2. Search Result
Search Result
Pathways Recommended: Anti-infection
Results for "

infections

" in MCE Product Catalog:

6338

Inhibitors & Agonists

18

Screening Libraries

29

Fluorescent Dye

39

Biochemical Assay Reagents

359

Peptides

104

Inhibitory Antibodies

1510

Natural
Products

555

Isotope-Labeled Compounds

Cat. No. Product Name Target Research Areas
  • HY-145713
    HBV-IN-19

    		HBV Infection
    HBV-IN-19 inhibits hepatitis B virus (HBV) infection. Inhibiting HBsAg secretion and/or production is a strategy for the treatment of HBV infection, including chronic HBV infection.
  • HY-145713A
    HBV-IN-19 TFA

    		HBV Infection
    HBV-IN-19 TFA inhibits hepatitis B virus (HBV) infection. Inhibiting HBsAg secretion and/or production is a strategy for the treatment of HBV infection, including chronic HBV infection.
  • HY-N7139
    Penicillin G

    Benzylpenicillin

    		 Antibiotic Bacterial Infection
    Penicillin G is a potent penicillinantibiotic. Penicillin G can be used for bacterial infection.
  • HY-B1702
    Nifuroxime

    		Fungal Infection
    Nifuroxime is an anti-infective agent. Nifuroxime can be used in the research of fungal infections.
  • HY-139755
    Antibacterial agent 38

    		Bacterial Infection
    Antibacterial agent 38 is an antibacterial agent extracted from patent WO2015063714A1, compound C. Antibacterial agent 38 can be used for the research of bacterial infections.
  • HY-139754
    Antibacterial agent 37

    		Bacterial Infection
    Antibacterial agent 37 is an antibacterial agent extracted from patent WO2015063714A1, compound B. Antibacterial agent 37 can be used for the research of bacterial infections.
  • HY-139761
    Antibacterial agent 44

    		Bacterial Infection
    Antibacterial agent 44 is an antibacterial agent extracted from patent WO2013030735A1, example 7. Antibacterial agent 44 can be used for the research of bacterial infections.
  • HY-139763
    Antibacterial agent 46

    		Bacterial Infection
    Antibacterial agent 46 is an antibacterial agent extracted from patent WO2013030735A1, example 9. Antibacterial agent 46 can be used for the research of bacterial infections.
  • HY-139760
    Antibacterial agent 43

    		Bacterial Infection
    Antibacterial agent 43 is an antibacterial agent extracted from patent WO2013030735A1, example 6. Antibacterial agent 43 can be used for the research of bacterial infections.
  • HY-128502
    Nifurtoinol

    		Bacterial Antibiotic Infection
    Nifurtoinol is a nitrofuran-derivative antibiotic with antibacterial effects. Nifurtoinol can be used for the research of urinary tract infections.
  • HY-119900
    Carnidazole

    		Parasite Antibiotic Infection
    Carnidazole is an antiprotozoal agent of the nitroimidazole class. Carnidazole is used for the research of Trichomonas infection.
  • HY-P99433
    Alvircept sudotox

    U 85855

    		 HIV Infection
    Alvircept sudotox is a recombinant CD4 derived from Pneumonas aeruginosa exotoxin A. Alvircept sudotox can be used in the research of HIV infections.
  • HY-106571
    Cefteram pivoxil

    Ro 19-5248; T-2588

    		 Bacterial Antibiotic Infection
    Cefteram pivoxil (Ro 19-5248), an orally active cephalosporin antibiotic, is used for bacterial infections.
  • HY-109004
    Enzaplatovir

    BTA-C585

    		 RSV Infection
    Enzaplatovir (BTA-C585) is an orally bioavailable Inhibitor for respiratory syncytial virus (RSV) infection.
  • HY-A0090
    Nitrofurantoin

    		Bacterial Antibiotic Infection
    Nitrofurantoin is a potent and orally active broad-spectrum beta-lactamase antimicrobial agent. Nitrofurantoin acts as an antibiotic and can be used for the study of urinary tract infections (UTIs), including cystitis and kidney infections.
  • HY-148160A
    Diamthazole hydrochloride

    Dimazole hydrochloride

    		 Fungal Infection
    Diamthazole (Dimazole) hydrochloride is an antifungal agent. Diamthazole hydrochloride can be used for the research of infection.
  • HY-148160
    Diamthazole

    Dimazole

    		 Fungal Infection
    Diamthazole (Dimazole) is an antifungal agent. Diamthazole can be used for the research of infection.
  • HY-W039454
    2,4-Dichlorobenzyl alcohol

    		Bacterial Infection
    2,4-Dichlorobenzyl alcohol is a mild antiseptic, with a broad spectrum for bacterial and virus associated with mouth and throat infections.
  • HY-P99586
    Suptavumab

    REGN2222

    		 RSV Infection
    Suptavumab (REGN2222) is a human monoclonal antibody. Suptavumab can bind and block a conserved epitope on RSV A and B subtypes. Suptavumab can be used for the research of RSV infection.
  • HY-108971
    Demecycline

    		Bacterial Infection
    Demecycline, a tetracycline antibiotic, is the C6-demethylated derivative of Tetracycline (HY-A0107) against bacterial infections including pneumonia and other respiratory tract infections.
  • HY-117582
    Elvucitabine

    		Reverse Transcriptase HIV Infection
    Elvucitabine is an L-nucleoside analogue. Elvucitabine is a potent nucleoside reverse transcriptase (RT) inhibitor. Elvucitabine can be used in research of viral infection.
  • HY-A0253
    Cefacetrile

    Cephacetrile; Cephacetril

    		 Bacterial Antibiotic Infection
    Cefacetrile (Cephacetrile) is a broad-spectrum antibiotic that is effective in gram-positive and gram-negative bacterial infection.
  • HY-B0337A
    Sulfadimethoxine sodium

    Sulphadimethoxine sodium

    		 Bacterial Antibiotic Infection
    Sulfadimethoxine sodium (Sulphadimethoxine sodium) is a sulfonamide antibiotic used to treat many infections.
  • HY-B0337
    Sulfadimethoxine

    Sulphadimethoxine

    		 Bacterial Antibiotic Infection
    Sulfadimethoxine (Sulphadimethoxine) is a sulfonamide antibiotic used to treat many infections.
  • HY-W009886
    3,4,5-Trimethoxybenzaldehyde

    		Bacterial Infection
    3,4,5-Trimethoxybenzaldehyde is an intermediate for the synthesis of various pharmaceuticals, especially for?trimethoprim?used to research bacterial infections, including urinary tract pathogens infection.
  • HY-139751
    β-Lactamase-IN-4

    		Bacterial Infection
    β-Lactamase-IN-4 is a β-lactamase inhibitor extracted from patent WO2013149121A1, compound 708. β-Lactamase-IN-4 can be used for the research of bacterial infections.
  • HY-139779
    β-Lactamase-IN-5

    		Bacterial Infection
    β-Lactamase-IN-5 is a β-lactamase inhibitor extracted from patent WO2013149121A1, compound 720. β-Lactamase-IN-5 can be used for the research of bacterial infections.
  • HY-B0555B
    Nafcillin sodium

    		Antibiotic Bacterial Infection
    Nafcillin sodium, an antibiotic, is a reversible inhibitor of β-lactamase. Nafcillin sodium can be used for the research of staphylococcal infections.
  • HY-131554
    Tibezonium iodide

    		Bacterial Antibiotic Infection
    Tibezonium iodide, an oropharyngeal disinfectant, has antibacterial activity for the prevention of mouth infections.
  • HY-119123
    Voxvoganan

    LTX-109

    		 Fungal Bacterial Infection
    Voxvoganan (LTX-109), a topical antimicrobial, is highly effective against S. aureus with a MIC range of 2 to 4 μg/mL. Voxvoganan can be used for the research of bacterial skin infections, fungal infections and nasal decolonisation of MRSA.
  • HY-119123A
    Voxvoganan trihydrochloride

    LTX-109 trihydrochloride

    		 Bacterial Fungal Infection
    Voxvoganan (LTX-109) trihydrochloride, a topical antimicrobial, is highly effective against S. aureus with a MIC range of 2 to 4 μg/mL. Voxvoganan trihydrochloride can be used for the research of bacterial skin infections, fungal infections and nasal decolonisation of MRSA.
  • HY-A0111
    Cefetamet

    Ro 15-8074; Deacetoxycefotaxime

    		 Antibiotic Bacterial Infection
    Cefetamet is a cephalosporin antibiotic. Cefetamet has the potential for the research of both upper and lower community-acquired respiratory tract infections.
  • HY-133937
    Sulfametrole

    		Bacterial HIV Infection
    Sulfametrole is an orally active and potent antibacterial. Sulfametrole can be used for infections research, such as HIV, severe pneumonia and UTIs (urinary tract infections).
  • HY-108880
    Carindacillin sodium

    Carbenicillin indanyl sodium; CP-15464-2

    		 Bacterial Infection
    Carindacillin (Carbenicillin indanyl) sodium is an orally active and broad-spectrum antimicrobial agent. Carindacillin sodium can be hydrolyzed to Carbenicillin in vivo. Carindacillin sodium can be used for the research of urinary-tract infection.
  • HY-131596
    Emtricitabine triphosphate

    (-)-Emtricitabine triphosphate

    		 HIV Infection
    Emtricitabine triphosphate ((-)-Emtricitabine triphosphate) is the phosphorylated anabolite of Emtricitabine (HY-17427). Emtricitabine is a nucleoside reverse transcriptase inhibitor. Emtricitabine is antiretroviral agent for HIV and HBV infection.
  • HY-B0455A
    Lomefloxacin

    SC47111A

    		 Bacterial Antibiotic Infection
    Lomefloxacin (SC47111A) is a broad-spectrum quinolone antibiotic, with antimicrobial activity. Lomefloxacin is used for the research of respiratory tract infections, genitourinary infections, gastrointestinal infections, ENT infections, etc..
  • HY-B0337S1
    Sulfadimethoxine-d6

    Sulphadimethoxine-d6

    		 Bacterial Antibiotic Infection
    Sulfadimethoxine-d6 is the deuterium labeled Sulfadimethoxine. Sulfadimethoxine is a sulfonamide antibiotic used to treat many infections[1].
  • HY-106296
    WIN 54954

    		Enterovirus Infection
    WIN 54954 is an orally active and broad-spectrum antipicornavirus agent. WIN 54954 is effectiveness against human rhinovirus, echovirus 9 and enterovirus infections.
  • HY-B0455
    Lomefloxacin hydrochloride

    SC47111A hydrochloride

    		 Bacterial Antibiotic Infection
    Lomefloxacin (SC47111A) hydrochloride is a broad-spectrum quinolone antibiotic, with antimicrobial activity. Lomefloxacin hydrochloride is used for the research of respiratory tract infections, genitourinary infections, gastrointestinal infections, ENT infections, etc..
  • HY-B0198A
    Cefaclor monohydrate

    		Bacterial Antibiotic Infection
    Cefaclor (monohydrate) is a well-absorbed orally active cephalosporin antibiotic. Cefaclor can specifically bind to specific for penicillin-binding protein 3 (PBP3). Cefaclor can be used for the research kinds of infections caused by bacteria, such as respiratory tract infections, bacterial bronchitis, pharyngitis and skin infections.
  • HY-B0198
    Cefaclor

    		Bacterial Antibiotic Infection
    Cefaclor is a well-absorbed orally active cephalosporin antibiotic. Cefaclor can specifically bind to specific for penicillin-binding protein 3 (PBP3). Cefaclor can be used for the research kinds of infections caused by bacteria, such as respiratory tract infections, bacterial bronchitis, pharyngitis and skin infections.
  • HY-P99564
    Teropavimab

    3BNC117-LS; GS-5423

    		 HIV Infection Inflammation/Immunology
    Teropavimab (3BNC117-LS) is an antibody. Teropavimab can be used for the research of HIV infection.
  • HY-W008216S
    HMMNI-d3

    Hydroxy Dimetridazole-d3

    		 Isotope-Labeled Compounds Drug Metabolite Infection
    HMMNI-d3 is deuterium labeled HMMNI. HMMNI (Hydroxy dimetridazole) is a hydroxy metabolite of Dimetridazole. Dimetridazole is a nitroimidazole class agent that combats protozoan infections[1].
  • HY-B0996
    Hexetidine

    NSC-17764

    		 Bacterial Fungal Infection
    Hexetidine is an orally active antiseptic with broad antibacterial and antifungal activity. Hexetidine give important potential for treatment of oral infections.
  • HY-113715
    Niclofolan

    BAY 9015; Menichlopholan; Menichlofolan; Bilevon

    		 Parasite Infection
    Niclofolan (BAY 9015) is an orally active anthelmintic agent. Niclofolan can be used in the research of parasite infection.
  • HY-117660
    Lincomycin

    U-10149

    		 Antibiotic Bacterial Infection
    Lincomycin, a lincosamide antibiotic, is an antimicrobial agent used for the research of Gram-positive bacteria infections.
  • HY-151418
    Chitin synthase inhibitor 8

    		Fungal Infection
    Chitin synthase inhibitor 8 is a chitin synthase (CHS) inhibitor with broad-spectrum antifungal activity. Chitin synthase inhibitor 8 can be used in the research of fungi infection.
  • HY-151419
    Chitin synthase inhibitor 9

    		Fungal Infection
    Chitin synthase inhibitor 9 is a chitin synthase (CHS) inhibitor with broad-spectrum antifungal activity. Chitin synthase inhibitor 9 can be used in the research of fungi infection.
  • HY-144093
    HPK1-IN-26

    		MAP4K Infection
    HPK1-IN-26 is a HPK1 and GLK inhibitor extracted from patent WO2021254118A1 compound 1. HPK1-IN-26 can be used for the research of animal pathogen infection.
  • HY-132823
    Ledaborbactam

    VNRX-5236

    		 Bacterial Infection
    Iedaborbactam (VNRX-5236), as a β-lactamase inhibitor (WO2015191907, Example 62), can be used for the research of bacterial infections.
  • HY-16472
    Sulfacytine

    		Antibiotic Bacterial Infection
    Sulfacytine is a short-acting sulfonamide antibiotic. Sulfacytine is active against bacteria and is an effective agent for the research of acute uncomplicated urinary tract infections.
  • HY-135117
    Glyceryl monocaprate

    Monocaprin

    		 Bacterial HSV Infection
    Glyceryl monocaprate (Monocaprin) is a 1-monoglyceride of capric acid against gram-positive bacterial infections. Glyceryl monocaprate (Monocaprin has inhibitory effect on Herpes Simplex Virus (HSV) and offers an effective treatment for herpes labialiss.
  • HY-147015
    HOE961

    		Orthopoxvirus Infection
    HOE961, the diacetate ester proagent of S2242, is active against respiratory cowpox virus infections, is orally active in infection models. Anti-orthopoxvirus activity.
  • HY-17592A
    Bithionol (sulfoxide)

    		Parasite Infection
    Bithionol sulfoxide is an anti-infection agent for parasites. Bithionol sulfoxide has mutagenic activity. Bithionol sulfoxide can be used in the research of parasite infection, such as paragonimiasis, flukes andcestodes infection.
  • HY-132282
    Thiamphenicol glycinate hydrochloride

    		Bacterial Infection
    Thiamphenicol glycinate hydrochloride is a broad-spectrum antibacterial agent that can be used for respiratory tract infections research.
  • HY-19964
    Potassium clavulanate cellulose

    Potassium clavulanate:cellulose (1:1)

    		 Bacterial Antibiotic Infection
    Potassium clavulanate cellulose (Potassium clavulanate:cellulose (1:1)) is a mixture of potassium clavulanate and cellulose, is a bacterial β-lactamase inhibitor. Clavulanate potassium is a form of Clavulanic acid. Clavulanate potassium fights bacteria that resistant to penicillins and other antibiotics. Potassium clavulanate with the combination of amoxicillin can be used for the research of different infections caused by bacteria, such as sinusitis, pneumonia, ear infections, bronchitis, urinary tract infections, and infections of the skin.
  • HY-P3425
    AGPV

    		Parasite Infection
    AGPV, a tetrapeptide, has the potential for prevention of schistosome parasite infection research.
  • HY-12641A
    Pyrantel

    		nAChR Antibiotic Parasite Infection
    Pyrantel is an orally active anthelmintic and an agonist of the nicotinic acetylcholine receptor (nAChR). Pyrantel can cause spasmodic muscle paralysis in parasites. Pyrantel can be used in the study of parasitic infections such as ascariasis, hookworm infections, intestinal worms (pinworm infections), trichinosis and trichinosis.
  • HY-106959
    Flurithromycin

    (8S)-8-Fluoroerythromycin A; P-0501A

    		 Antibiotic Bacterial Infection
    Flurithromycin ((8S)-8-Fluoroerythromycin A) is an orally active broad spectrum antibiotic. Flurithromycin can be used in the research of bacterial infections.
  • HY-138502
    Melarsomine

    		Parasite Infection
    Melarsomine is a trivalent arsenical compound used as an adulticide. Melarsomine can be used for the reserach of canine heartworm disease and other helminth infections.
  • HY-138502A
    Melarsomine dihydrochloride

    		Parasite Infection
    Melarsomine dihydrochloride is a trivalent arsenical compound used as an adulticide. Melarsomine dihydrochloride can be used for the reserach of canine heartworm disease and other helminth infections.
  • HY-P3425A
    AGPV TFA

    		Parasite Infection
    AGPV TFA, a tetrapeptide, has the potential for prevention of schistosome parasite infection research.
  • HY-P3417
    Amp1EP9

    		Bacterial Infection
    Amp1EP9 is an antimicrobial peptide. Amp1EP9 is a powerful tool for developing potent and nontoxic antimicrobial agents. Amp1EP9 has the potential for the research of multidrug-resistant bacterial infections.
  • HY-14737
    Ceftaroline fosamil

    TAK-599; PPI0903

    		 Bacterial Antibiotic Infection
    Ceftaroline fosamil (TAK-599), a cephalosporin derivative, is an N-phosphono proagent of anti-methicillin-resistant Staphylococcus aureus (MRSA) T-91825. Ceftaroline fosamil can be used for the research of MRSA infection.
  • HY-12641
    Pyrantel tartrate

    		Parasite nAChR Antibiotic Infection
    Pyrantel tartrate is an orally active anthelmintic and an agonist of the nicotinic acetylcholine receptor (nAChR). Pyrantel tartrate can cause spasmodic muscle paralysis in parasites. Pyrantel tartrate can be used in the study of parasitic infections such as ascariasis, hookworm infections, intestinal worms (pinworm infections), trichinosis and trichinosis.
  • HY-14738
    Ceftaroline fosamil inner salt

    TAK-599 free acid; PPI0903 free acid

    		 Bacterial Antibiotic Infection
    Ceftaroline fosamil (TAK-599) inner salt, a cephalosporin derivative, is an N-phosphono proagent of anti-methicillin-resistant Staphylococcus aureus (MRSA) T-91825. Ceftaroline fosamil inner salt can be used for the research of MRSA infection.
  • HY-12640
    Pyrantel pamoate

    Pyrantel embonate

    		 Parasite nAChR Antibiotic Infection
    Pyrantel pamoate (Pyrantel embonate) is an orally active anthelmintic and an agonist of the nicotinic acetylcholine receptor (nAChR). Pyrantel pamoate can cause spasmodic muscle paralysis in parasites. Pyrantel pamoate can be used in the study of parasitic infections such as ascariasis, hookworm infections, intestinal worms (pinworm infections), trichinosis and trichinosis.
  • HY-124871
    LASV inhibitor 3.3

    		Arenavirus Infection
    LASV inhibitor 3.3 is a Lassa fever virus (LASV) inhibitor. LASV inhibitor 3.3 binds with LASV glycoprotein (GP) and promotes virus membrane fusion and infection. LASV inhibitor 3.3 can be used for LASV infection research.
  • HY-14749
    Pyronaridine

    		Parasite Infection
    Pyronaridine is an orally active Mannich base anti-malarial agent. Pyronaridine is active against P. falciparum and Echinococcus granulosus infection.
  • HY-153062
    6-Chloro-7-deazapurine-2F-β-D-arabinofuranose

    		HCV Infection
    6-Chloro-7-deazapurine-2F-β-D-arabinofuranose is a nucleoside derivative. 6-Chloro-7-deazapurine-2F-β-D-arabinofuranose can be used for synthesis of antiviral agent against hepatitis C virus infection.
  • HY-P2292A
    Omiganan-FITC TFA

