamine Receptor Phosphodiesterase (PDE) Inflammation/Immunology Endocrinology
    Fenspiride, an orally active non-steroidal antiinflammatory agent, is an antagonist of H1-histamine receptor. Fenspiride inhibites phosphodiesterase 3 (PDE3), phosphodiesterase 4 (PDE4) and phosphodiesterase 5 (PDE5) activities with -log IC50 values of 3.44, 4.16 and approximately 3.8, respectively. Fenspiride can be used for the research of respiratory diseases.
  • HY-A0027A
    Fenspiride

    		Histamine Receptor Phosphodiesterase (PDE) Inflammation/Immunology
    Fenspiride, an orally active non-steroidal antiinflammatory agent, is an antagonist of H1-histamine receptor. Fenspiride inhibites phosphodiesterase 3 (PDE3), phosphodiesterase 4 (PDE4) and phosphodiesterase 5 (PDE5) activities with -log IC50 values of 3.44, 4.16 and approximately 3.8, respectively. Fenspiride can be used for the research of respiratory diseases.
  • HY-117006
    E1231

    1-{4-[2-(5-Methylfuran-2-yl)quinoline-4-carbonyl]piperazin-1-yl}ethan-1-one

    		 Sirtuin Cardiovascular Disease
    E1231 is an orally active activator of Sirtuin 1 (SIRT1) (EC50=0.83 μM), to modulate cholesterol and lipid metabolism. E1231 interactes with SIRT1 (KD=9.61 μM) and deacetylated liver X receptor-alpha (LXRα), and increases ATP-binding cassette transporter A1 (ABCA1) expression. E1231 also reduces atherosclerotic plaque development in ApoE -/- mice model. E1231 can be used for research in cholesterol and lipid disorder-related diseases.
  • HY-B1806A
    Tridihexethyl chloride

    Pathilon chloride

    		 mAChR Inflammation/Immunology Neurological Disease
    Tridihexethyl (Pathilon) chloride is an orally active anticholinergic agent and mAChR antagonist, shows activities of antimuscarinic and anticholinergic. Tridihexethyl chloride shows pronounced antispasmodic and antisecretory effects on the gastrointestinal tract. Tridihexethyl chloride can be used in studies of peptic ulcer disease and acquired nystagmus .
  • HY-139561
    KDM2B-IN-2

    		Histone Demethylase Cancer Inflammation/Immunology
    KDM2B-IN-2, a potent histone demethylase (kdm2b) inhibitor with an IC50 of 0.021 μM in a KDM2B TR-FRET assay. KDM2B-IN-2 can be used for hyperproliferative diseases research.
  • HY-146195
    MAPK-IN-1

    		Toll-like Receptor (TLR) p38 MAPK JNK ERK Cholinesterase (ChE) Inflammation/Immunology Neurological Disease
    MAPK-IN-1 (Compound 2) is a MAPK signaling pathway inhibitor. MAPK-IN-1 exhibits AChE inhibitory activity with an IC50 of 23.84 μM. MAPK-IN-1 shows anti-neuroinflammatory and neuroprotective activity and can be used for Alzheimer's disease research.
  • HY-136490
    Psychosine

    Galactosylsphingosine

    		 PKC Cancer Neurological Disease
    Psychosine (Galactosylsphingosine), a substrate of the galactocerebrosidase (GALC) enzyme, is a potential biomarker for Krabbe disease. Psychosine is a highly cytotoxic lipid, capable of inducing cell death in a wide variety of cell types including, most relevantly to globoid cell leukodystrophy (GLD), oligodendrocytes. Psychosine causes cell death at least in part via apoptosis. Psychosine also is an inhibitor of PKC.
  • HY-N4005
    Isoastilbin

    		Bacterial Tyrosinase Infection Neurological Disease
    Isoastilbin is a dihydroflavonol glycoside compound in Rhizoma Smilacis glabrae and Astragalus membranaceus. Isoastilbin inhibits glucosyltransferase (GTase) with an IC50 value of 54.3 μg/mL, and also inhibits tyrosinase activity. Isoastilbin shows neuroprotective, antioxidation, antimicrobial and anti-apoptotic properties and has the potential for Alzheimer’s disease research.
  • HY-127150
    Clofezone

    Perclusone

    		 Others Inflammation/Immunology
    Clofezone (Perclusone) is a antirheumatic agent. Clofezone can be used in the study of various rheumatic diseases, especially arthritis (RA) and ankylosing spondylitis (AS).
  • HY-142673
    ATR-IN-7

    		ATM/ATR Cancer
    ATR-IN-7 is a potent inhibitor of ATR. ATR is a class of protein kinases involved in genome stability and DNA damage repair, and is a member of the PIKK family. ATR-IN-7 has the potential for the research of ATR kinase-mediated diseases such as proliferative diseases and cancer (extracted from patent WO2021238999A1, compound 1).
  • HY-146731
    PPARγ agonist 1

    		PPAR Metabolic Disease Cardiovascular Disease
    PPARγ agonist 1 (compound 15) is a potent agonist of PPARγ. PPARγ agonist 1 shows high efficacy to activate hPPARγ without raising a full agonism and probably avoiding adverse effects. PPARγ agonist 1 has the potential for the research of cardiovascular diseases associated with metabolic disorders.
  • HY-149211
    AChE/BChE-IN-12

    		Cholinesterase (ChE) Beta-secretase Amyloid-β Neurological Disease
    AChE/BChE-IN-12 (compound 10b), a 3,5-dimethoxy analogue, is a potent AChE, BChE, and β-secretase-1 (BACE-1) inhibitor, with IC50 values of 2.57, 3.26, and 10.65 μM, respectively. AChE/BChE-IN-12 crosses the blood-brain barrier via passive diffusion and inhibits the self-aggregation of amyloid-β monomers. AChE/BChE-IN-12 can be used for Alzheimer’s disease (AD) research.
  • HY-W008947
    SEW​2871

    		LPL Receptor ERK Akt Metabolic Disease Inflammation/Immunology Neurological Disease
    SEW2871 is an orally active, potent, highly selective S1P1 (sphingosine-1-phosphate type 1 receptor) agonist, with an EC50 of 13.8 nM. SEW2871 activates ERK, Akt, and Rac signaling pathways and induces S1P1 internalization and recycling. SEW2871 reduces lymphocyte numbers in blood. SEW2871 can be used for the research of diabetes, Alzheimer’s disease, liver fibrosis, and inflammatory responses.
  • HY-113089
    Epsilon-(gamma-glutamyl)-lysine

    H-Glu(H-Lys-OH)-OH; γ-Glu-ε-Lys

    		 Endogenous Metabolite Metabolic Disease
    Epsilon-(gamma-glutamyl)-lysine is an N(6)-acyl-L-lysine derivative. The enzyme tissue transglutaminase (tTg) helps the formation of epsilon-(gamma-glutamyl)lysine bonds between ECM components in some disease, such as non-diabetic kidney, glaucoma filtration.
  • HY-116044
    BCATc Inhibitor 2

    		Others Neurological Disease
    BCATc Inhibitor 2 is a selective branched-chain aminotransferase (BCAT) inhibitor for research of neurodegenerative diseases. The IC50s of 0.2 μM, 0.8 μM and 3.0 μM for rat cytosolic isoenzyme rBCATc, human cytosolic isoenzyme hBCATc and rat mitochondrial isoenzyme rBCATm, respectively. BCATc, also called BCAT1, is in the cytoplasm.
  • HY-D0961
    Gallocyanine chloride

    		Wnt Neurological Disease
    Gallocyanine chloride, a synthetic blue dyestuff, blocks DKK1 inhibitory activity by disrupting DKK1/LRP6 interaction. Its association with LRP6 is weak (IC50 of about 3 μM in the inhibition of DKK1 binding). Gallocyanine dye acts as a potential agent for the research of Alzheimer's disease and related neurodegenerative tauopathies.
  • HY-P3781
    (Met(O)35)-Amyloid β-Protein (1-42)

    		Amyloid-β Neurological Disease
    (Met(O)35)-Amyloid β-Protein (1-42) is the oxidation form of Met35 in Aβ42. (Met(O)35)-Amyloid β-Protein (1-42) can yield an oligomer size distribution characteristic of Aβ40. (Met(O)35)-Amyloid β-Protein (1-42) can be used in the research of Alzheimer’s disease (AD).
  • HY-117089
    Tetraconazole

    		Fungal Infection
    Tetraconazole, a chiral triazole fungicide, is widely used for the prevention of plant disease in wheat fields. Tetraconazole alters the methionine and ergosterol biosynthesis pathways in Saccharomyces yeasts promoting changes on volatile derived compounds.
  • HY-139414
    Lysophosphatidylcholines

    		Biochemical Assay Reagents Inflammation/Immunology
    Lysophosphatidylcholines are a class of chemical compounds which are derived from phosphatidylcholines. Lysophosphatidylcholine is produced from phospholipids by the action of phospholipase A2 (PLA2). Lysophosphatidylcholine plays critical role in allergic airway disease manifestation.
  • HY-W171071
    Phenylethynylcarbinol carbamate

    		Others Neurological Disease
    Phenylethynylcarbinol carbamate is a agent used for neurology disease.
  • HY-103130
    EMD386088

    		5-HT Receptor Neurological Disease
    EMD386088 is a potent serotonin 6 receptor (5-HT6R) agonist. EMD386088 induces cell death. EMD386088 regulates the activity of ERK1/2. EMD386088 has the potential for the research of alzheimer's disease (AD) and schizophrenia.
  • HY-11109
    Resatorvid

    TAK-242; CLI-095

    		 Toll-like Receptor (TLR) TNF Receptor Interleukin Related Autophagy Inflammation/Immunology Cancer
    Resatorvid (TAK-242) is a selective Toll-like receptor 4 (TLR4) inhibitor. Resatorvid inhibits NO, TNF-α and IL-6 production with IC50s of 1.8 nM, 1.9 nM and 1.3 nM, respectively. Resatorvid downregulates expression of TLR4 downstream signaling molecules MyD88 and TRIF. Resatorvid inhibits autophagy and plays pivotal role in various inflammatory diseases.
  • HY-15770
    TR-14035

    		Integrin Inflammation/Immunology
    TR-14035 is a orally active dual α4β7/α4β1 integrin antagonist, with IC50 s of 7 nM and 87 nM for α4β7 and α4β1, respectively. TR-14035 can be used for the research of inflammation and autoimmune diseases.
  • HY-128382
    Brilliant Black BN

    E 151

    		 Enterovirus Infection
    Brilliant black BN (E151) is an azo dye and a food colorant. Brilliant black BN is a promising antiviral agent against EV71 infection via inhibiting the interaction between EV71 and its cellular uncoating factor cyclophilin A. Brilliant black BN has the potential for the investigation of contagious disease. Storage: protect from light.
  • HY-N0450
    Sinapine thiocyanate

    		P-glycoprotein Cholinesterase (ChE) Cancer
    Sinapine thiocyanate is an alkaloid isolated from seeds of the cruciferous species. Sinapine thiocyanate exhibits anti-inflammatory, anti-oxidant, anti-tumor, anti-angiogenic and radio-protective effects. Sinapine thiocyanate is also an acetylcholinesterase (AChE) inhibitor and can be used for the research of Alzheimer’s disease, ataxia, myasthenia gravis, and Parkinson’s disease.
  • HY-147681
    SUN13837

    		FGFR Neurological Disease
    SUN13837 is an orally active, potent and BBB-penetrated FGFR (fibroblast growth factor receptor) modulator. SUN13837 shows neuroprotective activity. SUN13837 can be used for neurodegenerative diseases research.
  • HY-P1047
    β-Sheet Breaker Peptide iAβ5

    [Pro18, Asp21] β-Amyloid (17-21)

    		 Amyloid-β Neurological Disease
    β-Sheet Breaker Peptide iAβ5 is a potent degrader of cerebral amyloid-beta (Abeta). Abeta deposition is associatied with the Alzheimer disease (AD), due to its related toxicity linked to its beta-sheet conformation and/or aggregation. β-Sheet Breaker Peptide iAβ5 reproducibly induces in vivo disassembly of fibrillar amyloid deposits. Thus, β-Sheet Breaker Peptide iAβ5 prevents and/or reverses neuronal shrinkage caused by Abeta, and reduces the extent of interleukin-1beta positive microglia-like cells that surround the Abeta deposits. β-Sheet Breaker Peptide iAβ5 reduces the size and/or number of cerebral amyloid plaques in AD. β-Sheet Breaker Peptide iAβ5 labeled by hydrophobic benzyl alcohol (HBA) tag, can be used for quantitative assay by showing vivid blue color under acidic conditions.
  • HY-145361
    eIF4A3-IN-7

    		Eukaryotic Initiation Factor (eIF) Cancer
    eIF4A3-IN-7 is a potent inhibitor of eIF4A3. eIF4A3-IN-7 has the potential for researching cancer and other dysproliferative diseases (extracted from patent WO2019161345A1, Compound 8).
  • HY-112294
    TIE-2/VEGFR-2 kinase-IN-1

    		VEGFR Cancer Inflammation/Immunology Cardiovascular Disease
    TIE-2/VEGFR-2 kinase-IN-1 is used for the synthesis of TIE-2 and/or VEGFR-2 inhibitors, extracted from patent WO2003022852, example 14. TIE-2/VEGFR-2 kinase-IN-1 is used for the study of diseases associated with inappropriate angiogenesis.
  • HY-108287
    Trithiozine

    		Others Endocrinology
    Trithiozine is an orally active antisecretory and antiulcer agent. Trithiozine can be used for the research of peptic ulcer disease and hypersecretory disorders.
  • HY-B1332
    Ipratropium bromide hydrate

    Sch 1000 bromide hydrate

    		 mAChR Inflammation/Immunology Neurological Disease
    Ipratropium bromide (Sch 1000) hydrate is a muscarinic receptor antagonist, with IC50s of 2.9 nM, 2 nM, and 1.7 nM for M1, M2, and M3 receptors, respectively. Ipratropium bromide hydrate relaxes smooth muscle, can be used in the research for COPD (chronic obstructive pulmonary disease) and asthma.
  • HY-B0241
    Ipratropium bromide

    Sch 1000

    		 mAChR Inflammation/Immunology Neurological Disease
    Ipratropium bromide (Sch 1000) is a muscarinic receptor antagonist, with IC50s of 2.9 nM, 2 nM, and 1.7 nM for M1, M2, and M3 receptors, respectively. Ipratropium bromide relaxes smooth muscle, can be used in the research for COPD (chronic obstructive pulmonary disease) and asthma.
  • HY-B1042
    Oxolamine citrate

    SKF-9976 citrate; AF-438 citrate

    		 Others Inflammation/Immunology
    Oxolamine citrate (SKF-9976 citrate) is a cough suppressant that can be used for the research of respiratory tract diseases. Oxolamine citrate also exhibits anti-inflammatory effect.
  • HY-110155
    LM11A-31 dihydrochloride

    		Neurotensin Receptor Neurological Disease
    LM11A-31 dihydrochloride, a non-peptide p75 NTR (neurotrophin receptor p75) modulator, is an orally active and potent proNGF (nerve growth factor) antagonist. LM11A-31 dihydrochloride is an amino acid derivative with high blood-brain barrier permeability and blocks p75-mediated cell death. M11A-31 dihydrochloride reverses cholinergic neurite dystrophy in Alzheimer's disease mouse models with mid- to late-stage disease progression.
  • HY-142672
    ATR-IN-6

    		ATM/ATR Cancer
    ATR-IN-6 is a potent inhibitor of ATR. ATR is a class of protein kinases involved in genome stability and DNA damage repair, and is a member of the PIKK family. ATR-IN-6 has the potential for the research of ATR kinase-mediated diseases such as proliferative diseases and cancer (extracted from patent WO2021233376A1, compound A22).
  • HY-142671
    ATR-IN-5

    		ATM/ATR Cancer
    ATR-IN-5 is a potent inhibitor of ATR. ATR is a class of protein kinases involved in genome stability and DNA damage repair, and is a member of the PIKK family. ATR-IN-5 has the potential for the research of ATR kinase-mediated diseases such as proliferative diseases and cancer (extracted from patent CN112047938A, compound D24).
  • HY-151489
    CypE-IN-1

    		Sirtuin Cancer Metabolic Disease Neurological Disease
    CypD-IN-1 is a potent and subtype-selective cyclophilin E (CypE) inhibitor. CypD-IN-1 has CypE affinity with IC50 and Ki values of 0.013 μM and 0.072 μM, respectively. CypD-IN-1 can be used for the research of several diseases including oxidative stress, neurodegenerative disorders, liver diseases, aging, autophagy and diabetes.
  • HY-B0731
    Perospirone hydrochloride

    SM-9018

    		 5-HT Receptor Dopamine Receptor Neurological Disease
    Perospirone hydrochloride (SM-9018) is an orally active antagonist of 5-HT2A receptor (Ki of 0.6 nM) and dopamine D2 receptor (Ki of 1.4 nM). Perospirone hydrochloride is also a partial agonist of 5-HT1A receptor (Ki of 2.9 nM). Perospirone hydrochloride is an atypical antipsychotic agent and has the potential for schizophrenic disease research.
  • HY-149065
    D-685

    		α-synuclein Neurological Disease
    D-685, a prodrug of D-520, exhibits higher in vivo anti-Parkinsonian efficacy in a reserpinized Parkinson's disease (PD) animal model than the parent D-520. D-685 reduces accumulation of human α-synuclein (α-syn) protein. D-685 exhibits facile brain penetration.
  • HY-122487
    Troriluzole

    BHV-4157

    		 Others Neurological Disease
    Troriluzole, a third-generation, tripeptide proagent of Riluzole (HY-B0211), is an orally active glutamate modulator. Troriluzole reduces synaptic glutamate level and increases the synaptic glutamate absorption. Troriluzole has the potential for Alzheimer disease and generalized anxiety disorder (GAD).
  • HY-B0202
    Irbesartan

    SR-47436; BMS-186295

    		 Angiotensin Receptor Apoptosis Cardiovascular Disease Endocrinology
    Irbesartan (SR-47436) is an orally active Ang II type 1 (AT1) receptor blocker (ARB). Irbesartan can relax the blood vessels, low blood pressure and increase the supply of blood and oxygen to the heart. Irbesartan can be used for the research of high blood pressure, heart failure, and diabetic kidney disease.
  • HY-125111
    PSB-SB-487

    		GPR55 Cannabinoid Receptor Cancer Metabolic Disease Neurological Disease
    PSB-SB-487 is a potent GPR55 antagonist and CB2 agonist with an IC50 value of 0.113 µM for GPR55, and a Ki value of 0.292 µM for human CB2. PSB-SB-487 can be used for researching diabetes, Parkinson’s disease, neuropathic pain, and cancer.
  • HY-148335
    IRG1-IN-1

    		Others Cancer Infection Inflammation/Immunology
    IRG1-IN-1 is an itaconic acid derivative. IRG1-IN-1 can inhibit immune-responsive gene 1 (IRG1) activity. IRG1-IN-1 can be used for the research of cancer, inflammation and autoimmune diseases.
  • HY-B0843
    Metalaxyl

    		Fungal Infection
    Metalaxyl is a fungicide agent that inhibits the protein synthesis in fungi. Metalaxyl against downy mildews and soil-borne diseases by Phytium ssp. and Phytophthora ssp..
  • HY-18956
    (E/Z)-Icerguastat

    (E/Z)-Sephin1; (E/Z)-IFB-088

    		 Phosphatase Inflammation/Immunology
    (E/Z)-Icerguastat ((E/Z)-Sephin1) is a selective inhibitor of the phosphatase regulatory subunit PPP1R15A (R15A). (E/Z)-Icerguastat can be used for protein misfolding diseases research.
  • HY-B1858
    Isoprothiolane

    		Fungal Infection
    Isoprothiolane is a systemic fungicide. Isoprothiolane is a rice blast controlling agent against the fungal disease of rice planty Pyvioutavia oryzae Cav.
  • HY-148353
    PF-06455943

    		LRRK2 Neurological Disease
    PF-06455943 is a leucine rich repeat kinase 2 (LRRK2) inhibitor with IC50 value of 3 nM. PF-06455943 also is a PET radioligand. PF-06455943 can be used for the research of ADME/neuro PK characterization and Parkinson disease (PD).
  • HY-152037
    AChE/Nrf2 modulator 1

    		Cholinesterase (ChE) Keap1-Nrf2 Neurological Disease
    AChE/Nrf2 modulator 1 is an orally active acetylcholinesterase (AChE)/nuclear factor erythroid 2-related factor 2 (Nrf2) modulator. AChE/Nrf2 modulator 1 has Nrf2 inductive activity and AChE inhibitory activity for eeAChE and hAChE with IC50 values of 0.07 μM and 0.38 μM, respectively. AChE/Nrf2 modulator 1 can be used for the research of Alzheimer's disease.
  • HY-146691
    hMAO-B-IN-2

    		Monoamine Oxidase Neurological Disease
    hMAO-B-IN-2 (compound 6j) is an orally active, potent, selective and BBB penetrated and competitive reversible hMAO-B inhibitor, with an IC50 of 4 nM. hMAO-B-IN-2 shows low toxicity and good neuroprotective effects in SH-SY5Y cell. hMAO-B-IN-2 can be used for alzheimer’s disease research.
  • HY-103164
    (E)-8-(3-Chlorostyryl)caffeine

    		Adenosine Receptor Monoamine Oxidase Neurological Disease
    (E)-8-(3-Chlorostyryl)caffeine is a selective adenosine A2A receptor antagonist. (E)-8-(3-Chlorostyryl)caffeine inhibits monoamine oxidase B (MAO-B) with a Ki value of 70 nM by a pathway that is independent of its actions on the A2A receptor. (E)-8-(3-Chlorostyryl)caffeine has the potential for Parkinson's disease research.
  • HY-146315
    AChE/BChE-IN-6

    		Cholinesterase (ChE) Monoamine Oxidase Neurological Disease
    AChE/BChE-IN-6 (compound 22) is a potent dual AChE/BChE inhibitor with IC50 values of 0.809 µM, 2.248 µM and > 100 µM for hBChE, hAChE and hMAO-B, respectively. AChE/BChE-IN-6 penetrates the blood-brain barrier (BBB). AChE/BChE-IN-6 can be used for Alzheimer’s disease (AD) research.
  • HY-143245
    Monoamine Oxidase B inhibitor 2

    		Monoamine Oxidase Neurological Disease
    Monoamine Oxidase B inhibitor 2 is a potent, reversible, orally active and selective monoamine oxidase B (MAO-B) inhibitor with an IC50 of 1.33 nM. Monoamine Oxidase B inhibitor 2 has antioxidant and anti-neuroinflammatory activities. Monoamine Oxidase B inhibitor 2 can across the blood-brain barrier (BBB), and can be used for Parkinson’s disease study.
  • HY-143244
    Monoamine Oxidase B inhibitor 1

    		Monoamine Oxidase Neurological Disease
    Monoamine Oxidase B inhibitor 1 is a potent, reversible, orally active and selective monoamine oxidase B (MAO-B) inhibitor with an IC50 of 0.02 nM. Monoamine Oxidase B inhibitor 1 has antioxidant and anti-neuroinflammatory activities. Monoamine Oxidase B inhibitor 1 can across the blood-brain barrier (BBB), and can be used for Parkinson’s disease study.
  • HY-147939
    AChE/BuChE-IN-3

    		Cholinesterase (ChE) Amyloid-β Cancer
    AChE/BuChE-IN-3 is a potent and blood-brain barrier (BBB) penetrant AChE and BuChE dual inhibitor with IC50s of 0.65 μM and 5.77 μM for AChE and BuChE. AChE/BuChE-IN-3 also inhibits Aβ1-42 aggregation. AChE/BuChE-IN-3 has effectively neuroprotective activities and nearly no toxicity on SH-SY5Y cells. AChE/BuChE-IN-3 can be used for researching Alzheimer's disease.
  • HY-W040022
    Cefcapene pivoxil hydrochloride hydrate

    		Bacterial Antibiotic Infection
    Cefcapene pivoxil hydrochloride hydrate is a proagent and an orally active 3rd-generation cephalosporin with broad-spectrum of?anti-bacterial?activity. Cefcapene pivoxil hydrochloride hydrate is used for the study of palmoplantar pustulosis (PPP) and other?infectious diseases.
  • HY-146356
    Adenylyl cyclase type 2 agonist-1

    		Adenylate Cyclase Inflammation/Immunology
    Adenylyl cyclase type 2 agonist-1 (Compound 73) is a potent agonist of adenylyl cyclase type 2 (AC2) with the EC50 of 90 nM. Adenylyl cyclase type 2 agonist-1 inhibits expression of Interleukin-6, making it a potential lead compound against respiratory diseases.
  • HY-13240
    LY2886721

    		Beta-secretase Neurological Disease
    LY2886721 is a potent, selective and orally active beta-site amyloid precursor protein cleaving enzyme 1 (BACE1) inhibitor with an IC50 of 20.3 nM for recombinant human BACE1. LY2886721 is selectivity against cathepsin D, pepsin, and renin, but lacking selectivity against BACE2 (IC50 of 10.2 nM). LY2886721 can across blood-brain barrier and has the potential for Alzheimer's disease treatment.
  • HY-145801
    XT2

    		Others Inflammation/Immunology
    XT2 is a potent, orally active, and selective inhibitor of NF-κB-inducing kinase (NIK) with an IC50 of 9.1 nM. XT2 suppresses CCl4-induced upregulation of ALT, a key biomarker of acute liver injury. XT2 also decreases immune cell infiltration into the injured liver tissue. XT2 has the potential for the research of liver inflammatory diseases.
  • HY-14759
    Aleplasinin

    PAZ-417

    		 PAI-1 Amyloid-β Neurological Disease
    Aleplasinin is an orally active, potent, BBB-penetrated and selectiveSERPINE1 (PAI-1, Plasminogen activator inhibitor-1) inhibitor. Aleplasinin increases amyloid-β (Aβ) catabolism and ameliorates amyloid-related pathology. Aleplasinin improves memory deficiency. Aleplasinin can be used for Alzheimer's disease research.
  • HY-151386
    BChE-IN-13

    		Cholinesterase (ChE) Neurological Disease
    BChE-IN-13 (Compound 17c) is an orally active, potent and selective Butyrylcholinesterase (BChE) inhibitor with IC50s of 0.22 and 0.016 μM for eqBChE and hBChE, respectively. BChE-IN-13 can improve memory and cognitive impairments, and be used in Alzheimer’s disease (AD) research.
  • HY-144429
    TRPC5-IN-4