    		Bacterial Fungal Infection
    Omiganan-FITC TFA is a peptide-FITC complex composed of Omiganan and a FITC. Omiganan is a bactericidal and fungicidal cationic peptide being developed as a topical gel for prevention of catheter-associated infections.
  • HY-106882
    GE 2270A

    MDL 62879

    		 Bacterial Antibiotic Infection
    GE 2270A (MDL 62879) is an antibiotic. GE 2270A inhibits gram-positive bacteria and anaerobes by inhibiting protein synthesis. GE 2270A can be used for the research of infection.
  • HY-W013266
    N4-Acetylsulfamethoxazole

    Acetylsulfamethoxazole

    		 Bacterial Infection Metabolic Disease
    N4-Acetylsulfamethoxazole (Acetylsulfamethoxazole) is a metabolite of Sulfamethoxazole (HY-B0322). Sulfamethoxazole is a sulfonamide bacteriostatic antibiotic, used for bacterial infections.
  • HY-119480
    Megazol

    		Bacterial Infection
    Megazol is an orally active antibacterial agent. Megazol has effective inhibitory against T. b. brueei with an EC50 of 0.01 μg/mL. Megazol can be used for the research of protozoan infections.
  • HY-130627
    RSV/IAV-IN-2

    		RSV Influenza Virus Infection
    RSV/IAV-IN-2 (compound 14c) is a potent and dual inhibitor of RSV/IAV. RSV/IAV-IN-2 has lesser cytotoxicity than the clinical agent, Ribavirin. RSV/IAV-IN-2 has the potential for the research of RSV and/or IAV infections.
  • HY-130626
    RSV/IAV-IN-1

    		RSV Influenza Virus Infection
    RSV/IAV-IN-1 (compound 14e) is a potent and dual inhibitor of RSV/IAV. RSV/IAV-IN-1 has lesser cytotoxicity than the clinical agent, Ribavirin. RSV/IAV-IN-1 has the potential for the research of RSV and/or IAV infections.
  • HY-A0090A
    Nitrofurantoin sodium

    		Antibiotic Bacterial Infection
    Nitrofurantoin sodium is a potent and orally active antibacterial agent. Nitrofurantoin sodium acts as an antibiotic. Nitrofurantoin sodium can be used for the study of urinary tract infections (UTIs), including cystitis and kidney infections.
  • HY-P3383
    Peceleganan

    PL-5

    		 Bacterial Infection
    Peceleganan (PL-5) is an artificial antimicrobial cecropin A (1-10) × melittin B (3-18) hybrid (10+16)-peptide analogue. Peceleganan inhibits wound infection.
  • HY-P3383A
    Peceleganan acetate

    PL-5 acetate

    		 Bacterial Infection
    Peceleganan (PL-5) acetate is an artificial antimicrobial cecropin A (1-10) × melittin B (3-18) hybrid (10+16)-peptide analogue. Peceleganan acetate inhibits wound infection.
  • HY-14749A
    Pyronaridine tetraphosphate

    		Parasite Infection
    Pyronaridine tetraphosphate is an orally active Mannich base anti-malarial agent. Pyronaridine tetraphosphate is active against P. falciparum and Echinococcus granulosus infection.
  • HY-151936
    LmNADK1-IN-1

    		Bacterial Infection
    LmNADK1-IN-1 (compound MC1) is an inhibitor of nicotinamide adenine dinucleotide kinases (NADK1) from L. monocytogenes with a Ki value of 54 nM. LmNADK1-IN-1 can be used for the research of bacterial infection.
  • HY-144108
    HCV-IN-35

    		HCV Infection
    HCV-IN-35 (Compound (R)-3h) is a potent inhibitor of HCV. HCV-IN-35 has the potential for the research infection diseases.
  • HY-145596
    Sirpefenicol

    ZTS-00007928

    		 Bacterial Infection
    Sirpefenicol (ZTS-00007928) is a phenicol antibacterial agent. Sirpefenicol can be used in bacterial infections in animals (extracted from patent WO2020068607A1).
  • HY-B0395C
    Sitafloxacin hydrate

    DU6859a hydrate

    		 Bacterial Antibiotic Infection
    Sitafloxacin (DU6859a) hydrate is a potent, orally active fluoroquinolone antibiotic with in vitro activity against a broad range of gram-positive and gram-negative bacteria, including anaerobic bacteria, as well as against atypical pathogens. Sitafloxacin can be used for the research of respiratory tract infection and urinary tract infection.
  • HY-N11366
    Hadogenes Troglodytes Venom

    South African Rock Scorpion Venom

    		 Others Infection
    Hadogenes Troglodytes Venom (South African Rock Scorpion Venom) is venom that can be obtained from Hadogenes troglodytes. Hadogenes Troglodytes Venom can be used for the research of ion channel-associated diseases, and infections.
  • HY-117411A
    Coblopasvir dihydrochloride

    KW-136 dihydrochloride

    		 HCV HCV Protease Infection
    Coblopasvir (KW-136) dihydrochloride is a pangenotypic non-structural protein 5A (NS5A) inhibitor. Coblopasvir dihydrochloride can be used for research of chronic hepatitis C virus infection.
  • HY-P3021
    Human milk lysozyme

    		Bacterial Biochemical Assay Reagents Infection
    Human milk lysozyme is the lysozyme found in human milk. Human milk lysozyme is thought to be a key defense factor in protecting the gastrointestinal tract of newborns against bacterial infection.
  • HY-B1369
    Imipenem monohydrate

    N-Formimidoyl thienamycin monohydrate; MK0787 monohydrate

    		 Bacterial Antibiotic Infection
    Imipenem monohydrate, a stable crystalline derivative of thienamycin, is an antibiotic and has the excellent activity against a broad range of gram-positive and gram-negative aerobic and anaerobic bacteria. Imipenem monohydrate can be used for the research of carbapenem-nonsusceptible and P. aeruginosa biofilm infections.
  • HY-139554
    Zifanocycline

    KBP-7072

    		 Bacterial Infection
    Zifanocycline (KBP-7072) is a semisynthetic third-generation aminomethylcycline antibiotic that inhibits the normal function of the bacterial ribosome. Zifanocycline exhibits a broad spectrum of in vitro antibacterial activity against Gram-positive and Gram-negative bacteria, including many multidrug-resistant pathogens. Zifanocycline is available in both oral and injectable formulations. Zifanocycline can be used for the research of acute bacterial skin and skin structure infections, community-acquired bacterial pneumonia, and complicated intra-abdominal infections.
  • HY-P9944
    Palivizumab

    MEDI 493

    		 RSV Infection
    Palivizumab (MEDI 493), a humanized respiratory syncytial virus monoclonal antibody, reduces respiratory syncytial virus (RSV) infection.
  • HY-B0395A
    Sitafloxacin hydrochloride

    DU6859a hydrochloride

    		 Antibiotic Bacterial Infection
    Sitafloxacin (DU6859a) hydrochloride is a potent, orally active fluoroquinolone antibiotic. Sitafloxacin hydrochloride shows antichlamydial activity and antibacterial activities against a broad range of gram-positive and gram-negative bacteria, including anaerobic bacteria, as well as against atypical pathogens. Sitafloxacin hydrochloride can be used for the research of respiratory tract infection and urinary tract infection.
  • HY-B0395
    Sitafloxacin

    DU6859a

    		 Bacterial Antibiotic Infection
    Sitafloxacin (DU6859a) is a potent, orally active fluoroquinolone antibiotic. Sitafloxacin shows antichlamydial activity and antibacterial activities against a broad range of gram-positive and gram-negative bacteria, including anaerobic bacteria, as well as against atypical pathogens. Sitafloxacin can be used for the research of respiratory tract infection and urinary tract infection.
  • HY-151416
    Chitin synthase inhibitor 6

    		Fungal Infection
    Chitin synthase inhibitor 6 (compound 9b) is a potent chitin synthase (CHS) inhibitor with an IC50 value of 0.21 mM. Chitin synthase inhibitor 6 has broad-spectrum antifungal activity against drug-resistant fungi. Chitin synthase inhibitor 6 can be used in the research of fungi infection.
  • HY-151417
    Chitin synthase inhibitor 7

    		Fungal Infection
    Chitin synthase inhibitor 7 (compound 9c) is a potent chitin synthase (CHS) inhibitor with an IC50 value of 0.37 mM. Chitin synthase inhibitor 7 has broad-spectrum antifungal activity against drug-resistant fungi. Chitin synthase inhibitor 7 can be used in the research of fungi infection.
  • HY-105088
    Pexiganan

    MSI 78 free base

    		 Bacterial Infection
    Pexiganan (MSI 78 free base) is a synthetic analog of magainin 2. Pexiganan is a potent and orally active broad-spectrum antimicrobial peptide. Pexiganan can be used in the research of infections, such as diabetic foot ulcer infections.
  • HY-120832
    Azt-pmap

    		HIV Infection
    Azt-pmap, a nucleoside analogue, is an aryl phosphate derivative of AZT. Azt-pmap shows anti-HIV activity. AZT is a nucleoside reverse transcriptase inhibitor (NRTI) for HIV infection.
  • HY-B1369A
    Imipenem

    N-Formimidoyl thienamycin; MK0787

    		 Antibiotic Bacterial Infection
    Imipenem (MK0787), a stable crystalline derivative of thienamycin, is an antibiotic and has the excellent activity against a broad range of gram-positive and gram-negative aerobic and anaerobic bacteria. Imipenem can be used for the research of carbapenem-nonsusceptible and P. aeruginosa biofilm infections.
  • HY-P4055
    GP120, HIV-1 MN

    		HIV Infection Inflammation/Immunology
    GP120, HIV-1 MN is a peptide. GP120, HIV-1 MN can be used for the research of HIV infection.
  • HY-148315
    GLUT1-IN-2

    		GLUT Infection
    GLUT1-IN-2 (compound 17) is a GLUT1 inhibitor with an IC50 value of 12 μM. GLUT1-IN-2 shows inhibitory effect to Plasmodium falciparum hexose transporter PfHT with an IC50 value of 13 μM. GLUT1-IN-2 can be used for the research of infection.
  • HY-16745
    Lascufloxacin

    KRP-AM1977X

    		 Bacterial Antibiotic Infection
    Lascufloxacin (KRP-AM1977X) is a potent and orally active fluoroquinolone antibacterial agent. Lascufloxacin potently inhibits infections caused by various pathogens, including quinolone-resistant strains. Lascufloxacin has the potential for various infectious diseases treatment, including lower respiratory tract infections.
  • HY-P99764
    Odesivimab

    REGN-3471

    		 Influenza Virus Infection
    Odesivimab is a humanized monoclonal antibody, targeting Ebola virus glycoprotein with a KD value of 7.74 nM for recombinant histidine-tagged Makona strain Ebola virus glycoprotein ectodomain protein. Odesivimab can be used in research of Ebola virus infection.
  • HY-121211
    Digitolutein

    		Parasite Infection
    Digitolutein is a natural product that can be isolated from the stem bark and the roots of Morinda lucida Benth. Digitolutein effectively inhibits the growth of Plasmodium falciparum with an IC50 value of 12.92 μg/mL. Digitolutein can be used for the research of infection.
  • HY-107798
    Potassium guaiacolsulfonate hemihydrate

    		Bacterial Infection
    Potassium guaiacolsulfonate hemihydrate is an orally active expectorant used for acute respiratory tract infections. Potassium guaiacolsulfonate hemihydrate helps loosen mucus and used for a cough caused by the common cold, infections or allergies in combination with other agents.
  • HY-138646
    Poly(deoxyadenylic-thymidylic) acid sodium

    		Biochemical Assay Reagents Cancer Infection
    Polydeoxyadenylic-thymidylic acid sodium is a synthetic DNA polymer. Polydeoxyadenylic-thymidylic acid sodium can be used to determine the activity of bound and free ribonucleic acid polymerase. Polydeoxyadenylic-thymidylic acid sodium can be used for the research of cancer and virus infection.
  • HY-128036
    ddATP

    2',3'-Dideoxyadenosine 5'-triphosphate

    		 DNA/RNA Synthesis HIV Infection
    ddATP (2',3'-Dideoxyadenosine 5'-triphosphate), an active metabolite of 2',3'-dideoxyinosine, is a chain-elongating inhibitor of DNA polymerase. ddATP can be used for Sanger method for DNA sequencing and research of virus infection.
  • HY-P99770
    Omodenbamab

    514-G3

    		 Bacterial Infection
    Omodenbamab is an anti-SpA (Staphylococcal protein A) humanized monoclonal antibody with a KD value of 0.0467 nM. Omodenbamab circumvents a key S. aureus evasion mechanism by targeting the cell wall moiety Protein A (SpA). Omodenbamab can be used in research of S. aureus bloodstream infection.
  • HY-128036B
    ddATP trisodium

    2',3'-Dideoxyadenosine 5'-triphosphate trisodium

    		 DNA/RNA Synthesis HIV Infection
    ddATP (2',3'-Dideoxyadenosine 5'-triphosphate) trisodium, an active metabolite of 2',3'-dideoxyinosine, is a chain-elongating inhibitor of DNA polymerase. ddATP trisodium can be used for Sanger method for DNA sequencing and research of virus infection.
  • HY-112542
    Nemadectin

    CL-287088; LL-F28249 α

    		 Parasite Antibiotic Infection
    Nemadectin (CL-287088), an orally active broad-spectrum endectocide, is highly efficacious against natural infections of all the major canine gastrointestinal helminthes. Anthelmintic activity.
  • HY-P3465
    Bulevirtide

    Myrcludex B

    		 HBV Infection
    Bulevirtide (Myrcludex B) is a NTCP inhibitor, a linear lipopeptide of 47 amino acids. Bulevirtide inhibits HBV and HDV entry into liver cells, blocks HBV infection in hepatocytes, and participates in HBV transcriptional suppression. Bulevirtide can be used in HDV infection and compensated cirrhosis research.
  • HY-17426
    Famciclovir

    BRL 42810

    		 HSV HBV Infection
    Famciclovir (BRL 42810) is an orally active nucleoside analogue. Famciclovir is an antiviral agent with potent activities against HBV, HSV and VZV. Famciclovir can be used for the research of herpesvirus infection.
  • HY-151924
    Antiviral agent 23

    		Enterovirus Infection
    Antiviral agent 23 (compound 11b) is an antiviral agent to enterovirus 71 (EV71) with an EC50 value of 94 nM. Antiviral agent 23 effectively suppresses the activity of METTL3/METTL14. Antiviral agent 23 can be used for the research of infection.
  • HY-N10255
    Trypacidin

    		Parasite Infection
    Trypacidin is the conidia-bound metabolite with antiprotozoal activity. Trypacidin has a protective function against phagocytes both in the environment and during the infection process.
  • HY-121513
    Torcitabine

    2'-Deoxy-L-cytidine; L-dC

    		 HBV Infection
    Torcitabine (2'-Deoxy-L-cytidine) is an antiviral agent. Torcitabine has the potential for chronic hepatitis B virus infection treatment.
  • HY-142127
    Ribostamycin

    Vistamycin; SF-733

    		 Bacterial Antibiotic PDI Infection
    Ribostamycin (Vistamycin) is a broad-spectrum aminoglycoside antibiotic. Ribostamycin is effective against Gram-Negative and Gram-Positive bacterial infection. Ribostamycin also inhibits the chaperone activity of PDI.
  • HY-W014120
    Thianthrene

    		Others Infection
    Thianthrene, a sulfur-containing heterocyclic compound, is a derivative of dithiin. Thianthrene can be used in the research of dermal infections, in which it interferes with enzyme and nucleic acid function.
  • HY-122704A
    Surfen dihydrochloride

    Aminoquincarbamide dihydrochloride

    		 FGFR HSV VEGFR Infection
    Surfen dihydrochloride is a potent HS (heparan sulfate) antagonist. Surfen binds to glycosaminoglycans. Surfen neutralizes the anticoagulant activity of both unfractionated and low molecular weight heparins. Surfen affects sulfation of heparin and inhibits degradation by heparin lyases. Surfen inhibits FGF2 binding and signaling. Surfen inhibits cell attachment, and virus infection.
  • HY-N1985
    Acetylastragaloside I

    		Parasite Infection
    Acetylastragaloside I is a glycoside that can be isolated from the roots of Astragalus baibutensis. Acetylastragaloside I is the first cycloartane-type triterpene with remarkable trypanocidal activity with IC50 values of 9.5 and 5.0 μg/mL for T. brucei rhodesiense and T. cruzi, respectively. Acetylastragaloside I can be used for the research of trypanosome infection.
  • HY-19906
    LFF-571

    		Bacterial Antibiotic Infection
    LFF-571 is an orally active semisynthetic thiopeptide antibiotic. LFF-571 shows potent activity against a Clostridium difficile and Staphylococcus aureus with MIC values of 0.03 and 0.125 μg/mL, respectively. LFF-571 can be used for the research of infection.
  • HY-B0213
    Sulfameter

    Sulfametoxydiazine; 5-Methoxysulfadiazine

    		 Antibiotic Bacterial Infection
    Sulfameter (Sulfametoxydiazine; 5-Methoxysulfadiazine) is an effective long-acting sulfonamide antibiotic with antibacterial activities. Sulfameter can be used for the research of urinary tract infections and lepriasis.
  • HY-P2317A
    Cecropin P1, porcine acetate

    		Bacterial Endogenous Metabolite Infection
    Cecropin P1, porcine acetate is an antibacterial peptide that can be isolated from the upper part of the small intestine of the pig. Cecropin P1, porcine acetate shows antibacterial activity against Gram-negative bacteria. Cecropin P1, porcine acetate shows antiviral activity and inhibits PRRSV infection.
  • HY-N8393
    Ascr#18

    		Bacterial Fungal Infection
    Ascr#18, an ascaroside, is a hormone of nematodes. Ascr#18 is expressed during nematode development. Ascr#18 increases resistance in Arabidopsis, tomato, potato and barley to viral, bacterial, oomycete, fungal and nematode infections.
  • HY-B2237A
    Lysozyme chloride

    		Bacterial HIV Infection
    Lysozyme chloride is a bactericidal enzyme, and it lyses gram-positive bacteria. Lysozyme chloride can also be used for the research of HIV infection and pulmonary emphysema.
  • HY-124952
    iKIX1

    		Fungal Infection
    iKIX1 is an antifungal agent and resensitizes drug-resistant C. glabrata to azole antifungals in vitro. iKIX1 inhibits the interaction between the KIX domain of the mediator subunit CgGal11A and the activation domain of CgPdr1, the IC50 and Ki values are 190.2 μM and 18 μM, respectively. iKIX1 is used for the study of multidrug resistance and C. glabrata infection.
  • HY-B0956
    Paromomycin sulfate

    Aminosidine sulfate

    		 Antibiotic Parasite Bacterial Infection
    Paromomycin (Aminosidine) sulfate, a neomycin (HY-B0470) derivative, is a broad spectrum aminoglycoside antibiotic with amebicidal and bactericidal effects. Paromomycin sulfate prematures termination of translation of mRNA and inhibits protein synthesis by specifically binds to the RNA oligonucleotide at the A site of bacterial 30S ribosomes. Paromomycin sulfate can be used for the research of bacterial and parasitic infections.
  • HY-144820
    JO146

    		Ser/Thr Protease Infection
    JO146 is a Chlamydia trachomatis high temperature requirement A (CtHtrA) protease inhibitor with IC50s of 21.86 and 1.15 μM for CtHtrA and human neutrophil elastase (HNE), respectively. JO146 can be used to inhibits bacterial infections.
  • HY-116433
    Nequinate

    		Parasite Xanthine Oxidase Infection Metabolic Disease
    Nequinate, a quinoline compound, is an anticoccidial agent against cecal coccidiosis (Eimeria tenella) infections. Nequinate inhibits xanthine oxidoreductase (XOD) activity.
  • HY-126810A
    NP213 TFA

    		Fungal Infection
    NP213 TFA is a rapidly acting, novel, first-in-class synthetic antimicrobial peptide (AMP), has anti-fungal activities. NP213 TFA targets the fungal cytoplasmic membrane and plays it role via membrane perturbation and disruption. NP213 TFA is effective and well-tolerated in resolving nail fungal infections.
  • HY-148836
    c-Myc inhibitor 6

    		c-Myc Cancer Infection Cardiovascular Disease
    c-Myc inhibitor 6 (compound A102) is a c-Myc inhibitor. c-Myc inhibitor 6 decreases cancer cell viability and degrades c-Myc protein. c-Myc inhibitor 6 can be used for the research of c-Myc imbalance, such as cancer, cardiovascular diseases, and viral infection.
  • HY-A0161
    Chlophedianol