    		TRP Channel Metabolic Disease
    TRPC5-IN-4 is potent and safe TRPC inhibitor with IC50 value of 14.07 nM and 65 nM for TRPC5 and TRPC4, respectively. TRPC5-IN-4 shows no damage on the cellular component of liver and kidney. TRPC5-IN-4 can be used for the research of chronic kidney disease (CKD).
  • HY-19285A
    Sulfaclozine sodium

    Sulfachloropyrazine sodium

    		 Bacterial Parasite Antibiotic Infection
    Sulfaclozine sodium (Sulfachloropyrazine sodium) is an efficacious sulphonamide derivative with antibacterial and anticoccidial effects. Sulfaclozine sodium is commonly used for the treatment of various poultry diseases (particularly, collibacteriosis, fowl cholera and coccidiosis).
  • HY-19285
    Sulfaclozine

    Sulfachloropyrazine

    		 Bacterial Parasite Antibiotic Infection
    Sulfaclozine (Sulfachloropyrazine) is an efficacious sulphonamide derivative with antibacterial and anticoccidial effects. Sulfaclozine is commonly used for the treatment of various poultry diseases (particularly, collibacteriosis, fowl cholera and coccidiosis).
  • HY-150076
    BLU2864

    		Others Cancer Metabolic Disease
    BLU2864 is an orally active, highly selective, ATP-competitive PRKACA inhibitor (IC50=0.3 nM). BLU2864 shows anti-tumor activity. BLU2864 can be used in cancer and polycystic kidney disease research.
  • HY-136535
    Anizatrectinib

    hTrkA-IN-1

    		 Trk Receptor Inflammation/Immunology
    Anizatrectinib (hTrkA-IN-1) is a potent and orally active inhibitor of TrkA kinase with an IC50 of 1.3 nM, compound 2 extracted from patent WO2015175788. Anizatrectinib can be used for the study of inflammatory disease, such as prostatitis, pelvic, et al.
  • HY-126415
    Magnesium Lithospermate B

    		Others Inflammation/Immunology Neurological Disease Cardiovascular Disease
    Magnesium Lithospermate B, a derivative of caffeic acid tetramer, and is extracted from Salviae miltiorrhizae. Magnesium Lithospermate B is widely used for the research of cardiovascular diseases, and it can protect against glucose-induced intracellular oxidative damage. Magnesium Lithospermate B also suppresses neuroinflammation and attenuates neurodegeneration.
  • HY-142936
    RORγt modulator 3

    		ROR Inflammation/Immunology Cancer Neurological Disease
    RORγt modulator 3 (Compound 23) is a modulator of retinoid-related orphan receptor γt (RORγt). RORγt modulator 3 can be used for the research of RORyt mediated diseases such as, e.g., pain, inflammation, COPD, asthma, rheumatoid arthritis, colitis, multiple sclerosis, psoriasis, neurodegenerative diseases and cancer.
  • HY-149279
    JNK3 inhibitor-7

    		JNK Neurological Disease
    JNK3 inhibitor-7 is a potent, orally active and cross the blood-brain barrier JNK3 inhibitor with IC50 values of 53, 973, 1039 nM for JNK3, JNK2, JNK1, respectively. JNK3 inhibitor-7 shows significant neuroprotective effects. JNK3 inhibitor-7 has the potential for the research of Alzheimer’s disease (AD).
  • HY-136780
    SEN177

    		Amyloid-β Neurological Disease
    SEN177 is a potent glutaminyl cyclase (QPCT) inhibitor with an IC50 of 0.013μM for glutaminyl-peptide cyclotransferase-like (QPCTL). SEN177 has a Ki of 20 nM for human glutaminyl cyclase (hQC). SEN177 greatly reduces the early stages of mutant HTT oligomerisation and reduces the percentage of neurons with Q80 aggregates. SEN177 has the potential for Huntington’s disease research.
  • HY-149280
    JNK3 inhibitor-8

    		JNK Neurological Disease
    JNK3 inhibitor-8 is a potent, delective, orally active and cross the blood-brain barrier JNK3 inhibitor with IC50 values of 21, 2203, >10000 nM for JNK3, JNK2, JNK1, respectively. JNK3 inhibitor-8 shows significant neuroprotective effects. JNK3 inhibitor-8 has the potential for the research of Alzheimer’s disease (AD).
  • HY-151878
    CDK7-IN-20

    		CDK GSK-3 Metabolic Disease
    CDK7-IN-20 is a potent, selective and irreversible CDK7 (CDK) inhibitor with an IC50 value of 4 nM. CDK7-IN-20 displays >206-fold selectivity for CDK7 over CDK1, CDK2, CDK3, CDK5, CDK6, CDK9 and CDK12 . CDK7-IN-20 has the potential for autosomal dominant polycystic kidney disease (ADPKD) research.
  • HY-B0558
    Carbimazole

    		Others Endocrinology
    Carbimazole is an imidazole antithyroid agent and can be used for the research of Graves' disease. Carbimazole plays its role due to its rapid conversion to methylmercapto imidazole (MMI) in vivo and can be converted to methimazole in vitro.
  • HY-125990
    SLC13A5-IN-1

    		Sodium Channel Metabolic Disease Cardiovascular Disease
    SLC13A5-IN-1 is a selective sodium-citrate co-transporter (SLC13A5) inhibitor. SLC13A5-IN-1 completely blocks the uptake of  14C-citrate with an IC50 value of 0.022 μM in HepG2 cells. SLC13A5-IN-1 has the potential for the treatment of metabolic and/or cardiovascular diseases. SLC13A5-IN-1 is extracted from patent WO2018104220A1, Compound I-5.
  • HY-105670
    PHA-543613

    		nAChR Neurological Disease
    PHA-543613 is a potent, orally active, brain-penetrant and selective α7 nAChR agonist with a Ki of 8.8 nM. PHA-543613 displays selectivity for α7-nAChR over α3β4, α1β1γδ, α4β2 and 5-HT3 receptors. PHA-543613 can be used for the cognitive deficits of Alzheimer's disease and schizophrenia research.
  • HY-120632
    BMS-433771

    		RSV Infection
    BMS-433771 is a potent orally active inhibitor of respiratory syncytial virus (RSV). BMS-433771 is active against both A and B groups of RSV, with an average EC50 of 20 nM. BMS-433771 can be used for the research of respiratory tract disease.
  • HY-120632A
    BMS-433771 dihydrochloride hydrate

    		RSV Infection
    BMS-433771 dihydrochloride hydrate is a potent orally active inhibitor of respiratory syncytial virus (RSV). BMS-433771 dihydrochloride hydrate is active against both A and B groups of RSV, with an average EC50 of 20 nM. BMS-433771 dihydrochloride hydrate can be used for the research of respiratory tract disease.
  • HY-113089A
    Epsilon-(gamma-glutamyl)-lysine TFA

    H-Glu(H-Lys-OH)-OH TFA; γ-Glu-ε-Lys TFA

    		 Endogenous Metabolite Metabolic Disease
    Epsilon-(gamma-glutamyl)-lysine (H-Glu(H-Lys-OH)-OH) TFA is an N(6)-acyl-L-lysine derivative. The enzyme tissue transglutaminase (tTg) helps the formation of epsilon-(gamma-glutamyl)lysine bonds between ECM components in some disease, such as non-diabetic kidney, glaucoma filtration.
  • HY-15283
    Clopidogrel

    		P2Y Receptor Cardiovascular Disease
    Clopidogrel is an orally active platelet inhibitor that targets P2Y12 receptor. Clopidogrel is used to inhibit blood clots in coronary artery disease, peripheral vascular disease, and cerebrovascular disease.
  • HY-18300A
    Filgotinib maleate

    GLPG0634 maleate

    		 JAK Inflammation/Immunology
    Filgotinib (maleate) is a selective and orally active JAK1 inhibitor with IC50 of 10 nM, 28 nM, 810 nM and 116 nM for JAK1, JAK2, JAK3 and TYK2, respectively. Filgotinib (maleate) can be used for rheumatoid arthritis (RA) and Crohn's disease research.
  • HY-142935
    RORγt modulator 2

    		ROR Inflammation/Immunology Cancer Neurological Disease
    RORγt modulator 2 (Compound 21) is a modulator of retinoid-related orphan receptor γt (RORγt) with the IC50 of <50 nM. RORγt modulator 2 can be used for the research of RORyt mediated diseases such as, e.g., pain, inflammation, COPD, asthma, rheumatoid arthritis, colitis, multiple sclerosis, psoriasis, neurodegenerative diseases and cancer.
  • HY-18054
    BVT 2733

    		11β-HSD Inflammation/Immunology
    BVT 2733 is a potent, selective, and orally active non-steroidal 11β-hydroxydehydrogenase 1 (11β-HSD1) inhibitor. BVT 2733 is potently against the mouse enzyme (IC50=96 nM) over the human enzyme (IC50=3341 nM). BVT 2733 has the potential for the study of arthritis and obesity related disease.
  • HY-P3528
    GPR

    		Caspase Apoptosis Neurological Disease
    GPR is a three amino acid peptide. GPR can rescue cultured rat hippocampal neurons from Aβ-induced neuronal death by inhibiting caspase-3/p53 dependent apoptosis. GPR can be used for the research of Alzheimer's disease (AD).
  • HY-147683
    FGFR-IN-3

    		FGFR Neurological Disease
    FGFR-IN-3 (compound 6) is an orally active, potent and BBB-penetrated FGFR (fibroblast growth factor receptor) modulator. FGFR-IN-3 shows neuroprotective activity. FGFR-IN-3 can be used for neurodegenerative diseases research.
  • HY-129624A
    Bisindolylmaleimide VIII acetate

    Ro 31-7549 acetate; Bis VIII acetate

    		 PKC Apoptosis Cancer Inflammation/Immunology
    Bisindolylmaleimide VIII acetate (Ro 31-7549 acetate) is a potent and selective protein kinase C (PKC) inhibitor with an IC50 of 158 nM for rat brain PKC. Bisindolylmaleimide VIII acetate has IC50s of 53, 195, 163, 213, and 175 nM for PKC-α, PKC-βI, PKC-βII, PKC-γ, PKC-ε, respectively. Bisindolylmaleimide VIII acetate facilitates Fas-mediated apoptosis and inhibits T cell-mediated autoimmune diseases.
  • HY-50861
    AZD3988

    		Acyltransferase Metabolic Disease
    AZD3988 is an orally active diacylglycerol acyl transferase-1 (DGAT-1) inhibitor. AZD3988 has excellent DGAT-1 (human) potency with an IC50 value of 0. 6 nM. AZD3988 can be used for the research of metabolic diseases such as diabetes, obesity.
  • HY-108346
    JX401

    		p38 MAPK Inflammation/Immunology
    JX401 is a potent inhibitor of p38alpha, containing a 4-benzylpiperidine motif. p38alpha is hyperactive in inflammatory diseases, and various indications suggest that its inhibition would reverse inflammation. JX401 has the potential for the research of inflammation.
  • HY-107355
    Letosteine

    		Others Inflammation/Immunology
    Letosteine is an orally active, potent and safe expectorant. Letosteine dissolves bronchial mucus and reduces respiratory inflammation symptoms, and restores gas exchanges and natural defense mechanisms in the lung. Letosteine can be used for acute or chronic respiratory diseases (such as bronchopneumopathies) research[1][2][3].
  • HY-144882
    (R)-HH2853

    		Histone Methyltransferase Cancer Inflammation/Immunology
    (R)-HH2853 is a mutant EZH2 inhibitor with an IC50 of <100 nM for EZH2-Y641F. (R)-HH2853 can be used for cancer and autoimmune diseases (WO2018045971A1; compound 201).
  • HY-153077
    PFKFB3-IN-2

    		Phosphatase Cancer Metabolic Disease Inflammation/Immunology Neurological Disease
    PFKFB3-IN-2 is a 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 3 (PFKFB3) inhibitor. PFKFB3-IN-2 has potential applications in cancer, neurodegenerative diseases, autoimmune diseases, inflammatory diseases, multiple sclerosis, metabolic diseases, angiogenesis inhibition and other diseases.
  • HY-141645
    IMM-H007

    WS070117

    		 AMPK TGF-β Receptor NF-κB JNK AP-1 Metabolic Disease Inflammation/Immunology Cardiovascular Disease
    IMM-H007 (WS070117) is an orally active and potent AMPK (AMP-activated protein kinase) activator and TGFβ1 (transforming growth factor β1) antagonist. IMM-H007 has protective effects in cardiovascular diseases via activation of AMPK. IMM-H007 negatively regulates endothelium inflammation through inactivating NF-κB and JNK/AP1 signaling. IMM-H007 inhibits ABCA1 degradation. IMM-H007 resolves hepatic steatosis in HFD-fed hamsters by the regulation of lipid metabolism. IMM-H007 can be used for the research of nonalcoholic fatty liver disease (NAFLD) and inflammatory atherosclerosis.
  • HY-19369
    L-685458

    L-685,458

    		 γ-secretase Apoptosis Neurological Disease Cancer
    L-685458 is a potent transition state analog (TSA) γ-secretase inhibitor (GSI). L-685458 inhibits amyloid β-protein precursor γ-secretase activity with IC50 of 17 nM, shows greater than 50-100-fold selectivity over other aspartyl proteases tested. L685458 inhibits γ-secretase-mediated cleavage of APP-C99 and Notch-100 with IC50s of 301.3 nM and 351.3 nM, respectively. L-685458 can be used for the research of alzheimer’s disease (AD) and cancers.
  • HY-P3340
    Leptin (116-130)

    		iGluR Neurological Disease
    Leptin (116-130) is a bioactive leptin fragment. Leptin (116-130) promotes AMPA receptor trafficking to synapses and facilitate activity-dependent hippocampal synaptic plasticity. Leptin (116-130) prevents hippocampal synaptic disruption and neuronal cell death in models of amyloid toxicity. Leptin (116-130) has the potential for the research of Alzheimer's disease (AD).
  • HY-N3680
    Danshenxinkun A