    Clofedanol; Calmotusin; NSC 113595

    		 Others Infection
    Chlophedianol (Clofedanol) is an orally active and potent antitussive agent. Chlophedianol can be used for the research of acute cough due to upper respiratory tract infections (URIs).
  • HY-126810
    NP213

    		Fungal Infection
    NP213 is a rapidly acting, novel, first-in-class synthetic antimicrobial peptide (AMP), has anti-fungal activities. NP213 targets the fungal cytoplasmic membrane and plays it role via membrane perturbation and disruption. NP213 is effective and well-tolerated in resolving nail fungal infections.
  • HY-B1210
    Pipemidic acid

    		Bacterial Antibiotic Infection
    Pipemidic acid , a derivative of Piromidic acid, is an antibacterial agent. Pipemidic acid inhibits DNA gyrase. Pipemidic acid is active against gram-negative bacteria including Pseudomonas aeruginosa as well as some gram-positive bacteria. Pipemidic acid can be used for the research of intestinal, urinary, and biliary tract infections.
  • HY-117411
    Coblopasvir

    KW-136

    		 HCV HCV Protease Infection Inflammation/Immunology
    Coblopasvir (KW-136) is a pangenotypic non-structural protein 5A (NS5A) inhibitor. Coblopasvir can be used for research of chronic hepatitis C virus infection.
  • HY-15993
    Posizolid

    AZD2563; AZD5847

    		 Antibiotic Infection
    Posizolid (AZD2563), an oxazolidinone antibiotic, is developed by AstraZeneca for the study of bacterial infections. Posizolid shows very good anti-mycobacterial activity.
  • HY-B1267
    Sulfaguanidine

    		Bacterial Antibiotic Infection
    Sulfaguanidine is an orally active antimicrobial agent/antibiotic of sulfonamide class. Sulfaguanidine can be used for the research of enteric infections such as bacillary dysentery.
  • HY-W282615
    Antibacterial agent 117

    		Bacterial Infection
    Antibacterial agent 117, triazole derivative, is an antibacterial agent. Antibacterial agent 117 has against R. prowazekii MetAP1 (RpMetAP1) activity with an IC50 value of 15 μM. Antibacterial agent 117 also inhibits rickettsial growth and can be used for the research of infection.
  • HY-A0035
    Faropenem

    		Antibiotic Bacterial Infection
    Faropenem is a potent and orally active beta-lactam antibiotic. Faropenem demonstrates broad-spectrum in vitro antimicrobial activity against many gram-positive and -negative aerobes and anaerobes. Faropenem is resistant to hydrolysis by nearly all beta-lactamases, including extended-spectrum beta-lactamases and AmpC beta-lactamases. Faropenem is developed as an oral proagent, faropenem medoxomil, for the research of respiratory tract infections.
  • HY-P3492
    SARS-CoV-2-IN-34

    		SARS-CoV Infection
    SARS-CoV-2-IN-34 (S-20-1) is a blood brain barrier penetrable pan-coronavirus (CoV) fusion inhibitor with broad-spectrum inhibitory activity. SARS-CoV-2-IN-34 effectively inhibits infection by pseudotyped and authentic SARS-CoV-2, and pseudotyped variants of concern (VOCs). SARS-CoV-2-IN-34 shows high affinity to RBD in S1 and HR1 domain in S2 of SARS-CoV-2 S protein. SARS-CoV-2-IN-34 can be used for the research of infection.
  • HY-B0159
    Balofloxacin

    Q-35

    		 Bacterial Antibiotic Infection
    Balofloxacin (Q-35) is an orally active fluoroquinolone antibiotic with broad-spectrum antibacterial activity against gram-negative, gram-positive, and anaerobic bacteria. Balofloxacin can be used for the research of respiratory, intestinal, and urinary tract infections.
  • HY-13337
    BMS-986094

    INX-08189

    		 HCV Infection
    BMS-986094 (INX-08189) is a potent inhibitor of hepatitis C virus (HCV) replication, with an EC50 of 35 nM at 24 h in Huh-7 cells. BMS-986094 is a phosphoramidate proagent of 6-O-methyl-2’-C-methyl guanosine. BMS-986094 can be used for the research of chronic HCV infection.
  • HY-128204
    AN3661

    		Parasite Infection
    AN3661, a potent antimalarial lead compound, targets a Plasmodium falciparum cleavage and polyadenylation specificity factor homologue subunit 3 (PfCPSF3). AN3661 inhibits Plasmodium falciparum laboratory-adapted strains (mean IC50=32 nM), Ugandan field isolates (mean ex vivo IC50=64 nM), and murine P. berghei and P. falciparum infections.
  • HY-108908
    (Rac)-Modipafant

    UK-74505

    		 Others Infection Inflammation/Immunology
    (Rac)-Modipafant (UK-74505) is an orally active, selective, long-acting irreversible platelet activating factor receptor (PAFR) antagonist. (Rac)-Modipafant prevents dengue infection.
  • HY-134910
    SID-852843

    		Virus Protease Infection
    SID-852843 is a WNV NS2B-NS3 proteinase inhibitor. SID-852843 can inhibit WNV NS2B-NS3 proteinase activity with IC50 value of 0.105 μM. SID-852843 can be used for the research of virus infection.
  • HY-151376
    SAP2-IN-1

    		Proteasome Infection
    SAP2-IN-1 is a secreted aspartic protease 2 (SAP2) inhibitor and has potent SAP2 inhibitory activity with an IC50 value of 0.92 μM. SAP2-IN-1 also is a virulence factor inhibitor and is inactive in vitro. SAP2-IN-1 can be used for the research of infection.
  • HY-19594
    Teclozan

    WIN 13146

    		 Parasite Infection
    Teclozan (WIN 13146) is an antiprotozoal agent, class in benzylamine derivatives. Teclozan intervenes in the phospholipid metabolism preventes the formation of arachidonic acid. Teclozan acts in the intestinal lumen being effective in Anti-G. intestinalis. Teclozan can be used for the research of protozoan infections.
  • HY-B0159A
    Balofloxacin dihydrate

    Q-35 dihydrate

    		 Bacterial Antibiotic Infection
    Balofloxacin dihydrate (Q-35 dihydrate) is an orally active fluoroquinolone antibiotic with broad-spectrum antibacterial activity against gram-negative, gram-positive, and anaerobic bacteria. Balofloxacin dihydrate can be used for the research of respiratory, intestinal, and urinary tract infections.
  • HY-106268
    Larazotide

    		Gap Junction Protein Infection Inflammation/Immunology
    Larazotideis a peptide which is an orally active zonulin antagonist. Larazotide shows antiviral activity to varicella-zoster virus (VZV) with EC50s of 44.14 and 59.06 μM for strain OKA and 07-1, respectively. Larazotide can be used for the research of celiac disease and infection.
  • HY-147349
    ANT3310 sodium

    		Bacterial Infection
    ANT3310 sodium is a broad-spectrum covalent Serine β-Lactamase inhibitor, with IC50 values ranging from 1 nM to 175 nM (a panel of Serine β-Lactamase). ANT3310 sodium potentiates activity of β-lactam antibiotics against Carbapenem-Resistant Enterobacterales (CRE) and Acinetobacter baumannii (CRAB). ANT3310 sodium can be used in the research of bacterial infection.
  • HY-151549
    Mtb-cyt-bd oxidase-IN-2

    		Bacterial Infection
    Mtb-cyt-bd oxidase-IN-2 is an inhibitor of Mycobacterium tuberculosis cytochrome bd oxidase (Mtb cyt-bd oxidase) with an IC50 value of 0.67 μM. Mtb-cyt-bd oxidase-IN-2 inhibits the growth of Mycobacterium tuberculosis with a MIC value of 256 μM. Mtb-cyt-bd oxidase-IN-2 can be used for the research of infection.
  • HY-143760
    Cap-dependent endonuclease-IN-11

    		Influenza Virus Infection
    Cap-dependent endonuclease-IN-11 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-11 has the potential for the research of viral infections (extracted from patent WO2021129602A1, compound DSC126).
  • HY-B2237
    Lysozyme from chicken egg white

    		Bacterial HIV Infection
    Lysozyme from chicken egg white is a bactericidal enzyme, and it lyses gram-positive bacteria. Lysozyme from chicken egg white can also be used for the research of HIV infection and pulmonary emphysema.
  • HY-B1257
    Cefmetazole sodium

    Sodium cefmetazole

    		 Bacterial Antibiotic Infection
    Cefmetazole sodium (Sodium cefmetazole) is a semisynthetic cephamycin antibiotic with broad-spectrum antibacterial activity, covering gram-positive, gram-negative, and anaerobic bacteria. Cefmetazole sodium binds to penicillin binding proteins (PBPs), resulting in interfering bacterial cell wall biosynthesis. Cefmetazole sodium is used for the research of gynecologic, intraabdominal, urinary tract, respiratory tract and skin and soft tissue infections.
  • HY-P99209
    Motavizumab

    MEDI-524

    		 RSV Infection
    Motavizumab (MEDI-524) is an anti-human RSV (respiratory syncytial virus) monoclonal antibody. Motavizumab can be used in respiratory syncytial virus infection in high-risk infants research.
  • HY-W008216
    HMMNI

    Hydroxy Dimetridazole

    		 Drug Metabolite Others
    HMMNI (Hydroxy dimetridazole) is a hydroxy metabolite of Dimetridazole. Dimetridazole is a nitroimidazole class drug that combats protozoan infections.
  • HY-B1595
    Cefmetazole

    CS 1170

    		 Antibiotic Bacterial Infection
    Cefmetazole (CS 1170) is a semisynthetic cephamycin antibiotic with broad-spectrum antibacterial activity, covering gram-positive, gram-negative and anaerobic bacteria. Cefmetazole binds to penicillin binding proteins (PBPs), resulting in interfering bacterial cell wall biosynthesis. Cefmetazole is used for the research of gynecologic, intraabdominal, urinary tract, respiratory tract and skin and soft tissue infections.
  • HY-A0161A
    Chlophedianol hydrochloride

    Clofedanol hydrochloride; Calmotusin hydrochloride; NSC 113595 hydrochloride

    		 Others Infection
    Chlophedianol (Clofedanol) hydrochloride is an orally active and potent antitussive agent. Chlophedianol hydrochloride can be used for the research of acute cough due to upper respiratory tract infections (URIs).
  • HY-B1466
    Mezlocillin sodium

    BAY-f 1353 sodium

    		 Bacterial Antibiotic Infection
    Mezlocillin (BAY-f 1353) sodium is a β-lactam antibiotic, a semisynthetic and extended-spectrum antibiotic. Mezlocillin sodium is active against both gram-negative and gram-positive bacteria. Mezlocillin sodium can be used in bacterial infection research.
  • HY-B1466A
    Mezlocillin

    BAY-f 1353

    		 Antibiotic Bacterial Infection
    Mezlocillin (BAY-f 1353) is a β-lactam antibiotic, a semisynthetic and extended-spectrum antibiotic. Mezlocillin is active against both gram-negative and gram-positive bacteria. Mezlocillin can be used in bacterial infection research.
  • HY-145265
    Antimicrobial photosensitizer-1

    		Bacterial Infection
    Antimicrobial photosensitizer-1 is a promising candidate as the antimicrobial photosensitizer for combating pathogenic microorganism infections. Antimicrobial photosensitizer-1 exhibits an impressive antimicrobial efficacy in S. aureus-infected mice wounds.
  • HY-147217
    Bepirovirsen

    ISIS 505358

    		 HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
  • HY-17452
    Cefditoren sodium

    ME 1206

    		 Bacterial Infection Inflammation/Immunology
    Cefditoren sodium (ME 1206) is a broad-spectrum, third-generation, oral cephalosporin antibacterial with enhanced stability against many common β lactamases. Cefditoren sodium has activity against Gram-negative organisms and Gram-positive organisms. Cefditoren sodium can be used in the research of infection diseases such as acute exacerbations of chronic bronchitis, community-acquired pneumonia (CAP), streptococcal pharyngitis/tonsillitis, or uncomplicated skin and skin structure infections.
  • HY-P2292
    Omiganan-FITC

    		Bacterial Fungal Infection
    Omiganan-FITC is a peptide-FITC complex composed of Omiganan and a FITC. Omiganan is a bactericidal and fungicidal cationic peptide being developed as a topical gel for prevention of catheter-associated infections. FITC is a derivative of fluorescein for the labeling of amines.
  • HY-128399
    CpCDPK1/TgCDPK1-IN-3

    		Parasite Infection
    CpCDPK1/TgCDPK1-IN-3 (Compound 20) is a CpCDPK1 and TgCDPK1 inhibitor with IC50 values of 0.003 and 0.0036 µM, respectively. CpCDPK1/TgCDPK1-IN-3 can be used in the research of apicomplexan protozoa-related diseases, such as the research of T. gondii, C. parvum and C. hominus infection.
  • HY-106866
    Bulaquine

    CDRI 80/53; Elubaquine

    		 Parasite Infection
    Bulaquine (CDRI 80/53) is a potent antimalarial agent which is an analogue of Primaquine (HY-12651A). Bulaquine affects multiple metabolism pathways and shows inhibition effect on Plasmodium cynomolgi infection. Bulaquine can be used for the research of malaria.
  • HY-12479A
    Epetraborole hydrochloride

    GSK2251052 hydrochloride

    		 Bacterial Aminoacyl-tRNA Synthetase Infection
    Epetraborole (GSK2251052) hydrochloride is a novel leucyl-tRNA synthetase (LeuRS) inhibitor (IC50=0.31 μM), thereby inhibiting protein synthesis. Epetraborole hydrochloride can be used in multidrug-resistant gram-negative pathogens infection research.
  • HY-P99637
    Gedivumab

    MHAA4549A; RG7745

    		 Influenza Virus Infection
    Gedivumab (MHAA4549A; RG7745) is a human monoclonal antibody that targets influenza A virus (IAV) with high specificity and binds to the highly conserved stem region of the IAV haemagglutinin protein, thereby preventing haemagglutinin maturation and blocking haemagglutinin-mediated membrane fusion in the intranucleosome. Gedivumab can be used in IAV infection disease studies.
  • HY-17452A
    Cefditoren (Pivoxil)

    Cefditoren pivoxyl; Cefditoren pivaloyloxymethyl ester; ME 1207

    		 Bacterial Antibiotic Infection Inflammation/Immunology
    Cefditoren Pivoxil (ME 1207) is a broad-spectrum, third-generation, oral cephalosporin antibacterial with enhanced stability against many common β lactamases. Cefditoren Pivoxil has activity against Gram-negative organisms and Gram-positive organisms. Cefditoren Pivoxil can be used in the research of infection diseases such as acute exacerbations of chronic bronchitis, community-acquired pneumonia (CAP), streptococcal pharyngitis/tonsillitis, or uncomplicated skin and skin structure infections.
  • HY-123601
    DHQZ 36

    		Parasite Infection
    DHQZ 36 is a potent inhibitor of retrograde trafficking. DHQZ 36 inhibits Leishmania amazonensis infection in macrophages with an EC50 of 13.63 μM. DHQZ 36 has potent anti-parasite activity.
  • HY-B0322S1
    Sulfamethoxazole-13C6

    		Antibiotic Bacterial Infection
    Sulfamethoxazole- 13C6 is a 13C labeled Sulfamethoxazole. Sulfamethoxazole (Ro 4-2130) is a sulfonamide bacteriostatic antibiotic, used for bacterial infections. Sulfonamides is a competitive antagonist of para-aminobenzoic acid (PABA)[1].
  • HY-50001
    Nucleozin

    		Influenza Virus Infection
    Nucleozin, a potent inhibitor of influenza A virus infection, induces the formation of nucleoprotein (NP) aggregates and antagonizes its nuclear accumulation, leading to cessation of viral replication. Nucleozin impedes influenza A virus replication in vitro with a nanomolar EC50.
  • HY-134863
    A1AT modulator 2

    		Others Infection Inflammation/Immunology
    A1AT modulator 2 (compound 33) is a modulator of A1AT (α-1 antitrypsin) with an IC50 value of ＞1.0 μM and an EC50 value of ＜0.4 μM. A1AT modulator 2 can be used for the research of infection and inflammation.
  • HY-P99028
    Ibalizumab

    TMB-355; TNX-355

    		 HIV Infection
    Ibalizumab (TMB-355) is a humanised IgG4 monoclonal antibody that prevents HIV cell entry by binding to CD4 receptor. Ibalizumab has the potential for HIV-1 infection research.
  • HY-B1156
    Cephradine

    Cefradine; SQ-11436

    		 Bacterial Antibiotic TOPK Infection Inflammation/Immunology
    Cephradine (Cefradine) is a broad-spectrum and orally active cephalosporin. Cephradine is active against both gram-positive and gram-negative pathogens. Cephradine is effective in eradicating most penicillinase-producing organisms. Cephradine has been used in the research of genitourinary, gastrointestinal and respiratory tract infections, and in infections of the skin and soft tissues. Cephradine blocks solar-ultraviolet induced skin inflammation through direct inhibition of TOPK.
  • HY-125789
    PF-04753299

    		Bacterial Infection
    PF-04753299 is a potent and selective UDP-3-O-(R-3-hydroxymyristol)-N-acetylglucosamine deacetylase (LpxC) inhibitor. PF-04753299 is bactericidal for the gonococcal isolates. PF-04753299 inhibits E. coli, P. aeruginosa and K. pneumoniae strains with MIC90 values of 2 μg/ml, 4 μg/ml and 16 μg/ml, respectively. PF-04753299 is used for the study of gram-negative bacteria infection.
  • HY-148679
    CL845

    		STING Cancer Infection Inflammation/Immunology
    CL845 is an analog of the STING agonist CL656 (HY-112878). CL845 can be used to synthesize conjugatable PRR ligands that target STING (stimulator of interferon genes). CL845 can be usexd for the research of cancers, immunological disorders or infections.
  • HY-A0294
    Ertapenem

    MK-0826

    		 Antibiotic Bacterial Infection
    Ertapenem (MK-0826) is a broad spectrum and long acting β-lactam antibiotic. Ertapenem has a broad-spectrum anti-anaerobic activity against a variety of anaerobes with a mode MIC of 0.12 μg/mL. Ertapenem can be used for the research of severe infections caused by bacteria in the skin, lungs, stomach, pelvis, and urinary tract.
  • HY-B0322A
    Sulfamethoxazole sodium

    Ro 4-2130 sodium

    		 Bacterial Antibiotic Infection
    Sulfamethoxazole sodium (Ro 4-2130 sodium) is a sulfonamide bacteriostatic antibiotic. Sulfamethoxazole sodium is used to treat various urinary tract pathogens and in combination with Trimethoprim is considered the gold standard in the treatment of urinary tract infections (UTIs).
  • HY-146079
    Antifungal agent 31

    		Fungal Infection
    Antifungal agent 31 (compound 12) is a potent and orally active triazole antifungal agents with a pyrrolotriazinone scaffold. Antifungal agent 31 shows antifungal activity against Candida spp. and filamentous fungi. Antifungal agent 31 significantly reduced mortality rates and kidney fungal burden in two murine models of lethal systemic infections.
  • HY-A0294A
    Ertapenem disodium

    MK-0826 disodium

    		 Bacterial Antibiotic Infection
    Ertapenem (MK-0826) disodium is a broad spectrum and long acting β-lactam antibiotic. Ertapenem disodium has a broad-spectrum anti-anaerobic activity against a variety of anaerobes with a mode MIC of 0.12 μg/mL. Ertapenem disodium can be used for the research of severe infections caused by bacteria in the skin, lungs, stomach, pelvis, and urinary tract.
  • HY-16908
    Lefamulin

    BC-3781

    		 Bacterial Antibiotic Infection
    Lefamulin (BC-3781) is an orally active antibiotic. Lefamulin inhibits protein synthesis by binding to the peptidyl transferase center of the 50S bacterial ribosome. Lefamulin has anti-inflammatory activity. Lefamulin can be used in the research of bacterial infections, such as bacterial pneumonia.
  • HY-107193
    Bacitracin

    		Bacterial Antibiotic Infection Cancer
    Bacitracin is a polypeptide antibiotic against staphylococcal and pathogenic protozoa infections. Bacitracin inhibits cell wall biosynthesis and permeability through binding to the undecaprenyl pyrophosphate. Bacitracin inhibits macromolecular synthesis. Bacitracin is also a protein disulfide isomerase (PDI) inhibitor.
  • HY-112959
    Telavancin

    TD-6424

    		 Antibiotic Bacterial Infection
    Telavancin (TD-6424) is a semisynthetic lipoglycopeptide vancomycin-derivative, is a novel antimicrobial agent developed by Theravance for overcoming resistant Gram-positive bacterial infections, specifically methicillin-resistant Staphylococcus aureus (MRSA). Telavancin disrupts cell membrane integrity, can be used for research of complicated skin and skin structure infections (cSSSIs) caused by Gram-positive bacteria.
  • HY-128449
    Cephradine monohydrate