    		Others Cardiovascular Disease
    Danshenxinkun A is a natural compound that could be isolated from Tanshen and is used in the study for heart diseases.
  • HY-105670B
    PHA-543613 dihydrochloride

    		nAChR Neurological Disease
    PHA-543613 dihydrochloride is a potent, orally active, brain-penetrant and selective α7 nAChR agonist with a Ki value of 8.8 nM. PHA-543613 dihydrochloride displays selectivity for α7-nAChR over α3β4, α1β1γδ, α4β2 and 5-HT3 receptors. PHA-543613 dihydrochloride can be used for the cognitive deficits of Alzheimer's disease and schizophrenia research.
  • HY-152552
    α-Synuclein inhibitor 8

    		α-synuclein Neurological Disease
    α-Synuclein inhibitor 8 is an active inhibitor of α-Synuclein with an IC50 value of 2.5 µM. α-Synuclein inhibitor 8 has highly inhibition on the aggregation and disaggregation of α-Synuclein fibers. α-Synuclein inhibitor 8 reduces the formation of inclusions in neurons that can repairs damage neurons and improves Parkinson’s disease (PD)-like symptoms. α-Synuclein inhibitor 8 has high antioxidant activity and low cytotoxicity.
  • HY-144389
    hAChE/Aβ1-42-IN-1

    		Cholinesterase (ChE) Amyloid-β Neurological Disease
    hAChE/Aβ1-42-IN-1 (Compound 16) is a potent inhibitor of hAChE and Aβ1-42 aggregation. hAChE/Aβ1-42-IN-1 shows acceptable relative safety upon hepG2 cell line and excellent BBB penetration with wide safety margin. hAChE/Aβ1-42-IN-1 has the potential for the research of Alzheimer disease (AD).
  • HY-146619
    RAGE/SERT-IN-1

    		Amyloid-β Serotonin Transporter Neurological Disease
    RAGE/SERT-IN-1 is a potent and orally active advanced glycation end products (RAGE) and serotonin transporter (SERT) inhibitor with IC50s of 8.26 μM and 31.09 nM, respectively. RAGE/SERT-IN-1 exhibits significant neuroprotective effect against Aβ25-35-induced neuronal damage and alleviates depressive behavior of mice. RAGE/SERT-IN-1 can be used for researching the comorbidity of Alzheimer's disease and depression.
  • HY-142934
    RORγt inhibitor 2

    		ROR Inflammation/Immunology Cancer
    RORγt inhibitor 2 (Compound 119) is a potent RORγt inhibitor with an IC50 of 9.2 nM. RORγt inhibitor 2 can be used for the research of cancer, inflammation or autoimmune diseases mediated by RORγt.
  • HY-144204
    Estrogen receptor antagonist 5

    		Estrogen Receptor/ERR Cancer Endocrinology
    Estrogen receptor antagonist 5 is a potent antagonist of Estrogen receptor. The estrogen receptor is a ligand-activated transcriptional regulatory protein that mediates induction of a variety of biological effects through its interaction with endogenous estrogens. Estrogen receptor antagonist 5 has the potential for the research of metastatic disease (extracted from patent WO2017174757A1, compound 165).
  • HY-144206
    Estrogen receptor antagonist 6

    		Estrogen Receptor/ERR Endocrinology
    Estrogen receptor antagonist 6 is a potent antagonist of Estrogen receptor. The estrogen receptor is a ligand-activated transcriptional regulatory protein that mediates induction of a variety of biological effects through its interaction with endogenous estrogens. Estrogen receptor antagonist 6 has the potential for the research of metastatic disease (extracted from patent WO2017174757A1, compound 166).
  • HY-148104
    ACSS2-IN-2

    		Others Cancer Infection Metabolic Disease Inflammation/Immunology Neurological Disease
    ACSS2-IN-2 is an acyl-CoA synthetase short-chain family member 2 (ACSS2) inhibitor. ACSS2-IN-2 can inhibit ACSS2 activity with an IC50 value of 3.8 nM. ACSS2-IN-2 can be used for the research of several diseases, such as viral infection, metabolic disorders, neuropsychiatric diseases, inflammatory/autoimmune conditions and cancer.
  • HY-144267
    Glucosylceramide synthase-IN-2

    		Glucosylceramide Synthase (GCS) Metabolic Disease Neurological Disease
    Glucosylceramide synthase-IN-2 (compound T-690) is a potent, brain-penetrant and orally active glucosylceramide synthase (GCS) inhibitor with IC50s of 15 nM and 190 nM for human GCS and mouse GCS, respectively.Glucosylceramide synthase-IN-2 exhibits noncompetitive type inhibition with C8-ceramide and UDP-glucose.Glucosylceramide synthase-IN-2 can be used for Gaucher's disease research.
  • HY-145240
    eIF4E-IN-1

    		Eukaryotic Initiation Factor (eIF) Cancer Infection
    eIF4E-IN-1 is a potent inhibitor of eIF4E. eIF4E-IN-1 inhibits immunosuppression components such as immune checkpoint proteins PD-1, PD-L1, LAG3, TIM3, and/or IDO, in order to inhibit or release immune suppression in certain diseases, such as cancer and infectious disease (extracted from patent WO2021003194A1, compound Y).
  • HY-A0208
    Rosoxacin

    Acrosoxacin

    		 Bacterial Antibiotic Infection
    Rosoxacin (Acrosoxacin) is an orally active and broad-spectrum antibacterial quinolone antibiotic. Rosoxacin inhibits Gram-negative bacteria, including N. gonorrhoeae (MIC range=0.03-0.125 µg/mL).Rosoxacin can be used in studies of urinary tract infections and certain sexually transmitted diseases.
  • HY-N1875
    4-(Ethoxymethyl)phenol

    p-Hydroxybenzyl Et ether

    		 Others Inflammation/Immunology
    4-(Ethoxymethyl)phenol (p-Hydroxybenzyl Et ether) is a potent antioxidant from Amburana cearensis leaf extract, with in vitro cytogenotoxic properties. Amburana cearensis leaves can be used foe the research of respiratory diseases and inflammations.
  • HY-P3779
    Amyloid 17-42

    Aβ(17-42)

    		 Apoptosis Neurological Disease
    Amyloid 17-42 (Aβ(17-42)) is a major constituent of diffuse plaques in Alzheimer's disease and cerebellar pre-amyloid in Down's syndrome, derived by alpha- and gamma-secretase cleavage of the amyloid precursor protein (APP). Amyloid 17-42 can induce neuronal apoptosis via a Fas-like/caspase-8 activation pathway.
  • HY-151885
    Dual AChE-MAO B-IN-3

    		Cholinesterase (ChE) Monoamine Oxidase Neurological Disease
    Dual AChE-MAO B-IN-3 (compound C10) is a potent dual AChE/MAO-B inhibitior, with IC50 values of 0.58 and 0.41 μM, respectively. Dual AChE-MAO B-IN-3 is a dual-binding inhibitor bound to both the catalytic anionic site and peripheral anionic site of AChE. Dual AChE-MAO B-IN-3 can be used for Alzheimer’s disease (AD) research.
  • HY-116753
    (-)Clausenamide

    		Amyloid-β Tau Protein Neurological Disease
    (-)Clausenamide is an active alkaloid isolated from the leaves of Clausena lansium (Lour.) Skeels, and improves cognitive function in both normal physiological and pathological conditions. (-)Clausenamide inhibits β-amyloid (Aβ) toxicity, blocking neurofibrillary tangle formation by inhibiting the phosphorylation of tau protein. (-)Clausenamide exerts a significant neuroprotective activity against Aβ25-35. (-)Clausenamide can be used for researching Alzheimer's disease (AD).
  • HY-B0124A
    Zonisamide sodium

    AD 810 sodium; CI 912 sodium

    		 Carbonic Anhydrase Apoptosis Neurological Disease Cardiovascular Disease
    Zonisamide (AD 810) sodium is an orally active carbonic anhydrase inhibitor, with Kis of 35.2 and 20.6 nM for hCA II and hCA V, respectively. Zonisamide sodium exerts neuroprotective effects through anti-apoptosis and upregulating MnSOD levels. Zonisamide sodium also increases the expression of Hrd1, thereby improving cardiac function in AAC rats. Zonisamide sodium can be used in studies of seizure, parkinson’s disease and cardiac hypertrophy.
  • HY-139290
    RGLS4326

    RG4326

    		 Others Cancer Metabolic Disease
    RGLS4326 (RG4326) is a first-in-class, short oligonucleotide inhibitor of microRNA-17 (miR-17). RGLS4326 can be used for the research of autosomal dominant polycystic kidney disease (ADPKD). RGLS4326 inhibits miR-17 function in HeLa cells with an EC50 value of 28.3 nM.
  • HY-B0954A
    Oxyphencyclimine

    		mAChR Endocrinology
    Oxyphencyclimine is an orally active muscarinic receptor (mAChR) antagonist. Oxyphencyclimine is effective in reducing ulceration index and increasing pepsin activity in rat gastric ulcer model. Oxyphencyclimine can be used in studies of peptic ulcer disease and gastrointestinal spasm.
  • HY-101341
    RS 67333 hydrochloride

    		5-HT Receptor Neurological Disease
    RS 67333 hydrochloride is a potent and selective 5-HT4 receptor (5-HT4R) partial agonist with a pKi of 8.7 in guinea-pig striatum. RS 67333 hydrochloride exhibits lower affinities at several other receptors including 5-HT1A, 5-HT1D, 5-HT2A, 5-HT2C, dopamine D1, D2 and muscarinic M1-M3 receptors. RS 67333 hydrochloride has neuroprotective effects, and can be used for Alzheimer's disease research.
  • HY-152113
    AChE/BChE/MAO-B-IN-3

    		Monoamine Oxidase Cholinesterase (ChE) Neurological Disease
    AChE/BChE/MAO-B-IN-3, an indan-1-one derivative, is a potent MAO-B inhibitor with an IC50 of 0.0359 μM for human MAO-B. AChE/BChE/MAO-B-IN-3 is a potent AChE and BChE enzyme inhibitor, with IC50s of 0.0473 μM and 0.0782 μM for human AChE and BChE enzyme, respectively. AChE/BChE/MAO-B-IN-3 shows significant antioxidant activity and has the potential for Alzheimer's disease (AD) research.
  • HY-120060
    GNF6702

    		Parasite Infection
    GNF6702 is a selective inhibitor of the kinetoplastid proteasome. GNF6702 clears parasites in murine models of leishmaniasis, Chagas disease, and human African trypanosomiasis.
  • HY-10664
    SB-611812

    		Urotensin Receptor Cardiovascular Disease
    SB-611812 is a urotensin II receptor (UTR) antagonist with the potential in the research of cardiovascular disease.
  • HY-139572
    Enuvaptan

    BAY-2327949

    		 Vasopressin Receptor Metabolic Disease
    Enuvaptan (BAY-2327949) is a vasopressin receptor antagonist and has the potential for research into renal and cardiovascular diseases.
  • HY-108557
    TCS 2510

    CAY10598

    		 Prostaglandin Receptor Metabolic Disease
    TCS 2510 is a selective EP4 agonist. TCS 2510 can be used for the research of metabolic diseases.
  • HY-B0051
    Carbazeran

    		Phosphodiesterase (PDE) Metabolic Disease
    Carbazeran, a potent phosphodiesterase inhibitor, is aldehyde oxidase substrate. Carbazeran can be used for the research of metabolic disease.
  • HY-103314
    Gadolinium chloride

    GdCl3

    		 CaSR Cardiovascular Disease
    Gadolinium chloride is a specific calcium-sensing receptor (CaSR) agonist. Gadolinium chloride can be used for the research of cardiovascular disease.
  • HY-108599A
    DCPLA-ME

    DCPLA methyl ester

    		 PKC Neurological Disease
    DCPLA-ME, the methyl ester form of DCPLA, is a potent PKCε activator for use in the treatment of neurodegenerative diseases.
  • HY-N5078
    Terrestrosin K

    		Others Cardiovascular Disease
    Terrestrosin K, a steroidal saponin from Tribulus terrestris L., has potential to treat cardiovascular and cerebrovascular diseases.
  • HY-151430
    Nrf2/HO-1 activator 1

    		Keap1-Nrf2 ERK Akt JNK Reactive Oxygen Species Neurological Disease
    Nrf2/HO-1 activator 1 (Compound 24) is a potent Nrf2/HO-1 activator, neuroprotective agent. Nrf2/HO-1 activator 1 shows neuroprotective and antioxidant activities. Nrf2/HO-1 activator 1 can be used in Parkinson's disease (PD) research.
  • HY-149087
    MR2938

    		Cholinesterase (ChE) NF-κB Interleukin Related TNF Receptor CCR NOD-like Receptor (NLR) JNK NO Synthase Inflammation/Immunology Neurological Disease
    MR2938 is a potent AChE inhibitor, with an IC50 of 5.04 μM. MR2938 also suppresses NO production obviously (IC50 = 3.29 μM). MR2938 suppresses the neuroinflammation through blocking MAPK/JNK and NF-κB signaling pathways. MR2938 can be used for Alzheimer’s disease (AD) research.
  • HY-124832
    δ-Secretase inhibitor 11