    Cefradine monohydrate

    		 Bacterial Antibiotic TOPK Infection Inflammation/Immunology
    Cephradine (Cefradine) monohydrate is a broad-spectrum and orally active cephalosporin. Cephradine monohydrate is active against both grampositive and gram-negative pathogens and effective in eradicating most penicillinase-producing organisms known to be resistant to penicillin G, penicillin V, and ampicillin. Cephradine monohydrate has been used in the research of genitourinary, gastrointestinal and respiratory tract infections, and in infections of the skin and soft tissues. Cephradine monohydrate blocks solar-ultraviolet induced skin inflammation through direct inhibition of TOPK.
  • HY-B1144A
    Chlormidazole hydrochloride

    Clomidazole hydrochloride

    		 Fungal Infection
    Chlormidazole hydrochloride is an antifungal agent and has inhibitory activity against many fungi and some gram-positive cocci. Chlormidazole hydrochloride can be applied in fungal and bacterial infections of nails and skin, including interdigital and periungual mycoses.
  • HY-128357
    Ibezapolstat

    ACX-362E; GLS-362E

    		 Bacterial DNA/RNA Synthesis Infection
    Ibezapolstat (ACX-362E) is a first-in-class, orally active DNA polymerase IIIC (pol IIIC) inhibitor, with a Ki of 0.325 μM for the DNA pol IIIC from C. difficile. Ibezapolstat is developed for the research of C. difficile infection(CDI).
  • HY-151380
    LANA-DNA-IN-1

    		Others Infection
    LANA-DNA-IN-1 is a potent LANA-DNA inhibitor. LANA-DNA-IN-1 has inhibition activity for LBS2, LBS1 and LBS3 with IC50 values of 8 μM, 9μM and 8μM. LANA-DNA-IN-1shows against wild-type LANA with IC50 value of 53 μM. LANA-DNA-IN-1 can be used for the research of infection.
  • HY-151164
    LasR-IN-2

    		Bacterial Infection
    LasR-IN-2 is a LasR inhibitor that forms H-bonding with TRY-56 residue. LasR-IN-2 can be used in the research of bacterial infection, neutropenia, severe burns and chronic lung disease in cystic fibrosis (CF).
  • HY-148201
    Oleana-2,12-dien-28-oic acid

    		HBV Infection
    Oleana-2,12-dien-28-oic acid is an HBV-DNA inhibitor, HBsAg and HBeAg inhibitor. Oleana-2,12-dien-28-oic acid can be used in hepatitis B virus infection disease research.
  • HY-P9803
    Anti-SARS-80R mAb

    SARS-80R; SARS Antibody-80R

    		 SARS-CoV Infection
    Anti-SARS-80R mAb (SARS-80R) is a human monoclonal IgG1 antibody produced in CHO cells. Anti-SARS-80R mAb can specifically bind to Spike (S1) protein to prevent SARS virus infection of susceptible cells.
  • HY-N8168
    LPRP-Et-97543

    		HBV Infection
    LPRP-Et-97543 is a potent anti-HBV agent. LPRP-Et-97543 reduces Core, S, and preS but not X promoter activities. LPRP-Et-97543 can be used for acute and chronic HBV infections research.
  • HY-B0510
    Trimethoprim

    		Antifolate Bacterial Antibiotic Influenza Virus Infection
    Trimethoprim is a bacteriostatic antibiotic and an orally active dihydrofolate reductase inhibitor. Trimethoprim is active against a wide range of Gram-positive and Gram-negative aerobic bacteria. Trimethoprim has the potential for the research of urinary tract infections, Shigellosis and Pneumocystis pneumonia. Trimethoprim can inhibit infection of Influenza A virus in chick embryo when combinated with zinc.
  • HY-B0510B
    Trimethoprim hydrochloride

    		Antifolate Bacterial Antibiotic Influenza Virus Infection
    Trimethoprim hydrochloride is a bacteriostatic antibiotic and an orally active dihydrofolate reductase inhibitor. Trimethoprim hydrochloride is active against a wide range of Gram-positive and Gram-negative aerobic bacteria. Trimethoprim hydrochloride has the potential for the research of urinary tract infections, Shigellosis and Pneumocystis pneumonia. Trimethoprim hydrochloride can inhibit infection of Influenza A virus in chick embryo when combinated with zinc.
  • HY-14283
    Luliconazole

    NND 502

    		 Fungal Antibiotic Infection
    Luliconazole (NND 502) is a topical antifungal imidazole antibiotic with broad-spectrum and potent antifungal activity. Luliconazole can be used for the research of skin infection, including dermatophytosis, tinea corporis, tinea pedis et al.
  • HY-B1597
    Cetalkonium chloride

    Benzyldimethylhexadecylammonium chloride

    		 Bacterial Infection Inflammation/Immunology
    Cetalkonium chloride is an ammonium antiseptic agent used in many topical agents for infections of mouth, throat and eye. Cetalkonium chloride acts as anti-inflammatory amphiphilic agent.
  • HY-148578
    CamA-IN-1

    		Bacterial Infection
    CamA-IN-1 is a Clostridioides difficile-specific DNA adenine methyltransferase (CamA) inhibitor. CamA-IN-1 has inhibitory for CamA with IC50 and Kd values of 0.4 μM and 0.2 μM, respectively. CamA-IN-1 can be used for the research of Clostridioides difficile infections (CDI).
  • HY-144833
    SARS-CoV-2 3CLpro-IN-1

    		SARS-CoV Infection
    SARS-CoV-2 3CLpro-IN-1 (Compound 14c) is a potent inhibitor of SARS-CoV-2 3CL pro. 3CL pro (main coronaviruses cysteine-protease) has been identified as a promising target for the development of antiviral agents. SARS-CoV-2 3CLpro-IN-1 has the potential for the research of infection diseases.
  • HY-119972
    Diloxanide

    		Parasite Infection
    Diloxanide is an anti-protozoal agent and can be used for the research of asymptomatic-intestinal amebiasis caused by Entamoeba histolytica or some other protozoal infections. Diloxanide is an active luminal amebicide and hydrolyzed in the gastrointestinal tract from its proagent Diloxanide furoate (HY-B1147).
  • HY-143766
    Cap-dependent endonuclease-IN-13

    		Influenza Virus Infection
    Cap-dependent endonuclease-IN-13 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-13 has the potential for the research of influenza virus infection (only influenza A) (extracted from patent WO2021180147A1, compound I-1).
  • HY-14865B
    Omadacycline tosylate

    PTK 0796 tosylate; Amadacycline tosylate

    		 Bacterial Antibiotic Infection
    Omadacycline (PTK 0796) tosylate, a first-in-class orally active aminomethylcycline antibacterial, is a member of the tetracycline class of antibiotics. Omadacycline tosylate acts through the inhibition of bacterial protein synthesis by binding to the 30S ribosomal subunit. Omadacycline tosylate possesses broad-spectrum antibacterial activity against aerobic and anaerobic Gram-positive and Gram-negative bacteria, as well as atypical bacteria. Omadacycline tosylate can be used for the research of acute bacterial skin and skin-structure infections, community-acquired pneumonia, and urinary tract infections.
  • HY-14865C
    Omadacycline hydrochloride

    PTK0796 hydrochloride; Amadacycline hydrochloride

    		 Bacterial Antibiotic Infection
    Omadacycline (PTK 0796) hydrochloride, a first-in-class orally active aminomethylcycline antibacterial, is a member of the tetracycline class of antibiotics. Omadacycline hydrochloride acts through the inhibition of bacterial protein synthesis by binding to the 30S ribosomal subunit. Omadacycline hydrochloride possesses broad-spectrum antibacterial activity against aerobic and anaerobic Gram-positive and Gram-negative bacteria, as well as atypical bacteria. Omadacycline hydrochloride can be used for the research of acute bacterial skin and skin-structure infections, community-acquired pneumonia, and urinary tract infections.
  • HY-14865
    Omadacycline

    PTK 0796; Amadacycline

    		 Bacterial Antibiotic Infection
    Omadacycline (PTK 0796), a first-in-class orally active aminomethylcycline antibacterial, is a member of the tetracycline class of antibiotics. Omadacycline acts through the inhibition of bacterial protein synthesis by binding to the 30S ribosomal subunit. Omadacycline possesses broad-spectrum antibacterial activity against aerobic and anaerobic Gram-positive and Gram-negative bacteria, as well as atypical bacteria. Omadacycline can be used for the research of acute bacterial skin and skin-structure infections, community-acquired pneumonia, and urinary tract infections.
  • HY-14865A
    Omadacycline mesylate

    PTK 0796 mesylate; Amadacycline mesylate

    		 Bacterial Antibiotic Infection
    Omadacycline (PTK 0796) mesylate, a first-in-class orally active aminomethylcycline antibacterial, is a member of the tetracycline class of antibiotics. Omadacycline mesylate acts through the inhibition of bacterial protein synthesis by binding to the 30S ribosomal subunit. Omadacycline mesylate possesses broad-spectrum antibacterial activity against aerobic and anaerobic Gram-positive and Gram-negative bacteria, as well as atypical bacteria. Omadacycline mesylate can be used for the research of acute bacterial skin and skin-structure infections, community-acquired pneumonia, and urinary tract infections.
  • HY-17532
    Haloxon

    		Parasite Infection
    Haloxon is an anti-parasitic agent. Haloxon can be used for the research of infections of Parascaris equorum, Oxyuris equi and Strongylus vulgaris. Haloxon also can be used in control of ascarids and hookworms in domesticated animals in combination with Bidimazium.
  • HY-104077S
    Remdesivir-d5

    GS-5734-d5

    		 DNA/RNA Synthesis SARS-CoV Infection
    Remdesivir-d5 is a deuterium labeled Remdesivir. Remdesivir (GS-5734) is a nucleoside analogue, with effective antiviral activity, with EC50s of 74 nM for SARS-CoV and MERS-CoV in HAE cells, and 30 nM for murine hepatitis virus in delayed brain tumor cells. Remdesivir is highly effective in the control of 2019-nCoV (COVID-19) infection in vitro[1][2].
  • HY-118365
    NSC 140873

    		Others Cancer Infection
    NSC 140873 is an inhibitor of the RUNX1-CBFβ interaction. NSC 140873 can be used for research of viral infection and leukemia. NSC 140873 has an unstable structure and can be converted spontaneously in solution to a benzodiazepine (Ro5-3335).
  • HY-P3350
    LS-BF1

    		Bacterial Infection
    LS-BF1 is a stable and low toxic cationic antimicrobial peptide. LS-BF1 displays broad spectrum of antibacterial activity, including the challenging ESKAPE pathogens, by cell membrane disruptive mechanism. LS-BF1 shows good in vivo efficacy for elimination of bacteria in a mouse infection model[1].
  • HY-148328
    CK2-IN-4

    		Casein Kinase Cancer Infection Inflammation/Immunology
    CK2-IN-4 (compound 5) is a protein kinase (CK2) inhibitor (IC50=8.6 µM). CK2-IN-4 has good potential for research in the areas of cancer, viral infections and glomerulonephritis.
  • HY-121544A
    Methicillin sodium hydrate

    		Bacterial Antibiotic Histamine Receptor Infection
    Methicillin sodium hydrate is a narrow-spectrum β-lactam antibiotic, acts by inhibiting penicillin-binding proteins (PBPs). Methicillin sodium hydrate is active against Staphylococcus aureus and Staphylococcus epidermidis that are resistant to other penicillins. Methicillin sodium hydrate can be used for the research of skin infections, osteomyelitis, and endocarditis.
  • HY-121544
    Methicillin

    		Bacterial Antibiotic Histamine Receptor Infection
    Methicillin is a narrow-spectrum β-lactam antibiotic, acts by inhibiting penicillin-binding proteins (PBPs). Methicillin is active against Staphylococcus aureus and Staphylococcus epidermidis that are resistant to other penicillins.Methicillin can be used for the research of skin infections, osteomyelitis, and endocarditis.
  • HY-114518
    Butenafine

    KP363

    		 Fungal Infection
    Butenafine (KP363) is a potent and broad spectrum benzylamine antifungal agent. Butenafine inhibits fungal ergosterol biosynthesis at the point of squalene epoxidation, leading to a deficiency of the fungal cell membranes. Butenafine is effective against dermatophytes infections, such as  tinea pedis,  tinea cruris, tinea versicolor.
  • HY-W011522
    Taurolidine

    		Bacterial Apoptosis Antibiotic Cancer Infection
    Taurolidine is a broad-spectrum antimicrobial for the prevention of central venous catheter-related infections. Taurolidine has a direct and selective antineoplastic effect on brain tumor cells by the induction of apoptosis.
  • HY-N10495
    Seconeolitsine

    		Antibiotic Bacterial Topoisomerase Infection
    Seconeolitsine, an antibiotic, and is an inhibitor of targeting topoisomerase I (TopA). Seconeolitsine also is a new antimicrobial agent that can inhibit S. pneumoniae growth. Seconeolitsine can inhibit TopA relaxation activity with an IC50 value of 17 μM. Seconeolitsine can be used for the research of S. pneumoniae infections resistant to other antibiotics.
  • HY-Y1718
    Tridecanoic acid

    N-Tridecanoic acid

    		 Endogenous Metabolite Bacterial Infection Metabolic Disease
    Tridecanoic acid (N-Tridecanoic acid), a 13-carbon medium-chain saturated fatty acid, can serve as an antipersister and antibiofilm agent that may be applied to research bacterial infections. Tridecanoic acid inhibits Escherichia coli persistence and biofilm formation.
  • HY-147321
    3'-DMTr-dG(iBu)

    		Tau Protein HBV Infection Neurological Disease
    3'-DMTr-dG(iBu) is a nucleoside for the synthesis of nucleic acid, such as antiviral agents used in the research of viral infection (HBV, HDV), and oligonucleotides against Alzheimer’s disease and other tauopathies.
  • HY-13625
    Ertapenem sodium

    L-749345; MK-826

    		 Bacterial Antibiotic Infection Cancer
    Ertapenem sodium (L-749345) is a broad spectrum and long acting β-lactam antibiotic. Ertapenem sodium has a broad-spectrum anti-anaerobic activity against a variety of anaerobes with a mode MIC of 0.12 μg/mL. Ertapenem sodium can be used for the research of severe infections caused by bacteria in the skin, lungs, stomach, pelvis, and urinary tract.
  • HY-B1002
    Oxolinic acid

    		Bacterial Antibiotic DNA/RNA Synthesis Infection
    Oxolinic acid is an antibiotic against both Gram-negative and Gram-positive bacteria. Oxolinic acid can be used for the research of acute and chronic urinary tract infections. Oxolinic acid is a DNA/RNA synthesis inhibitor. Oxolinic acid acts a dopamine uptake inhibitor and stimulants locomotor effect in mice.
  • HY-144062
    INSCoV-614(1B)

    		SARS-CoV Infection
    INSCoV-614(1B) is a potent inhibitor of M pro (3CL pro). Proteases (PL pro and 3CL pro) are involved with transcription and replication of the virus. INSCoV-614(1B) has the potential for the research of SARS-CoV-2 infection (extracted from patent WO2021219089A1).
  • HY-14913
    Apricitabine

    SPD754; AVX754

    		 Nucleoside Antimetabolite/Analog HIV DNA/RNA Synthesis Infection
    Apricitabine (SPD754; AVX754), the (-) enantiomer of 2′-deoxy-3′-oxa-4′-thiocytidine (dOTC), is a highly selective and orally active HIV-1 reverse transcriptase (RT) inhibitor (Ki=0.08 μM), as well as inhibits DNA polymerases α, β, and γ with Ki value of 300 μM, 12 μM, and 112.25 μM, respectively. Apricitabine (SPD754; AVX754) shows promising antiretroviral efficacy, good tolerability and a low propensity for resistance selection in antiretroviral-naive HIV infection[2].
  • HY-104077
    Remdesivir

    GS-5734

    		 DNA/RNA Synthesis SARS-CoV Infection
    Remdesivir (GS-5734), a nucleoside analogue with effective antiviral activity, has EC50s of 3.3 μM, 4.7 μM, 32 μM, 3.7 μM and 9.2 μM for SARS-CoV-2 and its variants alpha, beta, gamma and delta, respectively. Remdesivir is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro.
  • HY-143769
    Cap-dependent endonuclease-IN-15

    		Influenza Virus Infection
    Cap-dependent endonuclease-IN-15 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-15 inhibits the replication of influenza virus. Cap-dependent endonuclease-IN-15 has the potential for the research of viral infections caused by influenza viruses (extracted from patent CN113226327A, compound c-1).
  • HY-144063
    INSCoV-600K(1)

    		SARS-CoV Infection
    INSCoV-600K(1) is a potent inhibitor of M pro (3CL pro). Proteases (PL pro and 3CL pro) are involved with transcription and replication of the virus. INSCoV-600K(1) has the potential for the research of SARS-CoV-2 infection (extracted from patent WO2021219089A1).
  • HY-144061
    INSCoV-601I(1)

    		SARS-CoV Infection
    INSCoV-601I(1) is a potent inhibitor of M pro (3CL pro). Proteases (PL pro and 3CL pro) are involved with transcription and replication of the virus. INSCoV-601I(1) has the potential for the research of SARS-CoV-2 infection (extracted from patent WO2021219089A1).
  • HY-15287
    Nelfinavir

    AG1341

    		 HIV Protease HIV Infection Cancer
    Nelfinavir (AG-1341) is a potent and orally bioavailable HIV-1 protease inhibitor (Ki=2 nM) for HIV infection. Nelfinavir is a broad-spectrum, anticancer agent.
  • HY-B1085
    Cinoxacin

    Compound 64716

    		 Bacterial Antibiotic DNA/RNA Synthesis Infection
    Cinoxacin (Compound 64716), a synthetic antimicrobial related to the quinolone class of orally active antibacterial agent. Cinoxacin has antibacterial activity against many gram-negative aerobic bacteria and inhibits bacterial DNA synthesis. Cinoxacin can be used for the research of urinary tract infections and bacterial prostatitis.
  • HY-146379
    SARS-CoV-2-IN-19

    		SARS-CoV Infection
    SARS-CoV-2-IN-19 (Compound 6g) is a potent inhibitor of SARS-CoV-2 with an EC50 of 8.8 μM. SARS-CoV-2-IN-19 shows potent activity against SARS-CoV-2 helicase (nsp13), a highly conserved enzyme, highlighting a potentiality against emerging HCoVs outbreaks. SARS-CoV-2-IN-19 has the potential for the research of infection diseases.
  • HY-15287A
    Nelfinavir Mesylate

    AG 1343 Mesylate

    		 HIV Protease HIV Cancer Infection
    Nelfinavir Mesylate (AG 1343 Mesylate) is a potent and orally bioavailable HIV-1 protease inhibitor (Ki=2 nM) for HIV infection. Nelfinavir Mesylate (AG 1343 Mesylate) is a broad-spectrum, anticancer agent.
  • HY-N8188
    Dehydrojuncusol

    		HCV HCV Protease Infection
    Dehydrojuncusol, a potent HCV inhibitor, targets HCV NS5A and is able to inhibit RNA replication of replicons harboring resistance mutations to anti-NS5A direct-acting antivirals. Dehydrojuncusol significantly inhibits HCV infection when added after virus inoculation of HCV genotype 2a (EC50=1.35 µM).
  • HY-143768
    Cap-dependent endonuclease-IN-14

    		Influenza Virus Infection
    Cap-dependent endonuclease-IN-14 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-14 inhibits the replication of influenza virus. Cap-dependent endonuclease-IN-14 has the potential for the research of viral infections caused by influenza viruses (extracted from patent CN113620948A, compound 1-c).
  • HY-151445
    ZIKV-IN-2

    		DNA Methyltransferase Virus Protease Infection
    ZIKV-IN-2 (compound 3a) is a potent ZIKV NS5 methyl transferase (MTase) inhibitor with an IC50 value of 38.86 μM. ZIKV-IN-2 inhibits ZIKV replication and infection. ZIKV-IN-2 can be used in research of Zika virus (ZIKV).
  • HY-14737A
    Ceftaroline fosamil (hydrate)(acetate)

    TAK-599 (hydrate)(acetate); PPI0903 (hydrate)(acetate)

    		 Antibiotic Bacterial Infection
    Ceftaroline fosamil hydrate acetate is a potent cephalosporin antibiotic. Ceftaroline fosamil hydrate acetate shows broad-spectrum activity against Gram-positive pathogens, including methicillin-resistant Staphylococcus aureus (MRSA) and multidrug-resistant Streptococcus pneumoniae, and common Gram-negative organisms. Ceftaroline fosamil hydrate acetate has anti-infective activity, and can be used for the research of complicated skin and skin structure infections (cSSSIs) and community-acquired bacterial pneumonia (CABP).
  • HY-14532
    Brincidofovir

    CMX001; HDP-CDV

    		 CMV HSV Orthopoxvirus Infection
    Brincidofovir (CMX001), the lipid-conjugated prodrug of Cidofovir (HY-17438), is an orally available, long-acting antiviral. Brincidofovir shows activity against a broad spectrum of DNA viruses including cytomegalovirus (CMV), adenovirus (ADV), varicella zoster virus, herpes simplex virus, polyomaviruses, papillomaviruses, poxviruses, and mixed double-stranded DNA virus infections. Brincidofovir, an oral antiviral in late stage development, has proven effective against orthopoxviruses in vitro and in vivo..
  • HY-128382
    Brilliant Black BN

    E 151

    		 Enterovirus Infection
    Brilliant black BN (E151) is an azo dye and a food colorant. Brilliant black BN is a promising antiviral agent against EV71 infection via inhibiting the interaction between EV71 and its cellular uncoating factor cyclophilin A. Brilliant black BN has the potential for the investigation of contagious disease. Storage: protect from light.
  • HY-126419
    Kobophenol A

    		SARS-CoV PKC Infection
    Kobophenol A, an oligomeric stilbene, blocks the interaction between the ACE2 receptor and S1-RBD with an IC50 of 1.81 μM and inhibits SARS-CoV-2 viral infection in cells with an EC50 of 71.6 μM. Kobophenol A inhibits the activity of partially purified rat brain protein kinase C (PKC) with an IC50 of 52 µM.
  • HY-19840
    Voxilaprevir

    GS-9857

    		 HCV Protease Infection
    Voxilaprevir (GS-9857) is a noncovalent, reversible inhibitor of HCV NS3/4A protease inhibitor (PI) with pangenotypic antiviral activity. Voxilaprevir inhibits genotype 1b and 3a wild-type NS3 proteases with Ki values of 0.038 nM and 0.066 nM, respectively. Voxilaprevir is an orally active direct-acting antiviral agent (DAA) and can be used for HCV infection research.
  • HY-14391
    PSI-353661

    GS-558093

    		 HCV Infection
    PSI-353661 (GS-558093) is a purine nucleotide NS5B polymerase inhibitor against HCV infection. PSI-353661 shows EC90s of 8 nM and 11 nM for wild type and S282T resistant replicons of HCV. PSI-353661 can produce high concentrations of the active triphosphate in primary human hepatocytes.
  • HY-A0248A
    Polymyxin B1

    		Bacterial Infection
    Polymyxin B1 is a potent antimicrobial lipopeptide first derived from Bacilus polymyxa. Polymyxin B1 is the major component in Polymyxin B (HY-A0248). Polymyxin B1 can induce lysis of bacterial cells through interaction with their membranes. Polymyxin B1 has the potential for multidrug-resistant Gram-negative bacterial infections treatment.
  • HY-B0455B
    Lomefloxacin (aspartate)

    SC47111A (aspartate)

    		 Bacterial Antibiotic Infection
    Lomefloxacin (SC47111A) aspartate is a broad-spectrum quinolone antibiotic, with antimicrobial activity. Lomefloxacin aspartate can be used for researching respiratory tract infections, genitourinary infections, gastrointestinal infections, ENT infections, etc..
  • HY-N7696
    Physalin F

    		Apoptosis Inflammation/Immunology
    Physalin F is a secosteroid with potent anti-inflammatory and immunomodulatory activities. Physalin F induces apoptosis of PBMC, decreasing the spontaneous proliferation and cytokine production caused by Human T-lymphotropic virus type 1 (HTLV-1) infection.
  • HY-B1916
    Acetylspiramycin

    Spiramycin B; Spiramycin II; Foromacidin B

    		 Antibiotic Bacterial Parasite Infection
    Acetylspiramycin (Spiramycin B; Spiramycin II; Foromacidin B) is a potent and orally active macrolide antibiotic produced by various Streptomyces species, an acetylated derivative of Spiramycin (HY-100593). Acetylspiramycin is an antimicrobial agent with activity against gram-positive organisms, including Streptococcus pyogenes, S. viridans, Corynebacterium diphtheriae and methicillin-sensitive Staphylococcus aureus. Acetylspiramycin is also a potent antiprotozoal agent that against parasitic infection caused by Cryptosporidium spp.
  • HY-145741
    MptpB-IN-1

    		Antibiotic Infection
    MptpB-IN-1 (Compound 13) is a potent and orally active inhibitor of MptpB. Mycobacterium tuberculosis protein-tyrosine-phosphatase B (MptpB) is a secreted virulence factor that subverts antimicrobial activity in the host. MptpB-IN-1 reduces multidrug-resistant mycobacterium tuberculosis survival and infection burden.
  • HY-144068
    Cap-dependent endonuclease-IN-25

    		Influenza Virus Infection
    Cap-dependent endonuclease-IN-25 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-25 is a macrocyclic pyridotriazine derivative. Cap-dependent endonuclease-IN-25 has the potential for the research of viral infections caused by viruses belonging to the Orthomyxoviridae family (extracted from patent WO2020075080A1, compound 4).
  • HY-144347
    HF51116

    		CXCR Cancer Infection
    HF51116 is a potent antagonist of CXCR4. HF51116 strongly antagonizes SDF-1α-induced cell migration, calcium mobilization, and CXCR4 internalization. HF51116 inhibits HIV-1 infection via CXCR4. HF51116 has the potential for the research of HIV-1 infection, hematopoietic stem cell mobilization, and cancer metastasis.
  • HY-16908A
    Lefamulin acetate

    BC-3781 acetate

    		 Bacterial Antibiotic Infection Inflammation/Immunology
    Lefamulin (BC-3781) acetate is an orally active antibiotic. Lefamulin acetate inhibits protein synthesis by binding to the peptidyl transferase center of the 50S bacterial ribosome. Lefamulin acetate has anti-inflammatory activity. Lefamulin acetate can be used in the research of bacterial infections, such as bacterial pneumonia.
  • HY-B0318
    Metronidazole

    		Bacterial Parasite Apoptosis Antibiotic Cancer Infection Inflammation/Immunology
    Metronidazole is an orally active nitroimidazole antibiotic. Metronidazole can cross blood brain barrier. Metronidazole can be used for the research of anaerobic infections.
  • HY-130379
    Propargyl-PEG8-acid

    		ADC Linker PROTAC Linkers Bacterial Cancer Infection
    Propargyl-PEG8-acid is a PEG-based PROTAC linker can be used in the synthesis of PROTACs. Propargyl-PEG8-acid is a cleavable ADC linker used in the synthesis of antibody-drug conjugates (ADCs). The ADCs can be used in bacterial infections caused by Gram-negative bacteria.
  • HY-123305
    5-Hydroxymebendazole

    		Parasite Others
    5-Hydroxymebendazole is the one metabolite of Benzimidazoles. Benzimidazoles are safe, broad-spectrum anthelmintic agents and are widely used for prevention and treatment of parasitic infections in food-producing animals.
  • HY-A0208
    Rosoxacin

    Acrosoxacin

    		 Bacterial Antibiotic Infection
    Rosoxacin (Acrosoxacin) is an orally active and broad-spectrum antibacterial quinolone antibiotic. Rosoxacin inhibits Gram-negative bacteria, including N. gonorrhoeae (MIC range=0.03-0.125 µg/mL).Rosoxacin can be used in studies of urinary tract infections and certain sexually transmitted diseases.
  • HY-151446
    ZIKV-IN-3

    		DNA Methyltransferase Virus Protease Infection
    ZIKV-IN-3 (compound 5a), an andrographolide derivatives, is a potent ZIKV NS5 methyl transferase (MTase) inhibitor with an IC50 value of 18.34 μM. ZIKV-IN-3 inhibits ZIKV replication and infection. ZIKV-IN-3 can be used in research of Zika virus (ZIKV).
  • HY-144047
    HBV-IN-16

    		HBV DNA/RNA Synthesis Infection
    HBV-IN-16 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-16 is a quinoline derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2019121357A1, compound 1).
  • HY-144046
    HBV-IN-15

    		HBV DNA/RNA Synthesis Infection
    HBV-IN-15 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-15 is a flavone derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2020052774A1, compound 2).
  • HY-144045
    HBV-IN-14

    		HBV DNA/RNA Synthesis Infection
    HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5).
  • HY-N7139A
    Penicillin G benzathine

    Benzathine benzylpenicillin

    		 Bacterial Antibiotic Infection
    Penicillin G benzathine (Benzathine benzylpenicillin) is an antibiotic against many bacterial infections.
  • HY-N0440
    Germacrone

    		Influenza Virus Infection
    Germacrone is extracted from Rhizoma Curcuma. Germacrone inhibits influenza virus infection.
  • HY-B0576
    Sulfacetamide Sodium

    		Bacterial Antibiotic Infection
    Sulfacetamide Sodium is an anti-infective agent that is used topically to treat skin infections and orally for urinary tract infections.
  • HY-105752
    Loflucarban

    Fluonilid

    		 Fungal Infection
    Loflucarban (Fluonilid) is a potent antimycotic agent. Loflucarban can be used for the research of the ear infections.
  • HY-N7123
    Sulfacetamide

    Sulphacetamide

    		 Bacterial Antibiotic Infection
    Sulfacetamide (Sulphacetamide), a bacteriostatic sulphonamide, is a popular antibiotic prescribed for treating ocular infections.
  • HY-B0337S
    Sulfadimethoxine-d4

    Sulphadimethoxine-d4

    		 Bacterial Infection
    Sulfadimethoxine-d4 is a deuterium labeled Sulfadimethoxine (Sulphadimethoxine). Sulfadimethoxine is a sulfonamide antibiotic used to treat many infections including treatment of respiratory, urinary tract, enteric, and soft tissue infections[1].
  • HY-148790
    Pralurbactam

    		Bacterial Infection
    Pralurbactam is a β-Lactamase inhibitor. Pralurbactam can be used for research of bacterial infection.
  • HY-B1782
    Sulfamoxole

    		Bacterial Antibiotic Infection
    Sulfamoxole is a broad- spectrum chemotherapeutic antimicrobial agent. Sulfamoxole can be used for the study of pediatric infections.
  • HY-N7139B
    Penicillin G benzathine tetrahydrate

    Benzathine benzylpenicillin tetrahydrate

    		 Bacterial Infection
    Penicillin G benzathine tetrahydrate (Benzathine benzylpenicillin tetrahydrate) is an antibiotic against many bacterial infections.
  • HY-121368
    Mahanine

    		Parasite Cancer Infection Inflammation/Immunology
    Mahanine is a carbazole alkaloid with various biological properties. Mahanine is a potent anticancer agent against different types of cancer cells. Mahanine exhibits antileishmanial activity and can be used for Leishmania?infection research research.
  • HY-126417
    Methylenetanshinquinone

    		Parasite Infection
    Methylenetanshinquinone is a natural compound with antiplasmodial, antitrypanosomal and antioxidative activities. Methylenetanshinquinone can be used for the research of parasite infection.
  • HY-B0330D
    (R)-Ofloxacin

    Dextrofloxacin

    		 Bacterial Antibiotic Infection
    (R)-Ofloxacin (Dextrofloxacin) is an antibiotic useful for the treatment of a number of bacterial infections. Antibacterial activity.
  • HY-147876
    Antimicrobial agent-3

    		Bacterial Fungal Infection
    Antimicrobial agent-3 (Compound U10) is an antimicrobial agent against bacterial, fungal and tubercular infections.
  • HY-B0555A
    Nafcillin sodium monohydrate

    		Bacterial Antibiotic Infection
    Nafcillin sodium monohydrate, an antibiotic, is a reversible inhibitor of β-lactamase. Nafcillin sodium monohydrate can be used for the research of staphylococcal infections.
  • HY-B1244S
    Dimetridazole-d3

    1,2-Dimethyl-5-nitroimidazole-d3

    		 Parasite Antibiotic Infection
    Dimetridazole-d3 is a deuterium labeled Dimetridazole. Dmetridazole, a nitroimidazole-based antibiotic, combats protozoan infections[1].
  • HY-113678
    Colistin

    Polymyxin E

    		 Antibiotic Bacterial Infection
    Colistin (Polymyxin E) is an orally active polypeptide antibiotic. Colistin has excellent activity against various Gram-negative rod-shaped bacteria, including multidrug-resistant Pseudomonas aeruginosa, Acinetobacter baumannii and Klebsiella pneumoniae. Colistin is associated with nephrotoxicity. Colistin can be used for the research of infections caused by Gram-negative bacilli.
  • HY-N9690
    Longistyline A

    Longistylin A

    		 Bacterial Infection Neurological Disease
    Longistyline A (Longistylin A) is a natural stilbene, it can be isolated from leaves of Cajanus cajan. Longistyline A shows antimicrobial activity against MRSA with an MIC value of 1.56 μg/mL. Longistyline A shows neuroprotective effects, it can be used for the research of infection and nerve diseases.
  • HY-139805
    Ticarcillin

    		Antibiotic Bacterial Infection
    Ticarcillin is a semisynthetic, extended-spectrum, carboxypenicillin antibacterial agent, and is active against gram-positive cocci, including streptococci and staphylococci. Ticarcillin is also effective against most gram-negative organisms, including Pseudomonas aeruginosa. Ticarcillin can be used in lower respiratory tract infections, skin and skin structure infections, urinary tract infections, and intraabdominal infections research.
  • HY-B1244
    Dimetridazole

    1,2-Dimethyl-5-nitroimidazole

    		 Parasite Antibiotic Infection
    Dmetridazole (1,2-Dimethyl-5-nitroimidazole), a nitroimidazole-based antibiotic, combats protozoan infections.
  • HY-N4181
    Kanzonol C

    		Bacterial Fungal Infection
    Kanzonol C, a flavonoid isolated from the twigs of Dorstenia barteri (Moraceae), has potential to treat bacterial and fungal infections.
  • HY-B0239S
    Chloramphenicol-d5

    		Bacterial Antibiotic Infection
    Chloramphenicol-d5 is the deuterium labeled Chloramphenicol. Chloramphenicol is a broad-spectrum antibiotic against bacterial infections[1][2].
  • HY-P2295
    Dabcyl-KTSAVLQSGFRKME-Edans TFA

    		SARS-CoV Others
    Dabcyl-KTSAVLQSGFRKME-Edans TFA is a fluorogenic peptide. Dabcyl-KTSAVLQSGFRKME-Edans TFA is used as the substrate to measure the enzymatic activities of protease forms. Dabcyl-KTSAVLQSGFRKME-Edans TFA has the potential for study 2019-nCoV (COVID-19) infection.
  • HY-132269
    Isoflupredone

    		Others Inflammation/Immunology
    Isoflupredone belongs to the class of corticosteroids and exerts its effect by binding to glucocorticoid and mineralocorticoid receptors of animals, such as horses. Isoflupredone can be used in wide range of conditions, such as infection and inflammatory diseases.
  • HY-P99954
    Rivabazumab pegol

    		Bacterial Infection
    Rivabazumab pegol is a PcrV protein antibody that can be used to study the phase II pegylated Fab of chronic Pseudomonas aeruginosa infection.
  • HY-N3754
    Dihydropinosylvin monomethyl ether

    		Parasite Infection
    Dihydropinosylvin monomethyl ether is a natrual compound with nematicidal activity. Dihydropinosylvin monomethyl ether can inhibit pine wood nematodes infection.
  • HY-143478
    HIV-IN-1

    		HIV Infection
    HIV-IN-1 (Compound 50) is a potent inhibitor of HIV. HIV-IN-2 has the potential for the research of HIV infection.
  • HY-143479
    HIV-IN-2

    		HIV Infection
    HIV-IN-2 (Compound 100) is a potent inhibitor of HIV. HIV-IN-2 has the potential for the research of HIV infection.
  • HY-17431
    Fosamprenavir Calcium Salt

    GW433908G

    		 HIV Endogenous Metabolite Infection
    Fosamprenavir Calcium Salt (GW433908G) is a phosphate ester proagent of the antiretroviral protease inhibitor Amprenavir, with improved solubility. Anti-HIV infection.
  • HY-B1784
    Sulfisomidin

    Sulfaisodimidine

    		 Bacterial Antibiotic Infection
    Sulfisomidin (Sulfaisodimidine) is an orally active short-acting sulfonamide antibacterial. Sulfisomidin can be used for the research of lower urinary tract infections.
  • HY-N2216
    Polygalasaponin XXXI

    Onjisaponin F

    		 Influenza Virus Infection
    Polygalasaponin XXXI (Onjisaponin F) is an effective adjuvant for intranasal administration of influenza Influenza hemagglutinin (HA) vaccine to protect influenza virus infection.
  • HY-78726
    Fosamprenavir

    Amprenavir phosphate; GW 433908

    		 HIV Endogenous Metabolite Infection
    Fosamprenavir (Amprenavir phosphate;GW 433908) is a phosphate ester proagent of the antiretroviral protease inhibitor Amprenavir, with improved solubility. Anti-HIV infection.
  • HY-152219
    CLK1-IN-2

    		CDK Cancer Infection
    CLK1-IN-2 is metabolically stable Clk1 inhibitor. CLK1-IN-2 has selectivity for Clk1 with an IC50 value of 1.7 nM. CLK1-IN-2 can be used for the research of tumour, Duchenne's muscular dystrophy and viral infections such as HIV-1 and influenza.
  • HY-B0549A
    Flavoxate hydrochloride

    Rec-7-0040; DW61

    		 Phosphodiesterase (PDE) Calcium Channel mAChR Neurological Disease
    Flavoxate hydrochloride is a potent and competitive phosphodiesterase (PDE) inhibitor. Flavoxate hydrochloride is an antispasmodic agent and muscarinic mAChR antagonist. Flavoxate hydrochloride shows moderate calcium antagonistic activity and local anesthetic effect. Flavoxate hydrochloride can be used for the research of overactive bladder (OAB) and lower urinary tract infections.
  • HY-N10834
    (6E,12E)-Tetradecadiene-8,10-diyne-1,3-diol

    		Bacterial Infection
    (6E,12E)-Tetradecadiene-8,10-diyne-1,3-diol is an antibacterial compound. (6E,12E)-Tetradecadiene-8,10-diyne-1,3-diol can be isolated from the roots of Atractylodes japonica. (6E,12E)-Tetradecadiene-8,10-diyne-1,3-diol has anti-methicillin-resistant Staphylococcus aureus (MRSA) activity with MIC values of 4-32 μg/mL. (6E,12E)-Tetradecadiene-8,10-diyne-1,3-diol can be used for the research of bacterial infection.
  • HY-N7123S
    Sulfacetamide-d4

    Sulphacetamide-d4

    		 Bacterial Antibiotic Infection
    Sulfacetamide-d4 is the deuterium labeled Sulfacetamide. Sulfacetamide (Sulphacetamide), a bacteriostatic sulphonamide, is a popular antibiotic prescribed for treating ocular infections[1][2].
  • HY-16487
    Temafloxacin

    TMFX; TA-167 free acid; A-62254 free acid

    		 Bacterial Antibiotic Infection
    Temafloxacin (TMFX) is an orally active quinolone broad-spectrum antibacterial agent. Temafloxacin is well tolerated in lower respiratory and genitourinary tract infections.
  • HY-B0337S2
    Sulfadimethoxine-13C6

    Sulphadimethoxine-13C6

    		 Bacterial Antibiotic Infection
    Sulfadimethoxine- 13C6 is the 13C-labeled Sulfadimethoxine. Sulfadimethoxine (Sulphadimethoxine) is a sulfonamide antibiotic used to treat many infections[1][2].
  • HY-113595
    Temafloxacin hydrochloride

    TMFX hydrochloride; TA-167; A-62254

    		 Antibiotic Bacterial Infection
    Temafloxacin (TMFX) hydrochloride is an orally active quinolone broad-spectrum antibacterial agent. Temafloxacin hydrochloride is well tolerated in lower respiratory and genitourinary tract infections.
  • HY-10353AS
    Raltegravir-d3 potassium

    MK 0518-d3 (potassium)

    		 HIV Integrase HIV Infection
    Raltegravir-d3 (potassium) is the deuterium labeled Raltegravir potassium. Raltegravir (MK 0518) potassium is a potent integrase (IN) inhibitor, used to treat HIV infection[1][2].
  • HY-B1043
    Piromidic acid