    		Caspase Amyloid-β Neurological Disease
    δ-Secretase inhibitor 11 (compound 11) is an orally active, potent, BBB-penetrated, non-toxic, selective and specific δ-secretase inhibitor, with an IC50 of 0.7 μM. δ-Secretase inhibitor 11 interacts with both the active site and allosteric site of δ-secretase. δ-Secretase inhibitor 11 attenuates tau and APP (amyloid precursor protein) cleavage. δ-Secretase inhibitor 11 ameliorates synaptic dysfunction and cognitive impairments in tau P301S and 5XFAD transgenic mouse models. δ-Secretase inhibitor 11 can be used for Alzheimer's disease research.
  • HY-13995B
    Sevelamer carbonate

    		Others Metabolic Disease
    Sevelamer carbonate is an orally active and non-calcium-based phosphate binding agent and used for the hyperphosphatemia of chronic kidney disease (CKD)research. Sevelamer carbonate effectively lowers serum phosphorus levels hile having minimal effect on serum calcium or serum chloride levels in vivo. Sevelamer carbonate is considered as an improved, buffered form of sevelamer (HY-13995).
  • HY-142834
    RORγt/DHODH-IN-2

    		ROR Dihydroorotate Dehydrogenase Inflammation/Immunology
    RORγt/DHODH-IN-2 (compound 1) is a potent dual RORγt/DHODH inhibitor. RORγt/DHODH-IN-2 can be used for inflammatory bowel disease (IBD) research.
  • HY-N11366
    Hadogenes Troglodytes Venom

    South African Rock Scorpion Venom

    		 Others Infection
    Hadogenes Troglodytes Venom (South African Rock Scorpion Venom) is venom that can be obtained from Hadogenes troglodytes. Hadogenes Troglodytes Venom can be used for the research of ion channel-associated diseases, and infections.
  • HY-N2905
    Aurantiamide acetate

    Asperglaucide

    		 Cathepsin Inflammation/Immunology
    Aurantiamide acetate (TMC-58A) is a selective and orally active cathepsin inhibitor isolated from Portulaca oleracea L. Aurantiamide acetate has anti-inflammatory activities and can be used for the study of  inflammatory diseases.
  • HY-149060
    Neuraminidase-IN-15

    		Influenza Virus Infection
    Neuraminidase-IN-15 is an inhibitor of neuraminidase. Neuraminidase-IN-15 inhibits the activity of La Sota Clone 30 NDV-HN with an IC50 value of 0.06 µM. Neuraminidase-IN-15 can be used for the study of Newcastle disease virus (NDV) .
  • HY-151193
    NNMT-IN-3

    		Others Cancer Metabolic Disease
    NNMT-IN-3 (compound 14) is a potent and selective nicotinamide N-methyltransferase NNMT inhibitor with IC50 values of 1.1 nM and 0.4 μM in cell-free and cell-based assays, respectively. NNMT-IN-3 can be used to research obesity, type 2 diabetes, alcohol-related liver disease, cancer, sarcopenia and so on.
  • HY-141899
    MK-6884

    		mAChR Neurological Disease
    MK-6884 is a M4 muscarinic receptor positive allosteric modulator (PAM) with a Ki value of 0.19 nM. MK-6884 can be used for the research of the neurodegenerative diseases. MK-6884 can be conveniently radiolabeled with carbon-11 and as a positron emission tomography (PET) imaging agent.
  • HY-P1053
    β-Amyloid (10-20)

    		Amyloid-β Neurological Disease
    β-Amyloid (10-20) is a fragment of Amyloid-β peptide and maybe used in the research of neurological disease.
  • HY-132830
    Sebetralstat

    KVD900

    		 Ser/Thr Protease Metabolic Disease
    Sebetralstat (KVD900) is a plasma kallikrein inhibitor (WO2016083820). Sebetralstat can be used for the research of metabolic diseases.
  • HY-P0265A
    β-Amyloid (1-40) (TFA)

    Amyloid Beta-Peptide (1-40) (human) TFA; Amyloid β-Peptide (1-40) (human) TFA

    		 Amyloid-β Neurological Disease
    β-Amyloid (1-40) TFA is a primary protein in plaques found in the brains of patients with Alzheimer's disease.
  • HY-134238
    Cardiolipin (Heart, Bovine) (sodium)

    		Endogenous Metabolite Neurological Disease
    Cardiolipin (Heart, Bovine) sodium is a mitochondria-exclusive phospholipid. Cardiolipin (Heart, Bovine) sodium has the potential for the research of Neurological Disease.
  • HY-121577
    Sonlicromanol

    KH176

    		 Reactive Oxygen Species Metabolic Disease
    Sonlicromanol (KH176) is an orally active reactive oxygen species (ROS) modulator for the study in mitochondrial disease.
  • HY-B0124
    Zonisamide

    AD 810; CI 912

    		 Carbonic Anhydrase Apoptosis Neurological Disease
    Zonisamide (AD 810) is an orally active carbonic anhydrase inhibitor, with Kis of 35.2 and 20.6 nM for hCA II and hCA V, respectively. Zonisamide exerts neuroprotective effects through anti-apoptosis and upregulating MnSOD levels. Zonisamide also increases the expression of Hrd1, thereby improving cardiac function in AAC rats. Zonisamide can be used in studies of seizure, parkinson’s disease and cardiac hypertrophy.
  • HY-100794
    GR127935 hydrochloride

    		5-HT Receptor Neurological Disease
    GR127935 hydrochloride is a potent and orally active 5-HT1D and 5-HT1B receptor antagonist with pKis of 8.5 for both isoforms. GR127935 hydrochloride has 100-fold selectivity for 5-HT1B/1D receptors over 5-HT1A, 5-HT2A, and 5-HT2C receptors. GR127935 hydrochloride can be used in neurological disease research.
  • HY-151562
    AChE/BuChE/MAO-B-IN-1

    		Cholinesterase (ChE) Monoamine Oxidase Neurological Disease
    AChE/BuChE/MAO-B-IN-1 (compound 19) is an inhibitor of human acetyl- (hAChE), butyrylcholinesterase (hBuChE) and monoamine oxidase-B (hMAO-B) with IC50s of 4.8 μM, 13.7 μM, and 1.11 μM, respectively. AChE/BuChE/MAO-B-IN-1 also exhibits high affinity to both the σ1 and σ2 receptors with Ki values of 42.8 nM (human σ1 receptor) and 191 nM (rat σ2 receptor), respectively. AChE/BuChE/MAO-B-IN-1 can be used for Alzheimer’s disease research.
  • HY-146669
    BChE-IN-6

    		Cholinesterase (ChE) Neurological Disease
    BChE-IN-6 (compound 12) is a potent BChE inhibitor, with a Ki of 0.182 μM. BChE-IN-6 shows chelating capacity on Zn 2+. BChE-IN-6 can be used for Alzheimer’s disease (AD) research.
  • HY-P9956
    Siltuximab

    CNTO-328

    		 Interleukin Related Cancer
    Siltuximab is an anti-IL-6 (interleukin-6) monoclonal antibody, and shows antitumor activity. Siltuximab can be used in Multicentric Castleman's Disease (MCD) and COVID-19 research.
  • HY-118795
    SC-22716

    		Aminopeptidase Inflammation/Immunology
    SC-22716 is a potent, competitive, reversible inhibitor of human LTA4 hydrolase, with an IC50 of 0.20 µM. SC-22716 has potential for the research of inflammatory bowel disease (IBD) and psoriasis.
  • HY-P99050
    Sutimlimab

    		Complement System Inflammation/Immunology Cardiovascular Disease
    Sutimlimab, a first-in-class complement protein component 1, s subcomponent (C1s) inhibitor, can be used for the research of cold agglutinin disease. C1s is a serine protease which cleaves C4 and C2 to form the C3 convertase.
  • HY-144029
    RET-IN-13

    		RET Cancer
    RET-IN-13 (compound 1), a quinoline compound, is a potent RET inhibitor with IC50s of 0.5 nM, 0.9 nM for RET (WT) and RET (V804M), respectively. RET-IN-13 has the potential for tumors or intestinal diseases related to abnormal activation of RET research.
  • HY-111547
    M1001

    		HIF/HIF Prolyl-Hydroxylase Cancer
    M1001 is a weak hypoxia-inducible factor-2α (HIF-2α) agonist. M1001 can bind to the HIF-2α PAS-B domain, with a Kd of 667 nM. M1001 can be used in chronic kidney disease research.
  • HY-145062
    Enpp-1-IN-4

    		Phosphodiesterase (PDE) Cancer
    Enpp-1-IN-4 is a potent inhibitor of ectonucleotide pyrophosphatase-phosphodiesterase 1 (enpp-1). Enpp-1-IN-4 has the potential for the research of cancer diseases (extracted from patent WO2019177971A1, compound 1).
  • HY-13499
    CCR2 antagonist 5

    		CCR Inflammation/Immunology
    CCR2 antagonist 5 is a selective, orally active hCCR2 inhibitor with good binding affinity (IC50=37 nM) and potent functional antagonism (chemotaxis IC50=30 nM). CCR2 antagonist 5 displays a Ki of 9.6 µM for mCCR2 binding. CCR2 antagonist 5 can be used in the research of inflammatory disease.
  • HY-124073
    Dihydrocapsiate

    		TRP Channel Metabolic Disease
    Dihydrocapsiate, as a compound of capsinoid family, is an orally active TRPV1 agonist. Dihydrocapsiate can be used for the research of metabolism disease.
  • HY-N6617
    Norswertianolin

    		Others Cardiovascular Disease
    Norswertianolin acts as a CSE activator and is isolated from G. acuta. Norswertianolin may be a potential agent for cardiovascular diseases.
  • HY-108680
    Carbazeran citrate

    		Phosphodiesterase (PDE) Metabolic Disease
    Carbazeran (citrate), a potent phosphodiesterase inhibitor, is aldehyde oxidase substrate. Carbazeran (citrate) can be used for the research of metabolic disease.
  • HY-12381
    ML224

    NCGC00242364; ANTAG3

    		 TSH Receptor Endocrinology
    ML224 (NCGC00242364) is a selective TSHR antagonist with an IC50 value of 2.1 µM. ML224 can be used in the study of Graves' disease and other thyroid disorders.
  • HY-148093
    PM-81I

    		STAT Cancer Inflammation/Immunology
    PM-81I is a potent STAT6 inhibitor (targeting the SH2 structural domain) that effectively reduces STAT6 phosphorylation levels. PM-81I can be used in studies of allergic lung disease, allergic rhinitis, chronic obstructive pulmonary disease or cancer[1].
  • HY-142701
    SSTR4 agonist 4

    		Somatostatin Receptor Neurological Disease
    SSTR4 agonist 4 is a potent agonist of SSTR4. SSTR4 is expressed at relatively high levels in the hippocampus and neocortex, memory and learning regions, and Alzheimer's disease pathology. SSTR4 agonists are potent in rodent models of pain associated with acute and chronic associated anti-peripheral nociceptive and anti-inflammatory activity. SSTR4 agonist 4 has the potential for the research of pain (extracted from patent WO2021233428A1, compound 14).
  • HY-106224B
    Orexin A (human, rat, mouse) (acetate)

    Hypocretin-1 (human, rat, mouse) (acetate)

    		 Orexin Receptor (OX Receptor) Neurological Disease
    Orexin A (Hypocretin-1) (human, rat, mouse) acetate is a hypothalamic neuropeptide with analgesic properties (crosses the blood-brain barrier). Orexin A (human, rat, mouse) acetate is also an OX1R agonist that induces the expression of BDNF and TH proteins in SH-SY5Y cells in a time- and dose-dependent manner. Orexin A (human, rat, mouse) acetate can be used in studies of appetite regulation, neurodegenerative diseases and modulation of injurious messaging.
  • HY-142700
    SSTR4 agonist 3

    		Somatostatin Receptor Neurological Disease
    SSTR4 agonist 3 is a potent agonist of SSTR4. SSTR4 is expressed at relatively high levels in the hippocampus and neocortex, memory and learning regions, and Alzheimer's disease pathology. SSTR4 agonists are potent in rodent models of pain associated with acute and chronic associated anti-peripheral nociceptive and anti-inflammatory activity. SSTR4 agonist 3 has the potential for the research of pain (extracted from patent WO2021233427A1, compound 14).
  • HY-14174
    MRK-560

    		γ-secretase Cancer Neurological Disease
    MRK-560 is an orally active, brain barrier-penetrating γ-Secretase inhibitor, can potently reduces Aβ peptide in rat brain and cerebrospinal fluid. MRK-560 also decreases mutant NOTCH1 processing by selectively inhibiting PSEN1. MRK-560 can be used in studies of Alzheimer's disease and T-cell acute lymphoblastic leukaemia (T-ALL).
  • HY-N2099
    Onjisaponin B

    		Autophagy Neurological Disease
    Onjisaponin B is a natural product derived from Polygala tenuifolia. Onjisaponin B enhances autophagy and accelerates the degradation of mutant α-synuclein and huntingtin in PC-12 cells, and exbibits potential therapeutic effects on Parkinson disease and Huntington disease.
  • HY-137315
    TML-6

    		Amyloid-β NF-κB mTOR Keap1-Nrf2 Neurological Disease
    TML-6, an orally active curcumin derivative, inhibits the synthesis of the β-amyloid precursor protein and β-amyloid (Aβ). TML-6 can upregulate Apo E, suppress NF-κB and mTOR, and increase the activity of the anti-oxidative Nrf2 gene. TML-6 has the potential for Alzheimer’s disease (AD) research.
  • HY-131592
    Tricetin