    		Bacterial Antibiotic Infection
    Piromidic acid is an antibacterial agent. Piromidic acid is active against gramnegative bacteria and staphylococci and can be used for the research of intestinal, urinary, and biliary tract infections.
  • HY-B0549
    Flavoxate

    Rec-7-0040 free base; DW61 free base

    		 Phosphodiesterase (PDE) Calcium Channel mAChR Neurological Disease
    Flavoxate is a potent and competitive phosphodiesterase (PDE) inhibitor. Flavoxate is an antispasmodic agent and muscarinic mAChR antagonist. Flavoxate shows moderate calcium antagonistic activity and local anesthetic effect. Flavoxate can be used for the research of overactive bladder (OAB) and lower urinary tract infections.
  • HY-148569
    TMV-IN-3

    		TMV Bacterial Cancer Infection Inflammation/Immunology
    TMV-IN-3, chalcone derivative, is a tobacco mosaic virus (TMV) inhibitor. TMV-IN-3 has antiviral activity against TMV with an EC50 value of 120.3 μg/mL. TMV-IN-3 can be used for the research of infection, inflammation and tumor.
  • HY-148568
    TMV-IN-2

    		TMV Bacterial Cancer Infection Inflammation/Immunology
    TMV-IN-2, chalcone derivative, is a tobacco mosaic virus (TMV) inhibitor. TMV-IN-2 has antiviral activity against TMV with an EC50 value of 89.9 μg/mL. TMV-IN-2 can be used for the research of infection, inflammation and tumor.
  • HY-P99343
    Atoltivimab

    REGN3470

    		 Filovirus Infection
    Atoltivimab (REGN3470), or maftivimab/odesivimab (Inmazeb) is the first Food and agent Administration (FDA)-approved monoclonal antibody to target Zaire ebolavirus (EBOVs) infection.
  • HY-136462
    CYM50358

    		LPL Receptor Infection
    CYM50358 is a potent and selective S1PR4 antagonist, with an IC50 of 25 nM. CYM50358 can be used for the research of influenza infection.
  • HY-100577
    Ticarcillin sodium

    		Bacterial Antibiotic Infection
    Ticarcillin sodium is an injectable antibiotic for the treatment of Gram-negative bacteria, particularly Pseudomonas aeruginosa. It is also one of the few antibiotics capable of treating Stenotrophomonas maltophilia infections.
  • HY-N4118
    Cephaeline

    (-)-Cephaeline; NSC 32944 free base

    		 Influenza Virus Filovirus Infection
    Cephaeline is a phenolic alkaloid in Indian Ipecac roots. Cephaeline exhibits potent inhibition of both Zika virus (ZIKV) and Ebola virus (EBOV) infections.
  • HY-B0555
    Nafcillin

    		Antibiotic Bacterial Infection
    Nafcillin, an antibiotic, is a reversible inhibitor of β-lactamase. Nafcillin exhibits bactericidal activity, and can be used for the research of staphylococcal infections.
  • HY-105070
    Eritoran

    		EBV Toll-like Receptor (TLR) Infection
    Eritoran is a Toll-like receptor 4 (TLR4) antagonist. Eritoran protects mice against lethal influenza virus infection, such as Ebola virus (EBOV), Marburg virus (MARV). Eritoran decreases the level of granulocytosis, may alleviate the severity of the "cytokine storm". Eritoran inhibits pathogenesis of filovirus infection.
  • HY-B1282A
    Sulfaquinoxaline sodium salt

    		Bacterial Parasite Antibiotic Infection
    Sulfaquinoxaline sodium salt is an antimicrobial for veterinary use, with activity against a broad spectrum of Gram-negative and Gram-positive bacteria. Sulfaquinoxaline is used to prevent coccidiosis and bacterial infections.
  • HY-B1282
    Sulfaquinoxaline

    		Bacterial Parasite Antibiotic Infection
    Sulfaquinoxaline is an antimicrobial for veterinary use, with activity against a broad spectrum of Gram-negative and Gram-positive bacteria. Sulfaquinoxaline is used to prevent coccidiosis and bacterial infections.
  • HY-B0277A
    Vidarabine phosphate

    ara-AMP; ara-A 5'-monophosphate

    		 HBV Antibiotic Infection
    Vidarabine phosphate (Ara-AMP), an antiviral agent, inhibits chronic HBV infection. Vidarabine phosphate also against herpes simplex and varicella zoster viruses.
  • HY-17426S
    Famciclovir-d4

    BRL 42810-d4

    		 Isotope-Labeled Compounds HSV Infection
    Famciclovir-d4 is the deuterium labeled Famciclovir. Famciclovir (BRL 42810) is a guanine analogue antiviral agent used for the treatment of various herpesvirus infections[1][2].
  • HY-N2076
    Cephaeline hydrochloride

    (-)-Cephaeline hydrochloride; NSC 32944 monohydrochloride

    		 Influenza Virus Filovirus Infection
    Cephaeline hydrochloride ((-)-Cephaeline hydrochloride) is a phenolic alkaloid in Indian Ipecac roots. Cephaeline hydrochloride exhibits potent inhibition of both Zika virus (ZIKV) and Ebola virus (EBOV) infections.
  • HY-N7067
    Revaprazan hydrochloride

    		Bacterial COX Infection
    Revaprazan hydrochloride is a novel acid pump antagonist (APA). Revaprazan hydrochloride reduces COX-2 expression and has significant anti-inflammatory actions activities in H. pylori infection.
  • HY-143757
    Cap-dependent endonuclease-IN-10

    		Influenza Virus Infection
    Cap-dependent endonuclease-IN-10 is a potent inhibitor of cap-dependent endonuclease (CEN). Not only can Cap-dependent endonuclease-IN-10 inhibit influenza virus well, but also has lower cytotoxicity, better in vivo pharmacokinetic and in vivo pharmacodynamic properties, and better hepatic microsomal stability. Cap-dependent endonuclease-IN-10 has the potential for the research of viral infections (including influenza A, influenza B and influenza C) (extracted from patent WO2021129799A1, compound 1-1).
  • HY-W009886S
    3,4,5-Trimethoxybenzaldehyde-d3

    		Bacterial Infection
    3,4,5-Trimethoxybenzaldehyde-d3 is the deuterium labeled 3,4,5-Trimethoxybenzaldehyde. 3,4,5-Trimethoxybenzaldehyde is an intermediate for the synthesis of various pharmaceuticals, especially for?trimethoprim?used to research bacterial infections, including urinary tract pathogens infection.
  • HY-147358A
    Yimitasvir

    Emitasvir; DAG-181

    		 HCV Infection
    Yimitasvir (Emitasvir) is an orally active hepatitis C virus (HCV) nonstructural protein 5A (NS5A) inhibitor. Yimitasvir can be used for research of chronic HCV infection.
  • HY-B0555BS
    Nafcillin-d5 sodium

    		Antibiotic Infection
    Nafcillin-d5 (sodium) is the deuterium labeled Nafcillin sodium. Nafcillin sodium, an antibiotic, is a reversible inhibitor of β-lactamase. Nafcillin sodium can be used for the research of staphylococcal infections[1][2].
  • HY-B0509
    Amikacin hydrate

    BAY 41-6551 hydrate

    		 Bacterial Antibiotic Infection Cancer
    Amikacin hydrate (BAY 41-6551 hydrate) is an aminoglycoside antibiotic and a semisynthetic analog of kanamycin. Amikacin hydrate is bactericidal, acting directly on the 30S and 50S bacerial ribosomal subunits to inhibit protein synthesis. Amikacin hydrate is very active against most Gram-negative bacteria including gentamicin- and tobramycin-resistant strains. Amikacin hydrate also inhibits the infections caused by susceptible Nocardia and nontuberculous mycobacteria.
  • HY-17589
    Chloroquine phosphate

    		Parasite Autophagy SARS-CoV Toll-like Receptor (TLR) HIV Antibiotic Cancer Infection Inflammation/Immunology
    Chloroquine phosphate is an antimalarial and anti-inflammatory agent widely used to treat malaria and rheumatoid arthritis. Chloroquine phosphate is an autophagy and toll-like receptors (TLRs) inhibitor. Chloroquine phosphate is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC50=1.13 μM).
  • HY-17589B
    Chloroquine dihydrochloride

    		Parasite Autophagy SARS-CoV Toll-like Receptor (TLR) HIV Antibiotic Cancer Infection Inflammation/Immunology
    Chloroquine dihydrochloride is an antimalarial and anti-inflammatory agent widely used to treat malaria and rheumatoid arthritis. Chloroquine dihydrochloride is an autophagy and toll-like receptors (TLRs) inhibitor. Chloroquine dihydrochloride is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC50=1.13 μM).
  • HY-17589A
    Chloroquine

    		Parasite Autophagy SARS-CoV Toll-like Receptor (TLR) HIV Antibiotic Cancer Infection Inflammation/Immunology
    Chloroquine is an antimalarial and anti-inflammatory agent widely used to treat malaria and rheumatoid arthritis. Chloroquine is an autophagy and toll-like receptors (TLRs) inhibitor. Chloroquine is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC50=1.13 μM).
  • HY-B0395B
    Sitafloxacin monohydrate

    DU6859a monohydrate

    		 Bacterial Antibiotic Infection
    Sitafloxacin (DU6859a) monohydrate is a potent, orally active fluoroquinolone antibiotic. Sitafloxacin monohydrate shows antichlamydial activity and antibacterial activities against a broad range of gram-positive and gram-negative bacteria, including anaerobic bacteria, as well as against atypical pathogens. Sitafloxacin monohydrate can be used for the research of respiratory tract infection and urinary tract infection.
  • HY-P99804
    Clesrovimab

    MK1654

    		 RSV Infection
    Clesrovimab (MK1654) is a fully human, anti-RSV fusion (RSV F) glycoprotein monoclonal antibody. Clesrovimab has the potential for the research of respiratory syncytial virus infection.
  • HY-B0330DS
    (R)-Ofloxacin-d3

    		Bacterial Antibiotic Infection
    (R)-Ofloxacin-d3 is the deuterium labeled (R)-Ofloxacin. (R)-Ofloxacin (Dextrofloxacin) is an antibiotic useful for the treatment of a number of bacterial infections[1]. Antibacterial activity[1].
  • HY-P99693
    Lenvervimab

    GC1102

    		 HBV Infection
    Lenvervimab (GC1102) is a IgG1-type recombinant human hepatitis B Immunoglobulin. Lenvervimab can be used for research of hepatitis B virus infection.
  • HY-148323
    Anti-Trypanosoma cruzi agent-4

    		Parasite Infection
    Anti-Trypanosoma cruzi agent-4 (compound 5c) is an inhibitor of Trypanosoma cruzi. Anti-Trypanosoma cruzi agent-4 can be used for the research of infection.
  • HY-B0035S
    Sulfamethazine-d4

    Sulfadimidine-d4; Sulfadimerazine-d4

    		 Bacterial Infection
    Sulfamethazine-d4 is a deuterium labeled Sulfamethazine (Sulfadimidine). Sulfamethazine is an antimicrobial that is widely used to treat and prevent various animal diseases (such as gastrointestinal and respiratory tract infections)[1][2].
  • HY-B1637S
    Ditiocarb-d10 sodium

    		HIV Infection
    Ditiocarb-d10 (sodium) is the deuterium labeled Ditiocarb sodium[1]. Ditiocarb sodium (Sodium diethyldithiocarbamate) is an accelerator of the rate of copper cementation. Sodium diethyldithiocarbamate reduces the incidence of HIV infection[2][3].
  • HY-147411
    Ulonivirine

    MK-8507

    		 Reverse Transcriptase HIV Infection
    Ulonivirine (MK-8507) is an orally active non-nucleoside reverse transcriptase inhibitor with high antiviral activity. Ulonivirine can be used for the research of HIV-1 infection.
  • HY-147240
    Acloproxalap

    		Others Infection Inflammation/Immunology Cardiovascular Disease
    Acloproxalap is a quinoline-based aldehyde scavenger that can be used in studies of diseases with toxic aldehyde accumulation, such as inflammatory diseases of the eye and skin, respiratory diseases such as pneumonia, organ diseases, and viral infection-related syndromes.
  • HY-147808
    CXCR4 antagonist 7

    		CXCR HIV Infection Cancer Inflammation/Immunology
    CXCR4 antagonist 7 (Compound PARA-B) is a CXCR4 antagonist with the IC50 of 9.3 nM. CXCR4 antagonist 7 can be used for the research of HIV infection, inflammatory diseases, cancer, and WHIM syndrome.
  • HY-147358
    Yimitasvir diphosphate

    Emitasvir diphosphate; DAG-181 diphosphate

    		 HCV Infection
    Yimitasvir (Emitasvir) diphosphate is an orally active hepatitis C virus (HCV) nonstructural protein 5A (NS5A) inhibitor and can be used for research of chronic hepatitis C virus infection.
  • HY-118877
    Urea-13C

    		Isotope-Labeled Compounds Infection
    Urea- 13C is the 13C labelled urea. The Urea- 13C breath test ( 13C-UBT) is one of the best methods for the diagnosis of Helicobacter pylori infection[1].
  • HY-P2036
    FSL-1

    		Toll-like Receptor (TLR) Antibiotic Infection
    FSL-1, a bacterial-derived toll-like receptor 2/6 (TLR2/6) agonist, enhances resistance to experimental HSV-2 infection.
  • HY-106997
    Icofungipen

    BAY 10-8888; PLD 118

    		 Fungal Infection
    Icofungipen is an orally active antifungal agent. Icofungipen is the representative of beta amino acids, is toxic against Candida species. Icofungipen protects infected mice survival from C. albicans infection.
  • HY-N10014
    Bulnesol

    		Fungal Infection
    Bulnesol is a sesquiterpenoid that can be isolated from Salvia dorystaechas. Bulnesol inhibits the activity of Fusarium moniliforme with an EC50 value of 0.6 mg/mL. Bulnesol can be used for the research of fungal infection.
  • HY-U00131S
    Sulfabrom-d4

    N 3517-d4; Sulfabromomethazine-d4

    		 Isotope-Labeled Compounds Others
    Sulfabrom-d4 (N 3517-d4) is is the deuterium labeled Sulfabrom (HY-U00131). Sulfabrom is a long-acting Sulfonamide that is used for the treatment of coccidiosis and various bacterial infections in the poultry, swine and cattle.
  • HY-148567
    TMV-IN-1

    		TMV Bacterial Cancer Infection Inflammation/Immunology
    TMV-IN-1, chalcone derivative, is a tobacco mosaic virus (TMV) inhibitor. TMV-IN-1 has good therapeutic activity and protective activity against TMV with EC50 values of 70.7 μg/mL and 60.8 μg/mL, respectively. TMV-IN-1 can be used for the research of infection, inflammation and tumor.
  • HY-P1222B
    LL-37, human acetate

    		Bacterial Infection Inflammation/Immunology
    LL-37, human acetate is a 37-residue, amphipathic, cathelicidin-derived antimicrobial peptide, which exhibits a broad spectrum of antimicrobial activity. LL-37, human acetate could help protect the cornea from infection and modulates wound healing.
  • HY-B0509B
    Amikacin disulfate

    BAY 41-6551 disulfate

    		 Bacterial Antibiotic Infection Cancer
    Amikacin disulfate (BAY 41-6551 dissulfate) is an aminoglycoside antibiotic and a semisynthetic analog of kanamycin. Amikacin disulfate is bactericidal, acting directly on the 30S and 50S bacerial ribosomal subunits to inhibit protein synthesis. Amikacin disulfate is very active against most Gram-negative bacteria including gentamicin- and tobramycin-resistant strains. Amikacin disulfate also inhibits the infections caused by susceptible Nocardia and nontuberculous mycobacteria.
  • HY-107813
    Amikacin sulfate

    BAY 41-6551 sulfate

    		 Bacterial Antibiotic Infection Cancer
    Amikacin sulfate (BAY 41-6551 sulfate) is an aminoglycoside antibiotic and a semisynthetic analog of kanamycin. Amikacin sulfate is bactericidal, acting directly on the 30S and 50S bacerial ribosomal subunits to inhibit protein synthesis. Amikacin sulfate is very active against most Gram-negative bacteria including gentamicin- and tobramycin-resistant strains. Amikacin sulfate also inhibits the infections caused by susceptible Nocardia and nontuberculous mycobacteria.
  • HY-148690
    L18-MDP

    		Bacterial Fungal Infection
    L18-MDP is a derivative of muramyl dipeptide, an antibacterial agent. L18-MDP has antibacterial activity and has potential applications in bacterial and fungal infections.
  • HY-78726S
    Fosamprenavir-d4

    Amprenavir phosphate-d4; GW 433908-d4

    		 Isotope-Labeled Compounds HIV Endogenous Metabolite Infection
    Fosamprenavir-d4 is deuterium labeled Fosamprenavir. Fosamprenavir (Amprenavir phosphate;GW 433908) is a phosphate ester proagent of the antiretroviral protease inhibitor Amprenavir, with improved solubility[1]. Anti-HIV infection[1].
  • HY-19466
    Cefilavancin

    TD-1792

    		 Bacterial Antibiotic Infection
    Cefilavancin (TD-1792) is a potent multivalent glycopeptide-cephalosporin heterodimer antibiotic with effective activity against Gram-positive bacteria. Cefilavancin has been used to research skin infections.
  • HY-P99722
    Maftivimab

    REGN3470-3471-3479

    		 Filovirus Infection
    Maftivimab (REGN3470-3471-3479), the inhibitor of Filovirus, is an Food and agent Administration (FDA)-approved agent. Maftivimab, also named as Atoltivimab, Odesivimab (Inmazeb), can be used for research of Zaire ebolavirus infection.
  • HY-B1325
    Cefuroxime axetil

    		Bacterial Antibiotic Infection
    Cefuroxime Axetil, a proagent of the cephalosporin cefuroxime and an oarl broad spectrum antibiotic, inhibits several gram-positive and gram-negative organisms, including those most frequently associated with various common community-acquired infections.
  • HY-104074
    Pocapavir

    SCH-48973; V-073

    		 Enterovirus Infection
    Pocapavir (SCH-48973) is an orally active capsid inhibitor. Pocapavir prevents virion uncoating upon entry into the cell. Pocapavir has antiviral activity against polioviruses. Pocapavir also inhibits enterovirus infections.
  • HY-19952
    Pleconaril

    VP 63843; Win 63843

    		 Enterovirus Infection
    Pleconaril is a capsid inhibitor used previously to treat enterovirus infections.
  • HY-10353
    Raltegravir

    MK-0518

    		 HIV Integrase HIV Infection
    Raltegravir is a potent integrase (IN) inhibitor, used to treat HIV infection.
  • HY-B1282S
    Sulfaquinoxaline-d4

    		Bacterial Parasite Antibiotic Infection
    Sulfaquinoxaline-d4 is the deuterium labeled Sulfaquinoxaline. Sulfaquinoxaline is an antimicrobial for veterinary use, with activity against a broad spectrum of Gram-negative and Gram-positive bacteria. Sulfaquinoxaline is used to prevent coccidiosis and bacterial infections[1][2].
  • HY-P99649
    Gremubamab

    MEDI3902

    		 Bacterial Infection
    Gremubamab (MEDI3902) is a humanized IgG1 kappa anti-PcrV/Psl monoclonal antibody. Gremubamab binds to the PA PcrV protein and Psl exopolysaccharide. Gremubamab has the potential for the research of pseudomonas aeruginosa infections.
  • HY-151439
    Antifungal agent 41

    		Fungal Infection
    Antifungal agent 41 (compound B01) is an antifungal agent. Antifungal agent 41 shows inhibitory effect on Candida albicans in virto and vivo. Antifungal agent 41 can be used for the research of invasive fungal infections.
  • HY-109137
    Selgantolimod

    GS-9688

    		 Toll-like Receptor (TLR) HBV Infection
    Selgantolimod (GS-9688) is an orally active, potent and selective toll-like receptor 8 (TLR8) agonist for the treatment of hepatitis B virus (HBV) and human immunodeficiency virus (HIV) infection.
  • HY-149050
    Viral polymerase-IN-1 hydrochloride

    		Influenza Virus SARS-CoV Infection
    Viral polymerase-IN-1 hydrochloride, a Gemcitabine (HY-17026) derivative, potently inhibits influenza A and B viruses infection with IC90 values of 11.4-15.9 μM. Viral polymerase-IN-1 hydrochloride is active against SARS-CoV-2 infection. Viral polymerase-IN-1 hydrochloride suppresses influenza virus infection by affecting viral RNA replication/transcription in cells.
  • HY-148642
    12-Hydroxynevirapine

    12-hydroxy-NVP; 12-OH-NVP

    		 Drug Metabolite Infection
    12-Hydroxynevirapine (12-hydroxy-NVP; 12-OH-NVP) is a major oxidative metabolite of Nevirapine (HY-10570). Nevirapine is a non-nucleoside reverse transcriptase inhibitor indicated for the HIV-1 infections. Nevirapine causes idiosyncratic hepatotoxicity and mild-to-severe skin rashes. 12-Hydroxynevirapine, a non-reactive metabolite, can be bioactivated by sulphotransferases (SULTs) in the liver and skin, yielding the reactive species 12-Sulphoxy-nevirapine.
  • HY-108675
    PPNDS tetrasodium

    		MMP P2X Receptor Cancer Infection
    PPNDS tetrasodium is a selective and competitive meprin β inhibitor (IC50: 80 nM, Ki: 8 nM), and also inhibits ADAM10 (IC50: 1.2 μM). PPNDS tetrasodium is also a P2X1 receptor antagonist. PPNDS is an agonist for the ATP receptor of Paramecium. PPNDS tetrasodium potently inhibits polymerases from viruses. PPNDS tetrasodium can be used in the research of infection and cancers.
  • HY-139903
    Antifungal agent 18

    		Fungal Infection
    Antifungal agent 18 is a novel antifungal agent for the research of fungal infection.
  • HY-B1790
    Terconazole

    R42470

    		 Fungal Infection
    Terconazole is a broad-spectrum antifungal medication for the treatment of vaginal yeast infection.
  • HY-137453B
    (1R)-Tenofovir amibufenamide

    (1R)-HS-10234

    		 HBV HIV Infection
    (1R)-Tenofovir amibufenamide ((1R)-HS-10234) is the isomer of Tenofovir amibufenamide, is an orally active antiviral agent. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) is a HIV infection inhibitor and HBV infection inhibitor. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) can be used for HIV infections, hepatitis B research.
  • HY-14749AS
    Pyronaridine-d4 tetraphosphate

    		Parasite Infection
    Pyronaridine-d4 (tetraphosphate) is the deuterium labeled Pyronaridine tetraphosphate[1]. Pyronaridine tetraphosphate is an orally active Mannich base anti-malarial agent. Pyronaridine tetraphosphate is active against P. falciparum and Echinococcus granulosus infection[2][3].
  • HY-P99226
    Daxdilimab

    MEDI7734; VIB7734

    		 SARS-CoV Cancer
    Daxdilimab is an anti-ILT7 monoclonal antibody, ILT7 is a cell surface molecule specific to the pDC type of dendritic cells. Daxdilimab can be used in acute lung injury (ALI) in patients with COVID-19 infection research.
  • HY-P99784
    Porgaviximab

    		Filovirus Infection
    Porgaviximab is a monoclonal antibody that can be used Ebola infection research.
  • HY-10353A
    Raltegravir potassium

    MK 0518 potassium

    		 HIV Integrase HIV Infection
    Raltegravir (MK 0518) potassium is a potent integrase (IN) inhibitor, used to treat HIV infection.
  • HY-148560
    ccc_R08

    		HBV DNA/RNA Synthesis Infection
    ccc_R08 is a non-cytotoxic and orally active cccDNA inhibitor that reduces cccDNA levels in the liver of HBV-infected mice. ccc_R08 can be used in the study of HBV virus (hepatitis B virus) infection.
  • HY-147237
    LpxC-IN-10

    		Bacterial Infection
    LpxC-IN-10 (Compound A) is a high selectivity inhibitor of LpxC. LpxC-IN-10 exhibits MIC values of 0.5 μg/mL against E. coli and K. pneumoniae. LpxC-IN-10 (Compound A) can be used for the research of bacterial infection.
  • HY-I0501
    2'-Aminoacetophenone

    		Bacterial Inflammation/Immunology
    2'-Aminoacetophenone is an aromatic compound containing a ketone substituted by one alkyl group, and a phenyl group. 2'-Aminoacetophenone can be used as a breath biomarker for the detection of Ps. Aeruginosa infections in the cystic fibrosis lung.
  • HY-17506S
    Azithromycin-d3

    		Bacterial Autophagy Antibiotic Infection Cancer
    Azithromycin-d3 is the deuterium labeled Azithromycin. Azithromycin (CP-62993) is a macrolide antibiotic useful for the treatment of a number of bacterial infections[1][2].
  • HY-151421
    Chitin synthase inhibitor 11

    		Fungal Cancer Infection
    Chitin synthase inhibitor 11 is a chitin synthase inhibitor. Chitin synthase inhibitor 11 shows excellent chitin synthase inhibitory activity with an IC50 value of 0.10 mM. Chitin synthase inhibitor 11 has broad-spectrum antifungal activity in vitro. Chitin synthase inhibitor 11 can be used for the research of invasive fungal infections (IFIs).
  • HY-149059
    Neuraminidase-IN-14

    		Influenza Virus Infection
    Neuraminidase-IN-14 is an inhibitor of neuraminidase. Neuraminidase-IN-14 inhibits the activity of La Sota Clone 30 NDV-HN with an IC50 value of 0.20 µM. Neuraminidase-IN-14 can be used for research on Newcastle disease virus (NDV) infection.
  • HY-148780
    HBV-IN-29

    		HBV Infection
    HBV-IN-29 (ex8), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-29 has the potential for the research of HBV infection.
  • HY-14922
    Fosalvudine tidoxil

    		Reverse Transcriptase HIV Infection
    Fosalvudine tidoxil is an orally active nucleoside reverse transcriptase inhibitor (NRTI). Fosalvudine tidoxil is a prodrug derived from Alovudine (HY-B1516). Fosalvudine tidoxil is less toxic than Alovudine and can be used for the research of HIV-1 infection.
  • HY-148781
    HBV-IN-30

    		HBV Infection
    HBV-IN-30 (ex44), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-30 has the potential for the research of HBV infection.
  • HY-106268A
    Larazotide acetate

    		Gap Junction Protein Inflammation/Immunology
    Larazotide acetate is a peptide which is an orally active zonulin antagonist. Larazotide acetate shows antiviral activity to varicella-zoster virus (VZV) with EC50s of 44.14 and 59.06 μM for strain OKA and 07-1, respectively. Larazotide acetate can be used for the research of celiac disease and infection.
  • HY-N0248
    Saikosaponin B2

    		HCV Cancer Infection
    Saikosaponin B2 is an active component from Bupleurum chinensis root, acts as an entry inhibitor against HCV infection. Anti-cancer activity.
  • HY-B0465
    Oxacillin sodium monohydrate

    		Bacterial Antibiotic Infection
    Oxacillin sodium monohydrate is an antibiotic similar to Flucloxacillin used in resistant staphylococci infections study.
  • HY-17392
    Zalcitabine

    2',3'-Dideoxycytidine; ddC; Dideoxycytidine

    		 HIV Reverse Transcriptase Infection
    Zalcitabine is a potent nucleoside analogue reverse transcriptase inhibitor used in the treatment of HIV infection.
  • HY-N8221
    Homoembelin

    		Bacterial Infection
    Homoembelin is an antimicrobial compound and has the potential for MDR bacterial infection research.
  • HY-14881A
    Bedaquiline fumarate

    R403323; TMC207 fumarate; R207910 fumarate

    		 Bacterial Antibiotic Infection
    Bedaquiline fumarate, a diarylquinoline antibiotic that targets ATP synthase, is effective for the treatment of Mycobacterium tuberculosis infections.
  • HY-111069
    Nifeviroc

    		CCR HIV Infection Inflammation/Immunology
    Nifeviroc is an orally active CCR5 antagonist. Nifeviroc is used for the study of HIV type-1 infection.
  • HY-151484
    Anti-infective agent 4

    		Parasite Infection
    Anti-infective agent 4 (compound 73) is an orally active inhibitor of Trypanosoma cruzi with an IC50 value of 0.016 μM. Anti-infective agent 4 effectively reduces parasite burden in vivo. Anti-infective agent 4 can be used for the research of infection.
  • HY-P2988
    Neuraminidase

    Exo-α-sialidase

    		 Endogenous Metabolite Infection
    Neuraminidase (Exo-α-sialidase) is an exosialidase, is often used in biochemical studies. Neuraminidase cleaves α-ketosidic linkage between the sialic (N-acetylneuraminic) acid and an adjacent sugar residue. Neuraminidase, derived from mucosal pathogens, is a virulence factor that modifies the host's response to infection.
  • HY-107329
    Cefathiamidine

    		Bacterial Antibiotic Infection
    Cefathiamidine is a first-generation cephalosporin antibacterial agent and is used to treat infections caused by susceptible bacteria. Cefathiamidine exhibits a wide spectrum of antimicrobial activity against bacteria. Cefathiamidine is used for the treatment of respiratory, liver, five senses, urinary tract infections, endocarditis and sepsis.
  • HY-151485
    Anti-infective agent 5

    		Parasite Infection
    Anti-infective agent 5 (compound 74) is an orally active inhibitor of Trypanosoma cruzi with an IC50 value of 0.10 μM. Anti-infective agent 5 effectively reduces parasite burden in vivo. Anti-infective agent 5 can be used for the research of infection.
  • HY-143292
    Antibacterial agent 81

    		Bacterial Infection
    Antibacterial agent 81 is a DNA transcription inhibitor. Antibacterial agent 81 inhibits S. aureus USA300 and M. smegmatis ATCC14468 with MIC values of 12.5 and 7.8 μM, respectively. Antibacterial agent 81 can be used for the research of infection.
  • HY-B0671
    Vancomycin

    		Bacterial Autophagy Antibiotic Infection Cancer
    Vancomycin is an antibiotic for the treatment of bacterial infections.
  • HY-18324
    CRS3123

    REP-3123

    		 Antibiotic Inflammation/Immunology
    CRS3123 is a potent and orally active narrow-spectrum antibiotic. CRS3123 inhibits bacterial methionyl-tRNA synthetase. CRS3123 has potent activity against Clostridium difficile (C. difficile) and aerobic Gram-positive bacteria but little activity against Gram-negative bacteria, including anaerobes. CRS3123 has the potential for the research of C. difficile infections.
  • HY-107064
    Cefroxadine

    CGP 9000; Oraspor

    		 Bacterial Antibiotic Infection
    Cefroxadine (CGP 9000) is an orally active cephalosporin antibiotic. Cefroxadine is more effective than cephalexin against Escherichia coli and Klebsiella pneumoniae with MIC values of 3.13 and 1.56 μg/mL respectively with a concentration of 10 6 μg/mL. Cefroxadine can be used for the research of infection.
  • HY-N10624
    Koshidacin B

    		Parasite Infection
    Koshidacin B is an antiplasmodial cyclic tetrapeptide with antiplasmodial activity against P. falciparum FCR3 and K1 strain with IC50 values of 0.89 and 0.83 μM, respectively. Koshidacin B suppresses malaria parasites in vivo, it can be used for the research of parasites infection.
  • HY-10353B
    Raltegravir sodium

    MK 0518 sodium

    		 HIV Integrase HIV Infection
    Raltegravir (MK 0518) sodium is a potent and orally active integrase (IN) inhibitor, used to treat HIV infection.
  • HY-B1056
    Procodazole

    Propazol; 2-Benzimidazolepropionic acid

    		 Bacterial Infection
    Procodazole is a non-specific active immunoprotective agent against viral and bacterial infections, used as a potentiator.
  • HY-B2186
    Piperazine adipate

    		Parasite Infection
    Piperazine adipate is a potent broad spectrum anthelmintic against many common worm infections in mammals.
  • HY-142695
    Antibacterial synergist 1

    		Bacterial Infection
    Antibacterial synergist 1 (compound 20P) is a bacterial biofilm inhibitor. Antibacterial synergist 1 inhibits the production of pyocyanin and biofilm formation with IC50s of 8.6 and 4.5 μM, respectively. Antibacterial synergist 1 has the potential for the research of P. aeruginosa infections.
  • HY-122529
    Almurtide

    		Bacterial Infection
    Almurtide (nor-MDP), a muramyl dipeptide derivative with anti-inflammatory and anti-tumor activity. Almurtide also shows protective effects against intraperitoneal Pseudomonas aeruginosa infection or intravenously Candida albicans infection in mice. Almurtide also inhibits the carcinogenic Friend leukemia virus.
  • HY-100500
    Lenampicillin hydrochloride

    KBT 1585 hydrochloride

    		 Bacterial Cancer
    Lenampicillin hydrochloride (KBT 1585 hydrochloride) is an orally active proagent of Ampicillin and is an effective beta-lactam antibacterial agent that inhibits bacterial penicillin-binding proteins (transpeptidase). Lenampicillin hydrochloride has improved absorption and decreased side effects compares to Ampicillin and is applied in the investigation of the suppurative skin and soft tissue infection .
  • HY-P2317
    Cecropin P1, porcine

    		Bacterial Endogenous Metabolite Infection
    Cecropin P1, porcine is an antibacterial peptide that can be isolated from the upper part of the small intestine of the pig. Cecropin P1, porcine shows antibacterial activity against Gram-negative bacteria. Cecropin P1, porcine shows antiviral activity and inhibits PRRSV infection.
  • HY-B0136
    Cefdinir

    FK-482; CI-983

    		 Bacterial Antibiotic Infection
    Cefdinir (FK-482) is a semi-synthetic, broad-spectrum antibiotic in the third generation of the cephalosporin class, which is proved to be effective for infections caused by several Gram-negative and Gram-positive bacteria. Cefdinir can be used for the research of common bacterial infections of the ear, sinus, throat, and skin.
  • HY-B1190
    Cefadroxil

    BL-S 578

    		 Bacterial Antibiotic Infection
    Cefadroxil is a broad-spectrum antibiotic of the cephalosporin type, effective in Gram-positive and Gram-negative bacterial infections.
  • HY-12639
    Bephenium

    		Parasite Infection
    Bephenium is an anthelmintic agent formerly used in the treatment of hookworm infections and ascariasis; B-type AChR activator.
  • HY-B1360
    Chlorquinaldol

    Chloquinan

    		 Bacterial Fungal Antibiotic Infection
    Chlorquinaldol (Chloquinan) is a mono-hydroxyquinoline, is an antifungal and antibacterial, used for topical treatment of skin conditions and vaginal infections.
  • HY-100956
    Flurofamide

    		Bacterial Infection
    Flurofamide is a potent bacterial urease inhibitor with potential in the treatment of infection induced urinary stones.
  • HY-20685
    Palmitoylethanolamide

    Palmidrol; Loramine P 256

    		 Influenza Virus Endogenous Metabolite Infection
    Palmitoylethanolamide (Palmidrol) is an active endogenous compound which can used for preventing virus infection of the respiratory tract.
  • HY-136638
    ML328

    		Bacterial Infection
    ML328 is a selective inhibitor of bacterial AddAB and RecBCD helicase-nucleases with IC50 values of 26 and 5.1 μM, respectively. ML328 is a gyrase inhibitor. ML328 strongly inhibits the growth of E. coli in the presence of phage. ML328 can be used for the research of bacterial infection.
  • HY-W013766
    Pipemidic acid trihydrate

    		Bacterial Antibiotic Infection
    Pipemidic acid trihydrate, a derivative of Piromidic acid, is an antibacterial agent. Pipemidic acid trihydrate inhibits DNA gyrase. Pipemidic acid trihydrate is active against gram-negative bacteria including Pseudomonas aeruginosa as well as some gram-positive bacteria. Pipemidic acid trihydrate can be used for the research of intestinal, urinary, and biliary tract infections.
  • HY-105284
    Sulopenem

    CP-70429

    		 Bacterial Antibiotic Infection
    Sulopenem (CP-70429) is an orally active, parenteral penem antibiotic with broad-spectrum activities against Gram-positive and Gram-negative bacteria. Sulopenem has the potential for urinary tract infections and intra-abdominal infections treatment. Sulopenem is inactive against Pseudomonas aeruginosa and Xanthomonas maltophilia.
  • HY-B1381A
    Cefixime trihydrate

    FR-17027 trihydrate; FK-027 trihydrate; CL-284635 trihydrate

    		 Bacterial Antibiotic Infection Inflammation/Immunology
    Cefixime trihydrate (FR-17027 trihydrate) is an antibiotic and a third generation cephalosporin antibiotic, useful for the treatment of a number of bacterial infections.
  • HY-B2033
    Pyrimethanil

    		Fungal Infection
    Pyrimethanil is an anilinopyrimidine and broad-spectrum contact fungicide for the control of Botrytis spp. on a wide variety of crops. Pyrimethanil inhibits the biosynthesis of methionine and other amino acids in Botrytis cinerea. Pyrimethanil can be used for the research of fungal diseases prevention on fruit, vegetable and ornamental plants with mold infection.
  • HY-120104
    Nitidanin

    (±)-Nitidanin

    		 Parasite HCV Infection
    Nitidanin ((±)-Nitidanin) is an antimalarial and antiviral compound that can be isolated from the wood of Xanthoxylum nitidun D. C. Nitidanin is shows IC50 values of 21.2 and 18.4 μM for D6 and W2 clones of Plasmodium falciparum, respectively. Nitidanin can be used for the research of malaria and virus infection.
  • HY-152028
    HSP90-IN-19

    		HSP Cancer Infection Inflammation/Immunology Neurological Disease
    HSP90-IN-19 is an effective heat shock protein 90 (Hsp90) inhibitor. HSP90-IN-19 has effective Hsp90 inhibitory activity with an IC50 value of 0.27 μM. HSP90-IN-19 can be used for the research of viral infection, neurodegenerative disease, and inflammation.
  • HY-152027
    HSP90-IN-18

    		HSP Apoptosis Cancer Infection Inflammation/Immunology Neurological Disease
    HSP90-IN-18 is an effective heat shock protein 90 (Hsp90) inhibitor. HSP90-IN-18 has effective Hsp90 inhibitory activity with an IC50 value of 0.39 μM. HSP90-IN-18 can be used for the research of viral infection, neurodegenerative disease, and inflammation.
  • HY-N7934
    Trachelogenin

    (-)-Trachelogenin

    		 HCV Infection Inflammation/Immunology Neurological Disease
    Trachelogenin ((-)-Trachelogenin) is an HCV entry inhibitor without genotype specificity, and with low cytotoxicity. Trachelogenin inhibits HCVcc infection and HCVpp cell entry in a dose-dependent manner with an IC50 of 0.325 and 0.259 μg/mL in HCVcc and HCVpp models, respectively. Trachelogenin exhibits effective antiviral, anti-inflammatory and analgesic effects.
  • HY-12639A
    Bephenium (hydroxynaphthoate)

    		Parasite Infection
    Bephenium hydroxynaphthoate is an anthelmintic agent formerly used in the treatment of hookworm infections and ascariasis; B-type AChR activator.
  • HY-119826
    Quinfamide

    WIN-40014

    		 Parasite Infection
    Quinfamide is an antiamebic agent. Quinfamide has the potential to treat tropical parasitic infections such as Amoebiasis and Helminthiasis.
  • HY-109056
    Elsulfavirine

    		HIV Infection
    Elsulfavirine is a reverse transcriptase inhibitors for HIV-1 infection and is a new anti-HIV agent.
  • HY-107801
    Inosine pranobex

    Imunovir; Delimmun; Groprinosin

    		 HIV Infection
    Inosine pranobex is a potent, broad-spectrum antiviral compound for HIV infection. Inosine pranobex is an immunopotentiator.
  • HY-139679
    Antibacterial agent 28

    		Bacterial Infection
    Antibacterial agent 28 is a potential antibacterial candidate for combating MRSA infections (MICs = 0.5–2 μg/mL).
  • HY-B1235
    Acetohydroxamic acid

    N-Hydroxyacetamide

    		 Bacterial Infection
    Acetohydroxamic acid is a potent and irreversible inhibitor of bacterial and plant urease and also used as adjunctive therapy in chronic urinary infection.
  • HY-B0593
    Ceftazidime

    GR20263

    		 Bacterial Antibiotic Infection
    Ceftazidime (GR20263), an antibiotic, has a broad spectrum activity against Gram-positive and Gram-negative aerobic bacteria. Ceftazidime is also active against Enterobacteriaceae (including β-lactamase-positive strains) and is resistant to hydrolysis by most β-lactamases.
  • HY-N7071A
    Maduramicin ammonium

    Maduramycin ammonium

    		 Bacterial Apoptosis Antibiotic Infection
    Maduramicin ammonium (Maduramycin ammonium) is isolated from the actinomycete Actinomadura rubra. Maduramicin ammonium (Maduramycin ammonium) is an anticoccidial agent for the the treatment of Eimeria spp., E. adenoeides, E. gallopavonis, and E. dispersa infection. Maduramicin ammonium (Maduramycin ammonium) induces cell apoptosis in chicken myocardial cells via intrinsic and extrinsic pathways.
  • HY-19773
    β-Lactamase-IN-1