    		Apoptosis Keap1-Nrf2 Cancer Inflammation/Immunology Neurological Disease
    Tricetin is a potent competitive inhibitor of the Keap1-Nrf2 Protein Protein Interaction (PPI). Tricetin protects against 6-OHDA-induced neurotoxicity in Parkinson's disease model by activating Nrf2/HO-1 signaling pathway and preventing mitochondria-dependent apoptosis pathway.
  • HY-107337S
    Delapril-d3 hydrochloride

    		Angiotensin-converting Enzyme (ACE) Cardiovascular Disease
    Delapril-d3 (hydrochloride) is the deuterium labeled Delapril hydrochloride. Delapril hydrochloride is an angiotensin-converting enzyme (ACE) inhibitor for the treatment of cardiovascular diseases[1].
  • HY-103391
    Qc1

    		Others Metabolic Disease
    Qc1 is a reversible and noncompetitive threonine dehydrogenase (TDH) inhibitor. Qc1 can be used for the research of Metabolic disease.
  • HY-B1096
    Etamivan

    Ethamivan; N,N-Diethylvanillamide

    		 Others Neurological Disease
    Etamivan (Ethamivan), an orally active respiratory stimulant, is mainly used in the research of barbiturate overdose and chronic obstructive pulmonary disease.
  • HY-103372
    GSK264220A

    		Others Cardiovascular Disease
    GSK264220A is a potent endothelial lipase inhibitor with IC50 of 16 nM. GSK264220A has the potential to decrease the risk of cardiovascular disease.
  • HY-129411
    Sinbaglustat

    ACT-519276; OGT2378

    		 Glucosylceramide Synthase (GCS) Metabolic Disease
    Sinbaglustat (OGT2378) is a dual inhibitor of glucosylceramide synthase (GCS) and non-lysosomal glucosyl ceramidase (GBA2). Sinbaglustat is an orally available N-alkyl iminosugar that crosses the blood-brain barrier. Sinbaglustat can be used for the research of central neurodegenerative diseases associated with lysosomal dysfunctions.
  • HY-W181102
    NFAT Inhibitor-2

    		Others Inflammation/Immunology Neurological Disease Cardiovascular Disease
    NFAT Inhibitor-2 is a potent inhibitor of calcineurin NFAT signalling. Calcineurin is a serine/threonine protein phosphatase regulated by Ca2+ and calmodulin. NFAT Inhibitor-2 has the potential for the research of inflammatory disease, an autoimmune disorder, a cardiovascular disease, a neurodegenerative disease, a disease occurring with uncontrolled cell proliferation and/or differentiation, an angiogenesis-related disease, an allergy, anaphylaxis and alopecia (extracted from patent WO2016207212A1, compound 17).
  • HY-W268334
    1,2,3,4-Tetrahydronorharman-1-one

    		Bacterial Parasite Antibiotic Infection
    1,2,3,4-Tetrahydronorharman-1-one is a manzamine alkaloid with activity against infectious and tropical parasitic diseases from an Indonesian sponge.
  • HY-109086
    Edicotinib

    JNJ-40346527; JNJ-527

    		 c-Fms Inflammation/Immunology Neurological Disease
    Edicotinib (JNJ-40346527) is a potent, selective, brain penetrant and orally active colony-stimulating factor-1 receptor (CSF-1R) inhibitor with an IC50 of 3.2 nM. Edicotinib exhibits less inhibitory effects on KIT and FLT3 with IC50 values of 20 nM and 190 nM, respectively. Edicotinib limits microglial expansion and attenuates microglial proliferation and neurodegeneration in mice. Edicotinib has the potential for Alzheimer’s disease and rheumatoid arthritis research.
  • HY-147684
    FGFR-IN-7

    		FGFR Neurological Disease
    FGFR-IN-7 (compound 17) is an orally active, potent and BBB-penetrated FGFR (fibroblast growth factor receptor) modulator. FGFR-IN-7 shows neuroprotective activity. FGFR-IN-7 improves brain exposure and reduced risk of phospholidosis. FGFR-IN-7 can be used for neurodegenerative diseases research.
  • HY-33169
    1,2,3,4-Tetrahydro-β-carboline-1-carboxylic acid

    		Others Neurological Disease
    1,2,3,4-Tetrahydro-β-carboline-1-carboxylic acid is a chemical used on the study of neurodegenerative diseases.
  • HY-10388
    TTA-Q6

    		Calcium Channel Neurological Disease
    TTA-Q6 is a selective T-type Ca 2+ channel antagonist, which can be used in the research of neurological disease.
  • HY-19344
    Lifitegrast

    SAR 1118; SHP-606

    		 Integrin Inflammation/Immunology
    Lifitegrast (SAR 1118) is a potent integrin antagonist. Lifitegrast blocks the binding of intercellular adhesion molecule 1 (ICAM-1) to lymphocyte function-associated antigen 1 (LFA-1), interrupting the T cell-mediated inflammatory cycle. Lifitegrast inhibits Jurkat T cell attachment to ICAM-1 with an IC50 of 2.98 nM. Lifitegrast can be used for researching dry eye disease.
  • HY-19344A
    Lifitegrast sodium

    SAR 1118 sodium; SHP-606 sodium

    		 Integrin Inflammation/Immunology
    Lifitegrast (SAR 1118) sodium is a potent integrin antagonist. Lifitegrast sodium blocks the binding of intercellular adhesion molecule 1 (ICAM-1) to lymphocyte function-associated antigen 1 (LFA-1), interrupting the T cell-mediated inflammatory cycle. Lifitegrast sodium inhibits Jurkat T cell attachment to ICAM-1 with an IC50 of 2.98 nM. Lifitegrast sodium can be used for researching dry eye disease.
  • HY-P99563
    Tibulizumab

    LY 3090106; LY-3090106; LY3090106

    		 TNF Receptor Interleukin Related Inflammation/Immunology
    Tibulizumab (LY 3090106) is a tetravalent bispecific monoclonal antibody targeting B-cell activating factor (BAFF) and IL-17A with Kd values of 60 pM and 14 pM, respectively. Tibulizumab can be used for autoimmune disease research.
  • HY-121390
    Lasiocarpine

    		Endogenous Metabolite Cancer
    Lasiocarpine, a hepatotoxic pyrrolizidine alkaloid (PA), causes fatal liver veno-occlusive disease in vivo. Lasiocarpine is toxic only after its metabolic conversion to the toxic intermediate, including dehydrolasiocarpine and N-oxide.
  • HY-146398
    AMPK activator 6

    		AMPK Metabolic Disease
    AMPK activator 6 (Compound GC) reduces lipid content and activates the AMPK pathway in HepG2 and 3T3-L1 cells. AMPK activator 6 significantly suppresses the increase in triglyceride (TG) , total cholesterol (TC), low-density lipoprotein-C (LDL-C), and other biochemical indices in blood serum. AMPK activator 6 can be used for the research of non-alcoholic fatty liver disease (NAFLD) and metabolic syndrome.
  • HY-115876
    BTK-IN-5

    		Btk Metabolic Disease Inflammation/Immunology Cardiovascular Disease
    BTK-IN-5 is a covalent BTK inhibitor for researching medical conditions such as cardiovascular diseases, respiratory diseases, inflammation, and diabetes.
  • HY-151201
    Steroid sulfatase/17β-HSD1-IN-3

    		Others Cancer
    Steroid sulfatase/17β-HSD1-IN-3 (compound 19) is a dual inhibitor of steroid sulfatase (STS) and 17β-hydroxysteroid dehydrogenase type 1 (17β HSD1). Steroid sulfatase/17β-HSD1-IN-3 irreversibly inhibits hSTS activity with anIC50 value of 27 nM. Steroid sulfatase/17β-HSD1-IN-3 can be used in the study of endometriosis and other estrogen-dependent diseases.
  • HY-151202
    Steroid sulfatase/17β-HSD1-IN-4

    		Others Cancer
    Steroid sulfatase/17β-HSD1-IN-4 (compound 37) is a dual inhibitor of steroid sulfatase (STS) and 17β-hydroxysteroid dehydrogenase type 1 (17β HSD1). Steroid sulfatase/17β-HSD1-IN-4 irreversibly inhibits hSTS activity with anIC50 value of 63 nM. Steroid sulfatase/17β-HSD1-IN-4 can be used in the study of endometriosis and other estrogen-dependent diseases.
  • HY-N0611
    alpha-Boswellic acid

    α-Boswellic acid

    		 Others Inflammation/Immunology
    alpha-Boswellic acid (α-Boswellic acid) is a pentacyclic triterpene compound from extracts of Frankincense, has anticonvulsant and anti-cancer properties. alpha-Boswellic acid prevents and decreases the progression of Alzheimer’s hallmarks in vivo and can be used for Alzheimer’s disease research.
  • HY-152114
    AChE/BChE/MAO-B-IN-4

    		Monoamine Oxidase Cholinesterase (ChE) Neurological Disease
    AChE/BChE/MAO-B-IN-4, an indan-1-one derivative, is a potent MAO-B inhibitor with an IC50 of 0.0393 μM for human MAO-B. AChE/BChE/MAO-B-IN-4 is a potent AChE and BChE enzyme inhibitor, with IC50s of 0.0458 μM and 0.075 μM for human AChE and BChE enzyme, respectively. AChE/BChE/MAO-B-IN-4 shows significant antioxidant activity and prevent β-amyloid plaque aggregation. AChE/BChE/MAO-B-IN-4 has the potential for Alzheimer's disease (AD) research.
  • HY-105697
    Protoveratrine A

    NSC 7526; Protalba; Protoveratrin

    		 Others Cardiovascular Disease
    Protoveratrine A (NSC 7526; Protalba; Protoveratrin) is an alkaloid with strong cardiostimulant and vasoconstrictive effects, which can be used in the study of hypertension and other cardiovascular diseases.
  • HY-N4305
    Notoginsenoside FP2

    		Others Cardiovascular Disease
    Notoginsenoside FP2, a dammarane-Type Bisdesmoside isolated from the Fruit Pedicels of Panax notoginseng, has potential to treat cardiovascular disease.
  • HY-N4173
    8-Oxoepiberberine

    		Drug Metabolite Metabolic Disease
    8-Oxoepiberberine is an alkaloid metabolite in the plasma after oral administration of Zuojin formula, a traditional chinese medicine used to treat gastrointestinal disease.
  • HY-40161
    Indole-3-carboxylic acid

    		Endogenous Metabolite Metabolic Disease
    Indole-3-carboxylic acid is a normal urinary indolic tryptophan metabolite and has been found elevated in patients with liver diseases.
  • HY-134879
    Tau tracer 1

    		Microtubule/Tubulin Neurological Disease
    Tau tracer 1 is a Tau tracer used for imaging Tau protein aggregates. Tau tracer 1 can be used to diagnose neurodegenerative diseases.
  • HY-147195
    QH536

    		HMG-CoA Reductase (HMGCR) Metabolic Disease Inflammation/Immunology Cardiovascular Disease
    QH536 (Compound 29) is a potent HMGCR degrader with an EC50 of 0.22 μM. QH536 has no side-effect of inducing cholesterol accumulation in cells. QH536 shows anti-inflammatory and can be used for cardiovascular disease and nonalcoholic steatohepatitis research.
  • HY-117983
    RU-505

    		Amyloid-β Neurological Disease
    RU-505 is an effective β-amyloid (Aβ)-fibrinogen interaction inhibitor with IC50s of 5.00 and 2.72 μM in fluorescence polarization (FP) and AlphaLISA assays, respectively. RU-505 is highly permeable to the BBB. RU-505 reduces cerebral amyloid angiopathy (CAA). RU-505 can be used for the research of Alzheimer’s disease (AD).
  • HY-120785
    SR1555

    		ROR Inflammation/Immunology
    SR1555 is a specific retinoic acid receptor-related orphan nuclear receptor γ (RORγ) inverse agonist with an IC50 value of 1 μM. SR1555 not only inhibits TH17 cell development and function but also increases the frequency of T regulatory cells, as well as inhibits the expression of IL-17. SR1555 can be used for researching autoimmune diseases.
  • HY-100007A
    Vonoprazan hydrochloride

    TAK-438 hydrochloride

    		 Proton Pump Bacterial Infection Endocrinology
    Vonoprazan hydrochloride, a proton pump inhibitor (PPI), is a potent and orally active potassium-competitive acid blocker (P-CAB), with antisecretory activity. Vonoprazan hydrochloride inhibits H +,K +-ATPase activity in porcine gastric microsomes with an IC50 of 19 nM at pH 6.5. Vonoprazan hydrochloride is developed for the research of acid-related diseases, such as gastroesophageal reflux disease and peptic ulcer disease. Vonoprazan hydrochloride can be used for eradication of Helicobacter pylori.
  • HY-N2913
    Ayanin

    		Phosphodiesterase (PDE) Cancer Inflammation/Immunology
    Ayanin is a bioflavonoid isolated from Psychotria serpens. Ayanin is a non-selective phosphodiesterase1-4 inhibitor and can be used for the study of respiratory disease,such as allergic asthma et al.
  • HY-E70005
    Collagenase

    		Biochemical Assay Reagents Others
    Collagenase is a proteolytic enzyme, which breaks the peptide bonds in collagen. Collagenase has good research potential in disc herniation, keloid, cellulite, lipoma, as well as peyronie's disease and dupuytren fracture.
  • HY-115987
    MAO-B-IN-6

    		Monoamine Oxidase Neurological Disease
    MAO-B-IN-6 is a potent, selective and orally active MAO-B inhibitor with an IC50 of 0.019 µM. MAO-B-IN-6 shows more efficacious than Safinamide in vitro and in vivo. MAO-B-IN-6 has the potential for the research of parkinson's disease (PD).
  • HY-115977
    Aldose reductase-IN-3

    		Aldose Reductase Inflammation/Immunology
    Aldose reductase-IN-3 (Compound 5) is a potent and moderately selective inhibitor of aldose reductase (AR) with an IC50 of 3.99 μM. Aldose reductase has recently emerged as a molecular target that is involved in various inflammatory diseases, including sepsis. Aldose reductase-IN-3 has the potential for the research of sepsis.
  • HY-147060
    Dyrk1A-IN-3

    		DYRK Neurological Disease
    Dyrk1A-IN-3 (Compound 8b), a highly selective  dual-specificity tyrosine-regulated kinase 1A (DYRK1A) inhibitor, maintains high levels of DYRK1A binding affinity (IC50=76 nM). Dyrk1A-IN-3 can be used for the research of neurodegenerative disorders such as Alzheimer’s Disease, Huntington’s Disease, and Parkinson’s Disease.
  • HY-P9953
    Certolizumab pegol

    Certolizumab; CDP870

    		 TNF Receptor Inflammation/Immunology
    Certolizumab pegol (Certolizumab) is a recombinant, polyethylene glycolylated, antigen-binding fragment of a humanized monoclonal antibody that selectively targets and neutralizes tumour necrosis factor-α (TNF-α). Certolizumab pegol can be used for rheumatoid arthritis and Crohn disease research.
  • HY-15781
    Morinidazole

    		Bacterial Infection
    Morinidazole is an orally active and 5-nitroimidazole antimicrobial agent that undergoes extensive metabolism in humans via N +-glucuronidation and sulfation. Morinidazole can be used for bacterial infections research including appendicitis and pelvic inflammatory disease (PID) caused by anaerobic bacteria.
  • HY-103190
    MRS1220

    		Adenosine Receptor Cancer Neurological Disease
    MRS1220, a highly potent and selective human A3 adenosine receptor (hA3AR) antagonist with a Ki of 0.59 nM, has therapeutic potential for the research of diseases of the central nervous system. MRS1220 reduces glioblastoma tumor size and blood vessel formation in vivo.
  • HY-101367A
    GR 55562 dihydrochloride

    		5-HT Receptor Neurological Disease
    GR 55562 (dihydrochloride) is a selective 5-HT1B receptor antagonist. GR 55562 can be used for the research of nerve disease.
  • HY-17623S
    Tegoprazan-d6

    CJ-12420-d6; RQ-00000004-d6

    		 Proton Pump Metabolic Disease
    Tegoprazan-d6 is a stable isotope of Tegoprazan (HY-17623). Tegoprazan-d6 can be used for the research of metabolic disease[1].
  • HY-10043A
    gamma-secretase modulator 1 hydrochloride

    		γ-secretase Neurological Disease
    gamma-secretase inhibitior-1 is a gamma-secretase modulator, γ-secretase inhibitior-1 is useful for Alzheimer's disease.
  • HY-120475A
    PBT434 methanesulfonate

    		α-synuclein Neurological Disease
    PBT434 methanesulfonate is a potent, orally active and cross the blood-brain barrier α-synuclein aggregation inhibitor. PBT434 methanesulfonate can be used as a iron chelator and modulates transcellular iron trafficking. PBT434 methanesulfonate inhibits iron-mediated redox activity and iron-mediated aggregation of α-synuclein. PBT434 methanesulfonate prevents the loss of substantia nigra pars compacta neurons (SNpc). PBT434 methanesulfonate has the potential for the research of Parkinson’s disease (PD).
  • HY-148325
    α7 Nicotinic receptor agonist-1

    		nAChR Neurological Disease
    α7 Nicotinic receptor agonist-1 (Preparation 5) is an α7 nAChR agonist. α7 Nicotinic receptor agonist-1 can be used in studies of psychiatric disorders (such as schizophrenia, manic or hypomanic depression and anxiety disorders) and intellectual disorders (such as alzheimer's disease, learning deficits, cognitive deficits, attention deficits, memory loss, lewy body dementia and attention deficit hyperactivity disorder).
  • HY-W091734
    Methyl 4-iodo-L-phenylalaninate hydrochloride

    		Amino Acid Derivatives Neurological Disease Cardiovascular Disease
    Methyl 4-iodo-L-phenylalaninate hydrochloride is a Phenylalaninate derivative. Methyl 4-iodo-L-phenylalaninate hydrochloride can be used for the preparation of factor XI modulators used in the research of thrombotic and thromboembolic. Methyl 4-iodo-L-phenylalaninate hydrochloride can also be used for the synthesis of compounds for the research of amyloid-related diseases, such as Alzheimer’s disease.
  • HY-151431
    Nrf2/HO-1 activator 2

    		Keap1-Nrf2 Reactive Oxygen Species ERK Akt JNK Neurological Disease
    Nrf2/HO-1 activator 2 (compound 13m), difluoro-substituted derivative, is a potent Nrf2/HO-1 activator. Nrf2/HO-1 activator 2 has neuroprotective and antioxidant effects through the Nrf2/HO-1 pathway mediated by phosphorylation of ERK1/2, JNK, or Akt in PC12 cells. Nrf2/HO-1 activator 2 can be used in the research of Parkinson's disease (PD).
  • HY-151369
    AV123

    		RIP kinase Metabolic Disease Inflammation/Immunology Neurological Disease Cardiovascular Disease
    AV123 (compound 12) is a non-cytotoxic RIPK1 inhibitor (IC50=12.12 µM). AV123 blocks the TNF-α-induced necroptotic (EC50=1.7 μM) but not the apoptotic cell death. AV123 can be used in the study of necrotic chronic conditions such as ischemia-reperfusion injury of the brain, heart and kidney, inflammatory diseases, neurodegenerative diseases and infectious diseases.
  • HY-100740
    Lanabecestat

    AZD3293; LY3314814

    		 Beta-secretase Neurological Disease
    Lanabecestat (AZD3293) is a potent, orally active and blood-brain barrier penetrating BACE1 inhibitor with a Ki of 0.4 nM. Lanabecestat is used for the research of Alzheimer's disease.
  • HY-P99755
    Nimacimab

    RYI-018

    		 Cannabinoid Receptor Metabolic Disease
    Nimacimab (RYI-018) is a negative-allosteric modulating monoclonal antibody targeting CB1 receptor. Nimacimab can be used for research of metabolic diseases.
  • HY-B0232
    Dofetilide

    UK 68789

    		 Potassium Channel Cardiovascular Disease
    Dofetilide (UK 68789), as a class III antiarrhythmic agent, is an orally active, potent and specific IKr blocker. Dofetilide can be used for the research of cardiovascular disease.
  • HY-113344
    16α-Hydroxyestrone

    16αOHE

    		 Endogenous Metabolite Metabolic Disease
    16α-Hydroxyestrone (16αOHE) is a major Estradiol metabolite. 16α-Hydroxyestrone (16αOHE) can be used for the research of metabolic disease.
  • HY-P1440
    BeKm-1

    		Potassium Channel Cardiovascular Disease
    BeKm-1 is a HERG (human ether-a-go-go-related gene) blocking compound. BeKm-1 can be used for the research of heart disease.
  • HY-112070
    Oxyfedrine

    		Adrenergic Receptor Cardiovascular Disease
    Oxyfedrine, a vasodilator, is an orally active β-adrenoreceptor agonist. Oxyfedrine decreases the tonicity of coronary vessels. Oxyfedrine can be used in the research of cardiovascular disease.
  • HY-N10579
    Chrexanthomycin C

    		DNA/RNA Synthesis Neurological Disease
    Chrexanthomycin C is an orally active marine natural product with remarkable bioactivities. Chrexanthomycin C has binding affinity for DNA (G4C2) 4 G4 with a Kd value of 2.8 mM. Chrexanthomycin C can be used for the research of neurodegenerative disease such as amyotrophic lateral sclerosis (ALS).
  • HY-W028142
    Quipazine

    		5-HT Receptor SARS-CoV Neurological Disease
    Quipazine is a 5-HT agonist with a Ki value of 1.4 nM for displaces [3H]GR65630 from 5-HT3R in rat. Quipazine shows antiviral activity against SARS-CoV-2 with an EC50 of 31.64 μM. Quipazine behaves as a 5-HT3R agonist in peripheral models. Quipazine can be used for neurological disease research.
  • HY-W008614
    Lansoprazole sulfone

    AG-1813

    		 Proton Pump Metabolic Disease
    Lansoprazole sulfone (AG-1813) is an orally active and selective inhibitor of H +, K +-ATPase. Lansoprazole sulfone can significantly stimulates gastric acid secretion by inhibiting H +, K +-ATPase. Lansoprazole sulfone has potential applications in duodenal ulcer, gastric ulcer, gastroesophageal reflux disease and Zolinger Ellison disease.
  • HY-110168
    NS 9283

    		nAChR Neurological Disease
    NS9283 is a positive positive allosteric modulator of (α4)3(β2)2 nicotinic ACh receptors. NS9283 can be used in a series of neurological conditions such as attention deficit hyperactivity disorder (ADHD), schizophrenia, Parkinson's disease and Alzheimer's disease.
  • HY-N11416
    Glycodehydrocholic acid

    		Endogenous Metabolite Cancer Endocrinology Metabolic Disease
    Glycodehydrocholic acid is a bile acid glycine conjugate. Glycodehydrocholic acid is used to diagnose cancer and other diseases.
  • HY-122094
    Steppogenin

    		HIF/HIF Prolyl-Hydroxylase Cancer Cardiovascular Disease
    Steppogenin is a potent inhibitor of HIF-1α and DLL4, with IC50 values of 0.56 and 8.46 μM, respectively. Steppogenin can be sued for the research of angiogenic diseases, such as those involving solid tumors.
  • HY-15781A
    (R)-Morinidazole

    		Bacterial Infection
    (R)-Morinidazole is an orally active and 5-nitroimidazole antimicrobial agent that undergoes extensive metabolism in humans via N +-glucuronidation and sulfation. (R)-Morinidazole can be used for bacterial infections research including appendicitis and pelvic inflammatory disease (PID) caused by anaerobic bacteria.
  • HY-145721
    Mongersen

    GED-0301

    		 TGF-beta/Smad Inflammation/Immunology
    Mongersen (GED-0301) is a specific and orally active SMAD7 antisense oligonucleotide. Mongersen restores TGF-β1 activity leading to inhibition of inflammatory signals. Mongersen can attenuate Crohn's disease-like experimental colitis in mice.
  • HY-131062
    yGsy2p-IN-1

    		Others Metabolic Disease
    yGsy2p-IN-1 is a potent inhibitor for yeast glycogen synthase 2 (yGsy2p). yGsy2p-IN-1 is a competitive human glycogen synthase 1 (hGYS1) inhibitor with an IC50 of 2.75 µM and a Ki of 1.31 µM for wild-type hGYS1. yGsy2p-IN-H23 a pyrazole inhibitor, is used for glycogen storage diseases (GSDs).
  • HY-107529
    TC-G 24

    		GSK-3 Metabolic Disease Neurological Disease
    TC-G 24 (Compound 24) is a potent, selective glycogen synthase kinase-3β (GSK-3β) inhibitor with an IC50 of 17.1 nM. TC-G 24 can cross the BBB and can be used for studying many diseases such as type 2 diabetes mellitus, stroke, Alzheimer, and other related diseases.
  • HY-W040146S
    Propionylpromazine-d6 hydrochloride

    		Dopamine Receptor Neurological Disease
    Propionylpromazine-d6 (hydrochloride) is the deuterium labeled Propionylpromazine hydrochloride. Propionylpromazine hydrochloride (Propiopromazine hydrochloride), a dopamine receptor D2 (DRD2) antagonist, can be used in the research of Parkinson disease[1].
  • HY-148689
    SPC4061

    		Ser/Thr Protease Metabolic Disease
    SPC4061 an antisense nucleotide, is a potent PCSK9 inhibitor. SPC4061 targets the lock-in nucleic acid (LNA) of PCSK9 for the study of hypercholesterolemia and related diseases.
  • HY-132812
    Emraclidine

    CVL-231

    		 mAChR Neurological Disease
    Emraclidine (CVL-231) is a muscarinic M4 receptor positive allosteric modulator (WO2018002760, compound 11). Emraclidine can be used for the research of neurological diseases.
  • HY-134880
    Tau tracer 2

    Pl-2620

    		 Microtubule/Tubulin Neurological Disease
    Tau tracer 2 (Pl-2620) is a Tau tracer used for imaging Tau protein aggregates. Tau tracer 2 can be used to diagnose neurodegenerative diseases.
  • HY-P99317
    Solanezumab

    Immunoglobulin G1, anti-(human β-amyloid) (human-mouse monoclonAnti-Human Abeta Recombinant Antibody

    		 Amyloid-β Neurological Disease
    Solanezumab is a humanized monoclonal IgG1 antibody directed against the mid-domain of the amyloid-β (Aβ) peptide. Solanezumab has the potential for the research of Alzheimer’s disease.
  • HY-N7506
    13-Hydroxyisobakuchiol

    Delta3,2-Hydroxylbakuchiol

    		 Monoamine Transporter Dopamine Transporter Neurological Disease
    Hydroxyisobakuchiol (Delta3,2-Hydroxylbakuchiol), an analog of Bakuchiol (HY-N0235) isolated from Psoralea corylifolia (L.), is a potent monoamine transporter inhibitor. 13-Hydroxyisobakuchiol is more selective for the dopamine transporter (DAT) (IC50=0.58 μM) and norepinephrine transporter (NET) (IC50=0.69 μM) than for the serotonin transporter (SERT) (IC50=312.02 μM). 13-Hydroxyisobakuchiol has the potential for the research of disorders such as Parkinson's disease and depression.
  • HY-19999A
    PF-CBP1 hydrochloride

    		Epigenetic Reader Domain Histone Acetyltransferase Neurological Disease
    PF-CBP1 hydrochloride is a highly selective inhibitor of the CREB binding protein bromodomain (CBP BRD). PF-CBP1 inhibits CREBBP and EP300 bromodomains with IC50 of 125 nM and 363 nM respectively. PF-CBP1 hydrochloride reduces LPS-induced inflammatory cytokines expression (IL-1β, IL-6 and IFN-β) in primary macrophages. PF-CBP1 hydrochloride also downregulates RGS4 expression cortical neurons and can be used for the research of neurological disorders, including epilepsy and parkinson's disease, et al.
  • HY-118858
    UCPH-102

    		Others Cancer Neurological Disease
    UCPH-102 is a highly selective EAAT1 inhibitor with an IC50 of 0.43 µM. UCPH-102 exhibits a specific anti-proliferative effect on T-ALL cells. UCPH-102 also shows good blood-brain permeability, which can be used in studies of amyotrophic lateral sclerosis, Alzheimer’s disease, chronic pain and obsessive compulsive disorder.
  • HY-112726
    PXS-4728A

    BI-1467335

    		 Monoamine Oxidase Inflammation/Immunology
    PXS-4728A (BI-1467335) is a selective, orally active inhibitor of semicarbazide-sensitive amine oxidase (SSAO). PXS-4728A ameliorates chronic obstructive pulmonary disease in mice.
  • HY-100007
    Vonoprazan

    TAK-438 free base

    		 Proton Pump Bacterial Endocrinology
    Vonoprazan (TAK-438 free base), a proton pump inhibitor (PPI), is a potent and orally active potassium-competitive acid blocker (P-CAB), with antisecretory activity. Vonoprazan inhibits H +,K +-ATPase activity in porcine gastric microsomes with an IC50 of 19 nM at pH 6.5. Vonoprazan is developed for the research of acid-related diseases, such as gastroesophageal reflux disease and peptic ulcer disease. Vonoprazan can be used for eradication of Helicobacter pylori.
  • HY-P1267
    α-Conotoxin PnIA

    		nAChR Neurological Disease
    α-Conotoxin PnIA, a potent and selective antagonist of the mammalian α7 nAChR, has the potential for the research of neurological conditions such as neuropathic pain and Alzheimer’s disease.
  • HY-P2562
    β-Amyloid (1-38), mouse, rat

    		Amyloid-β Neurological Disease
    β-Amyloid (1-38), mouse, rat is composed of 38 aa (1-38 residues of the Aβ peptide) and is the primary component of the amyloid plaques of Alzheimer’s disease.
  • HY-108017
    Ferric maltol

    		Others Metabolic Disease
    Ferric maltol is an orally active complex of a single ferric ion (Fe 3+). Ferric maltol has tha potential for iron deficiency anemia treatment in inflammatory bowel disease.
  • HY-N7480A
    Quinolactacin A1

    		Cholinesterase (ChE) Neurological Disease
    Quinolactacin A1 is a potent acetylcholinesterase (AChE) inhibitor from solid state fermentation of Penicillium citrinum 90648. Quinolactacin A1 can be used for the research of Alzheimer disease.
  • HY-W029659
    1-Benzyl-1,2,3,4-tetrahydro-isoquinoline

    		Endogenous Metabolite Neurological Disease
    1-Benzyl-1,2,3,4-tetrahydro-isoquinoline is an endogenous metabolite present in Cerebrospinal_Fluid that can be used for the research of Parkinson's Disease.
  • HY-N1362
    Salvianolic acid B

    Lithospermic acid B

    		 Autophagy Cardiovascular Disease
    Salvianolic acid B is an active ingredient of Salvia miltiorrhiza, which has been widely applied in China for the management of various microcirculation-related disorders, such as cardiovascular disease, cerebrovascular disease, and diabetic vascular complication.
  • HY-108411
    Emedastine

    		Histamine Receptor Inflammation/Immunology
    Emedastine is an orally active, selective and high affinity histamine H1 receptor antagonist with a Ki value of 1.3 nM. Emedastine is a benzimidazole derivative with potent antiallergic properties and used for allergic rhinitis, allergic skin diseases and allergic conjunctivitis.
  • HY-108464A
    Phenamil methanesulfonate

    		Sodium Channel TRP Channel Metabolic Disease Inflammation/Immunology
    Phenamil methanesulfonate, an analog of Amiloride (HY-B0285), is a more potent and less reversible epithelial sodium channel (ENaC) blocker with an IC50 of 400 nM. Phenamil methanesulfonate is also a competive inhibitor of TRPP3 and inhibits TRPP3-mediated Ca 2+ transport with an IC50 of 140 nM in a Ca 2+ uptake assay. Phenamil methanesulfonate is an intriguing small molecule to promote bone repair by strongly activating BMP signaling pathway. Phenamil methanesulfonate is used for the research of cystic fibrosis lung disease.
  • HY-101046
    Quipazine dimaleate

    		5-HT Receptor SARS-CoV Neurological Disease
    Quipazine dimaleate is a 5-HT agonist with a Ki value of 1.4 nM for displaces [3H]GR65630 from 5-HT3R in rat. Quipazine dimaleate shows antiviral activity against SARS-CoV-2 with an EC50 of 31.64 μM. Quipazine dimaleate behaves as a 5-HT3R antagonist in peripheral models. Quipazine dimaleate can be used for neurological disease research.
  • HY-152028
    HSP90-IN-19

    		HSP Cancer Infection Inflammation/Immunology Neurological Disease
    HSP90-IN-19 is an effective heat shock protein 90 (Hsp90) inhibitor. HSP90-IN-19 has effective Hsp90 inhibitory activity with an IC50 value of 0.27 μM. HSP90-IN-19 can be used for the research of viral infection, neurodegenerative disease, and inflammation.
  • HY-152027
    HSP90-IN-18

    		HSP Apoptosis Cancer Infection Inflammation/Immunology Neurological Disease
    HSP90-IN-18 is an effective heat shock protein 90 (Hsp90) inhibitor. HSP90-IN-18 has effective Hsp90 inhibitory activity with an IC50 value of 0.39 μM. HSP90-IN-18 can be used for the research of viral infection, neurodegenerative disease, and inflammation.
  • HY-113110
    Cysteinylglycine

    		Endogenous Metabolite Metabolic Disease
    Cysteinylglycine is an endogenous metabolite and used in disease diagnosis.
  • HY-W016443
    L-m-Tyrosine

    		Others Inflammation/Immunology Neurological Disease
    L-m-Tyrosine is an unnatural amino acid, that has potential in the research of Parkinsons disease, Alzheimers disease, and arthritis.
  • HY-139908
    MERS-CoV-IN-1

    		SARS-CoV Infection
    MERS-CoV-IN-1 exhibits excellent inhibitory activity against coronavirus. MERS-CoV-IN-1 is useful as a pharmaceutical composition for preventing coronavirus-induced diseases (MERS-CoV and SARS) (extracted from patent WO2018174442A1, compound 1).
  • HY-107935
    6α-Fluoroprednisolone

    Fluprednisolone

    		 Others Inflammation/Immunology
    6α-Fluoroprednisolone (Fluprednisolone) is an internal standard for methylprednisolone, prednisolone and prednisone. 6α-Fluoroprednisolone is an anti-inflammatory agent. 6α-Fluoroprednisolone can be used for congenital adrenal virilism and Addison's disease research.
  • HY-P1267A
    α-Conotoxin PnIA TFA

    		nAChR Neurological Disease
    α-Conotoxin PnIA TFA, a potent and selective antagonist of the mammalian α7 nAChR, has the potential for the research of neurological conditions such as neuropathic pain and Alzheimer’s disease.
  • HY-125967
    AM 374

    		FAAH Neurological Disease
    AM 374 is an fatty acid amide hydrolase (FAAH) inhibitor. AM 374 inhibits amidase activity with an IC50 value of 13 nM. AM 374 can be used for the research of neurological disease.
  • HY-W013372
    7,8-Dihydroxyflavone

    		Trk Receptor Apoptosis Neurological Disease
    7,8-Dihydroxyflavone is a potent and selective TrkB agonist that mimics the physiological actions of Brain-derived neurotrophic factor (BDNF). Displays therapeutic efficacy toward various neurological diseases.
  • HY-116459
    trans-Cevimeline hydrochloride

    AF102A hydrochloride

    		 mAChR Neurological Disease
    Trans-Cevimeline (AF102A) (hydrochloride), as a trans-isomer of AF102B, is a M1 selective cholinergic agonist. Trans-Cevimeline (AF102A) (hydrochloride) can be used for the research of Alzheimer's disease.
  • HY-103479
    GOAT-IN-1

    		Acyltransferase Cancer Metabolic Disease Neurological Disease Cardiovascular Disease
    GOAT-IN-1 is an inhibitor of ghrelin O-acyltransferase (GOAT), which could be useful for the prophylaxis or treatment of obesity, diabetes, hyperlipidemia, metabolic, non-alcoholic fatty liver, steatohepatitis, sarcopenia, appetite control, alcohol/narcotic dependence, Alzheimer’s disease, Parkinson’s disease, cerebrovascular dementia, cerebral apoplexy, cerebral infarction, cardic disease, some kind of tumors.
  • HY-Y0055
    Phenothiazine

    Thiodiphenylamine

    		 Antibiotic Fungal Bacterial Parasite Infection Neurological Disease
    Phenothiazine is an antibiotic which has insecticidal, fungicidal, antibacterial and anthelmintic activities. Phenothiazine also can be used for the research of neurological diseases.
  • HY-13779
    J-147

    		Monoamine Oxidase Dopamine Transporter Neurological Disease
    J-147 is an exceptionally potent, orally active, neuroprotective agent for cognitive enhancement. J-147 can readily pass the blood brain barrier (BBB). J-147 can inhibit monoamine oxidase B (MAO B) and the dopamine transporter with EC50 values of 1.88 μM and 0.649 μM, respectively. J-147 has potential for the treatment of Alzheimer’s disease (AD).
  • HY-B0520
    Benztropine

    Benzatropine; Benzotropine

    		 Dopamine Receptor mAChR Histamine Receptor
    Benztropine (Benzatropine; Benzotropine) is an orally active centrally acting anticholinergic agent that can be used for Parkinson's disease research. Benztropine is an anti-histamine agent and a dopamine re-uptake inhibitor. Benztropine is also a human D2 dopamine receptor allosteric antagonist. Benztropine mesylate also has anti-CSCs (cancer stem cells) effects.
  • HY-142703
    RORγt inverse agonist 28

    		ROR Inflammation/Immunology
    RORγt inverse agonist 28 is a potent reverse agonist of RORγt. RORγt inverse agonist 28 regulates the differentiation of Th17 cells and inhibits the production of IL-17. RORγt inverse agonist 28 has the potential for the research of inflammation and autoimmune diseases (extracted from patent WO2021228215A1, compound 6) .
  • HY-142806
    RORγt inverse agonist 26

    		ROR Inflammation/Immunology
    RORγt inverse agonist 26 is a potent reverse agonist of RORγt. RORγt inverse agonist 26 regulates the differentiation of Th17 cells and inhibits the production of IL-17. RORγt inverse agonist 26 has the potential for the research of inflammation and autoimmune diseases (extracted from patent WO2021228215A1, compound 1) .
  • HY-148322
    Sirtuin modulator 5

    		Sirtuin Cancer Infection Metabolic Disease Inflammation/Immunology Neurological Disease
    Sirtuin modulator 5 is a sirtuin modulating agent. Sirtuin modulator 5 can activate SIRT1 with a DC50 value of <50 μM. Sirtuin modulator 5 can be used for increasing the lifespan of a cell and used for the research of variety of diseases including, for example, diseases or disorders related to aging or stress, diabetes, obesity, neurodegenerative diseases, cardiovascular disease, blood clotting disorders, inflammation, cancer, and/or flushing as well as diseases or disorders that would benfit from increased mitochondrial activity.
  • HY-101283
    HCH6-1

    		Formyl Peptide Receptor (FPR) Inflammation/Immunology
    HCH6-1 is a potent and competitive dipeptide antagonist of Formyl peptide receptor 1 (FPR1). HCH6-1 inhibits chemotaxis, superoxide anion generation, and elastase release in human neutrophils specifically activated by fMLF (an FPR1 agonist). HCH6-1 has protective effects against acute lung injury (ALI) in vivo and can be used for the research of FPR1-involved inflammatory lung diseases.
  • HY-P3977
    ACTH (3-24) (human, bovine, mouse, ovine, porcine, rabbit, rat)

    		Melanocortin Receptor Cancer Inflammation/Immunology Cardiovascular Disease
    ACTH (3-24) (human, bovine, mouse, ovine, porcine, rabbit, rat) is the 3-24 fragment of adrenocorticotropic hormone (ACTH). ACTH (3-24) (human, bovine, mouse, ovine, porcine, rabbit, rat) can be used for research of a variety of diseases, including cancer, immune diseases, cardiovascular disease.