    		Bacterial Infection
    β-Lactamase-IN-1 is an inhibitor of β-Lactamase extracted from patent WO2016027249A1, page 77. β-Lactamase-IN-1 can be used to prepare of tricyclic nitrogen containing compound. β-Lactamase-IN-1 can be used for the research of neisseria gonorrhea infection.
  • HY-P99604
    Cilgavimab

    AZD-1061; COV2-2130

    		 SARS-CoV Infection
    Cilgavimab (AZD-1061; COV2-2130) is a humanized SARS-CoV-2-neutralizing monoclonal antibody, can compose monoclonal-antibody combination AZD7442 with Tixagevimab (HY-P99556). Cilgavimab shows protective action on mouse models of SARS-CoV-2 infection.
  • HY-151420
    Chitin synthase inhibitor 10

    		Fungal Cancer Infection
    Chitin synthase inhibitor 10 is a chitin synthase inhibitor. Chitin synthase inhibitor 10 shows excellent chitin synthase inhibitory activity with an IC50 value of 0.11 mM. Chitin synthase inhibitor 10 also is an antifungal agent and has significantly antifungal activity against drug-resistant fungal variants, such as C. albicans and C. neoformans. Chitin synthase inhibitor 10 can be used for the research of invasive fungal infections (IFIs).
  • HY-151422
    Chitin synthase inhibitor 12

    		Fungal Cancer Infection
    Chitin synthase inhibitor 12 is a chitin synthase inhibitor. Chitin synthase inhibitor 12 shows excellent inhibitory activity with an IC50 value of 0.16 mM. Chitin synthase inhibitor 12 also is a broad-spectrum antifungal agent and has significantly antifungal activity against drug-resistant fungal variants, such as C. albicans and C. neoformans. Chitin synthase inhibitor 12 can be used for the research of invasive fungal infections (IFIs).
  • HY-17506A
    Azithromycin hydrate

    CP-62993 dihydrate

    		 Bacterial Autophagy Antibiotic Parasite Infection Cancer
    Azithromycin hydrate is a macrolide antibiotic useful for the treatment of a number of bacterial infections.
  • HY-17506
    Azithromycin

    CP 62993

    		 Bacterial Autophagy Antibiotic Parasite Infection Cancer
    Azithromycin is a macrolide antibiotic useful for the treatment of a number of bacterial infections.
  • HY-122123
    S-6123

    		Bacterial Antibiotic Infection
    S-6123 is a potent antimicrobial compound of the oxazolidinone series. S-6123 inhibits ribosomal protein synthesis without inhibiting DNA or RNA synthesis.
  • HY-116975
    Enoxastrobin

    Enestroburin

    		 Fungal Infection
    Enoxastrobin (Enestroburin) is an anti-fungal agent. Enoxastrobin is active against P. oryzae and B. cinerea.
  • HY-147346
    RSV-IN-7

    		RSV Infection
    RSV-IN-7 (example 253) is a RSV inhibitor (EC50: < 0.4 μΜ).
  • HY-153225
    PYR01

    		HIV Infection
    PYR01 is a potent HIV-1 nonnucleoside reverse transcriptase inhibitor. PYR01 is an also targeted activator of cell kill molecules eliminate cells expressing HIV-1.
  • HY-10353S
    Raltegravir-d4

    		HIV Integrase HIV Infection
    Raltegravir-d4 is deuterium labeled Raltegravir. Raltegravir is a potent integrase (IN) inhibitor, used to treat HIV infection.
  • HY-U00181
    Fludazonium chloride

    R23633

    		 Fungal Infection
    Fludazonium chloride (R23633) is an anti-fungal agent, which can be used in the treatment and prevention of superficial and systemic fungal infections.
  • HY-A0107
    Tetracycline

    		Bacterial Antibiotic Infection Cancer
    Tetracycline is a broad-spectrum antibiotic with oral activity. Tetracycline exhibits activity against a wide range of bacteria including gram-positive, gram-negative bacteria, chlamydiae, mycoplasmas and rickettsiae. Tetracycline can be used for the research of infections.
  • HY-B0239
    Chloramphenicol

    		Antibiotic Bacterial HIF/HIF Prolyl-Hydroxylase VEGFR Autophagy Apoptosis Beclin1 JNK Akt MMP Cancer Infection
    Chloramphenicol is an orally active, potent and broad-spectrum antibiotic. Chloramphenicol shows antibacterial activity. Chloramphenicol represses the oxygen-labile transcription factor and hypoxia inducible factor-1 alpha (HIF-1α) in hypoxic A549 and H1299 cells. Chloramphenicol suppresses the mRNA levels of vascular endothelial growth factor (VEGF) and glucose transporter 1, eventually decreasing VEGF release. Chloramphenicol can be used for anaerobic infections and lung cancer research.
  • HY-B1790S
    Terconazole-d4

    R42470-d4

    		 Fungal Infection
    Terconazole-d4 is the deuterium labeled Terconazole. Terconazole is a broad-spectrum antifungal medication for the treatment of vaginal yeast infection.
  • HY-B1366
    Meclocycline Sulfosalicylate Salt

    		Bacterial Antibiotic Infection
    Meclocycline Sulfosalicylate Salt is a tetracycline antibiotic with broad-spectrum antibacterial activities, preventing skin bacterial infections such as acne vulgaris.
  • HY-U00131
    Sulfabrom

    N 3517; Sulfabromomethazine

    		 Bacterial Infection
    Sulfabrom (N 3517; Sulfabromomethazine) is a long-acting Sulfonamide that is used for the treatment of coccidiosis and various bacterial infections in the poultry, swine and cattle.
  • HY-17591
    Penicillin G potassium

    Benzylpenicillin potassium

    		 Antibiotic Bacterial Infection
    Penicillin G potassium is a fast-acting antibiotic; used to treat bacterial infections that affect the blood, heart, lungs, joints, and genital areas.
  • HY-128722
    HIV-1 inhibitor-3

    		HIV Infection
    HIV-1 inhibitor-3 is a HIV infection inhibitor extracted from patent US2018360927.
  • HY-N3373
    Loganetin

    		Bacterial Infection
    Loganetin is a non-toxic natural product that may be applied in the antibacterial agent development for treating multidrug-resistant Gram negative infections.
  • HY-B1159
    Nitroxoline

    8-Hydroxy-5-nitroquinoline; 5-Nitro-8-quinolinol

    		 Bacterial Autophagy Antibiotic Infection Cancer
    Nitroxoline is an antibiotic that has proven to be very effective at combating biofilm infections.
  • HY-B0318A
    Metronidazole hydrochloride

    SC 326421

    		 Antibiotic Bacterial Parasite Apoptosis Infection Inflammation/Immunology
    Metronidazole hydrochloride (SC 326421) is an orally active nitroimidazole antibiotic, can be used to research anaerobic infections. Metronidazole hydrochloride can cross blood brain barrier and results inflammation and skeletal muscle contraction under long-term application.
  • HY-125747
    Actinomycin X2

    Actinomycin V

    		 Bacterial Antibiotic Cancer Infection
    Actinomycin X2 (Actinomycin V), produced by many Streptomyces sp., shows strong inhibition of MRSA with a minimum inhibitory concentration (MIC) value of 0.25 μg/mL. Actinomycin X2 can be used for cancer and bacterial infection.
  • HY-12653A
    LDC4297 hydrochloride

    		CDK HIV HSV Infection
    LDC4297 hydrochloride is a selective inhibitor of CDK7 with an IC50 value of 0.13 nM. LDC4297 hydrochloride inhibits human cytomegalovirus (HCMV) replication with an EC50 value of 24.5 nM. LDC4297 hydrochloride shows broad antiviral activities to Herpesviridae, Adenoviridae, Poxviridae, Retroviridae and Orthomyxoviridae with EC50 values of 0.02-1.21 μM. LDC4297 hydrochloride can be used for the research of infection.
  • HY-12653
    LDC4297

    		CDK HIV HSV Infection
    LDC4297 is a selective inhibitor of CDK7 with an IC50 value of 0.13 nM. LDC4297 inhibits human cytomegalovirus (HCMV) replication with an EC50 value of 24.5 nM. LDC4297 shows broad antiviral activities to Herpesviridae, Adenoviridae, Poxviridae, Retroviridae and Orthomyxoviridae with EC50 value of 0.02-1.21 μM. LDC4297 can be used for the research of infection.
  • HY-P1407
    Z-VRPR-FMK TFA

    VRPR

    		 MALT1 Influenza Virus Cancer Infection
    Z-VRPR-FMK (TFA) (VRPR), a tetrapeptide, is a selective and irreversible MALT1 (Mucosa-associated lymphoid tissue lymphoma translocation protein 1) inhibitor. Z-VRPR-FMK (TFA) can protect against influenza A virus (IAV) infection.
  • HY-17427
    Emtricitabine

    BW1592

    		 HIV Reverse Transcriptase Endogenous Metabolite Infection
    Emtricitabine is a nucleoside reverse transcriptase inhibitor (NRTI) with an EC50 of 0.01 μM in PBMC cell. It is an antiviral agent for the treatment of HIV infection.
  • HY-B1148A
    Furaltadone

    Altafur

    		 Bacterial Infection
    Furaltadone, a nitrofuran agent, has the potential for the study in infections of chickens with salmonella enteritidis. Furaltadone is inhibitory and bactericidal in vitro for staphylococci .
  • HY-14957
    Ozenoxacin

    T-3912

    		 Bacterial Antibiotic Infection
    Ozenoxacin is a nonfluorinated quinolone antibacterial, which shows potent activities against the main microorganisms isolated from skin and soft tissue infections.
  • HY-148475
    NF-κB-IN-7

    		NF-κB Cancer Infection Metabolic Disease Inflammation/Immunology Cardiovascular Disease
    NF-κB-IN-7 (compound 1B) is a potent NF-κB inhibitor. NF-κB-IN-7 can be used for the research of cancer, inflammation, autoimmune diseases, diabetes and diabetes complications, infections, cardiovascular disease and defective reperfusion injury.
  • HY-N2925
    β-Amyrone

    β-Amyron

    		 Fungal COX PPAR Infection Metabolic Disease Inflammation/Immunology
    β-Amyrone (β-Amyron) is a triterpene compound which has anti-inflammatory activity through inhibiting the expression of COX-2. β-Amyrone has antifungal activity , as well as antiviral activity against Chikungunya virus. β-Amyrone also inhibits α-glucosidase and acetylcholinesterase (AChE) activity. β-Amyrone can be used in the research of disease like inflammation, infection, and obesity.
  • HY-131337
    RhlR antagonist 1

    		Bacterial Infection
    RhlR antagonist 1 is a potent RhlR antagonist with an IC50 of 26 μM. RhlR antagonist 1 displays selective RhlR antagonism over LasR and PqsR, strong inhibition of biofilm formation in static and dynamic settings, and reduces production of virulence factors such as rhamnolipid and pyocyanin in P. aeruginosa. RhlR antagonist 1 can be utilized for developing QS-modulating molecules in the control of P. aeruginosa infections.
  • HY-19925
    AIC-292

    		HIV Infection
    AIC-292 is a potent and selective inhibitor of HIV-1 nonnucleoside reverse transcriptase. AIC-292 inhibits wild-type HIV-1 laboratory strains at low nanomolar concentrations. AIC-292 displays potent antiviral in vivo efficacy in a mouse xenograft model. AIC-292 has the potential for the research of HIV-1 infection.
  • HY-B0510C
    Trimethoprim lactate

    		Antifolate Bacterial Antibiotic Infection
    Trimethoprim lactate is a bacteriostatic antibiotic and an orally active dihydrofolate reductase inhibitor. Trimethoprim lactate is active against a wide range of Gram-positive and Gram-negative aerobic bacteria. Trimethoprim lactate has the potential for the research of urinary tract infections, Shigellosis and Pneumocystis pneumonia. Trimethoprim lactate can inhibit infection of Influenza A virus in chick embryo when combinated with zinc.
  • HY-152560
    HIV-1 inhibitor-55

    		HIV Infection
    HIV-1 inhibitor-55 (compound 4d) inhibits WT HIV-1 with an EC50 value of 8.6 nM. HIV-1 inhibitor-55 also shows inhibitory potency against single and double HIV-1 mutants. HIV-1 inhibitor-55 can be used for the research of virus infection.
  • HY-B0510A
    Trimethoprim sulfate

    		Antifolate Bacterial Antibiotic Influenza Virus Infection
    Trimethoprim sulfate is a bacteriostatic antibiotic and an orally active dihydrofolate reductase inhibitor. Trimethoprim sulfate is active against a wide range of Gram-positive and Gram-negative aerobic bacteria. Trimethoprim sulfate has the potential for the research of urinary tract infections, Shigellosis and Pneumocystis pneumonia. Trimethoprim sulfate can inhibit infection of Influenza A virus in chick embryo when combinated with zinc.
  • HY-136606
    SARS-CoV MPro-IN-1

    		SARS-CoV Infection
    SARS-CoV MPro-IN-1 is a SARS-CoV-2 3CLpro covalent inhibitor, with an IC50 of 40 nM. SARS-CoV MPro-IN-1 shows good anti-SARS-CoV-2-infection activity in cell culture with an EC50 of 0.33 μM. SARS-CoV MPro-IN-1 has the potential for COVID-19 research.
  • HY-119726
    Fosmanogepix

    APX001; E1211

    		 Fungal Infection
    Fosmanogepix (APX001) is a first-in-class and orally available broad-spectrum antifungal agent, which targets the highly conserved Gwt1 fungal enzyme. Fosmanogepix (APX001) is an N-phosphonooxymethyl prodrug which is rapidly and completely metabolized by systemic alkaline phosphatases to the active moiety, APX001A. Fosmanogepix (APX001) can be used in development for the treatment of invasive fungal infections.
  • HY-N2381
    Menthone

    		Parasite Infection Inflammation/Immunology
    Menthone, a monoterpene extracted from plants and Mentha oil with strong antioxidant properties. Menthone is a main volatile component of the essential oil, and has anti-Inflammatory properties in Schistosoma mansoni Infection.
  • HY-142073
    (+)-Dihydrocalanolide A

    DHCal A; NSC 678323

    		 Reverse Transcriptase HIV Infection
    (+)-Dihydrocalanolide A (DHCal A; NSC 678323) is an orally active nonnucleoside inhibitor of Reverse Transcriptase. (+)-Dihydrocalanolide A can be used to HIV infection research.
  • HY-N7453
    Fengycin

    		Fungal Antibiotic Infection
    Fengycin is a cyclic lipopeptide used as an agricultural fungicide. Fengmycin has an anti-fungal infection effect by damaging the target's cell membrane.
  • HY-119893
    Diamfenetide

    		Parasite Infection
    Diamfenetide is used for the study of Fasciola hepatica infections in vitro. Diamfenetide leads to irreversible paralysis in vitro of immature and adult Fasciola hepatica.
  • HY-B0322
    Sulfamethoxazole

    Ro 4-2130

    		 Bacterial Antibiotic Infection
    Sulfamethoxazole (Ro 4-2130) is a sulfonamide bacteriostatic antibiotic, used for bacterial infections. Sulfonamides is a competitive antagonists of para-aminobenzoic acid (PABA).
  • HY-U00160
    SP187

    MON-​DNJ; UV4

    		 Influenza Virus Infection
    SP187 is a host-targeted iminosugar with activity against filovirus infections in vitro and in vivo. SP187 is active against influenza and dengue in vivo.
  • HY-152539
    HIV-1 inhibitor-54

    		HIV Infection
    HIV-1 inhibitor-54 is a potent HIV-1 inhibitor. HIV-1 inhibitor-54 has anti-HIV activity in MT-4 cells against WT HIV-1 (strain IIIB) with an EC50 value of 0.032 μM. HIV-1 inhibitor-54 can be used for the research of virus infection.
  • HY-P2036A
    FSL-1 TFA

    		Toll-like Receptor (TLR) MMP HSV Antibiotic Infection
    FSL-1 TFA, a bacterial-derived toll-like receptor 2/6 (TLR2/6) agonist, enhances resistance to experimental HSV-2 infection. FSL-1 TFA induces MMP-9 production through TLR2 and NF-κB/AP-1 signaling pathways in monocytic THP-1 cells.
  • HY-B0101B
    Fluconazole mesylate

    UK 49858 mesylate

    		 Fungal Antibiotic Bacterial Infection Cancer
    Fluconazole (mesylate) is a triazole antifungal drug used in the treatment and prevention of superficial and systemic fungal infections.
  • HY-B0101A
    Fluconazole hydrate

    UK 49858 hydrate

    		 Fungal Antibiotic Bacterial Infection Cancer
    Fluconazole (hydrate) is a triazole antifungal drug used in the treatment and prevention of superficial and systemic fungal infections.
  • HY-B1381
    Cefixime

    FR-17027; FK-027; CL-284635

    		 Bacterial Antibiotic Infection Cancer
    Cefixime is an antibiotic and a third generation cephalosporin antibiotic, useful for the treatment of a number of bacterial infections.
  • HY-B0919
    Azaserine

    CI-337; O-Diazoacetyl-L-serine; P-165

    		 Bacterial Antibiotic DNA/RNA Synthesis Cancer Infection
    Azazerine (CI-337) is a competitive inhibitor of glutamine amidotransferase. Azaserine is an antibiotic, it shows antibacterial activities. Azazerine shows anti-tumor activities and it may also act as a tumor inducer. Azazerine can be used for the research of cancer and infection.
  • HY-B0914A
    10-Undecenoic acid zinc salt

    Zinc undecylenate

    		 Fungal Antibiotic Endogenous Metabolite Infection
    10-Undecenoic acid zinc salt is a natural or synthetic fungistatic fatty acid, is used topically in creams against fungal infections, eczemas, ringworm, and other cutaneous conditions.
  • HY-B1924
    Norvancomycin hydrochloride

    Desmethyl-vancomycin hydrochloride

    		 Bacterial Infection
    Norvancomycin hydrochloride is applicable for endocarditis, osteomyelitis, pneumonia, sepsis or soft tissue infections caused by Staphylococcus (including Methicillin-resistant strains and multidrug-resistant microbial strains).
  • HY-A0097
    Teicoplanin

    Antibiotic MDL-507; MDL-507

    		 Bacterial Antibiotic Infection
    Teicoplanin is a glycopeptide antibiotic used in the prophylaxis and treatment of serious infections caused by Gram-positive bacteria, including Methicillin-resistant Staphylococcus aureus and Enterococcus faecalis.
  • HY-100096
    Emtricitabine S-oxide

    Emtricitabine sulfoxide; Emtricitabine Degradant-III

    		 HIV Reverse Transcriptase Infection
    Emtricitabine S-oxide (Emtricitabine sulfoxide) is a major degradation product of Emtricitabine. Emtricitabine is a potent nucleoside reverse transcriptase inhibitor used for the treatment of HIV infection.
  • HY-P2123A
    Colistin A sulfate hydrate

    		Bacterial Antibiotic Infection
    Colistin A sulfate hydrate is a major component of Colistin. Colistin is a polymyxin antibiotic and can be used to combat infections caused by problematic gram-negative bacteria.
  • HY-N7123S1
    Sulfacetamide-13C6

    Sulphacetamide-13C6

    		 Bacterial Antibiotic Infection
    Sulfacetamide- 13C6 is the 13C6 labeled Sulfacetamide. Sulfacetamide (Sulphacetamide), a bacteriostatic sulphonamide, is a popular antibiotic prescribed for treating ocular infections.
  • HY-A0256
    Clavulanic acid

    		Antibiotic Bacterial Infection Inflammation/Immunology
    Clavulanic acid is a naturally occurring powerful bacterial β-lactamases inhibitor for research of infections caused by bacteria, including infections of the ears. Clavulanic acid is active against a wide spectrum of gram-positive and gram-negative bacterias.
  • HY-B0439S1
    Sulfadoxine D3

    Sulphadoxine d3

    		 Parasite Antibiotic Infection
    Sulfadoxine-d3 is a deuterium labeled Sulfadoxine (HY-B0439). Sulfadoxine is a sulfonamide that is used, usually in combination with Pyrimethamine (HY-18062), for multidrug-resistant Plasmodium falciparum and P. vivax inhibition. Unlike PYR, Sulfadoxine has no impact on HIV replication or MT-2 cell cycle progression. But also Sulfadoxine exhibits suppression on respiratory, and urinary tract infections[1][2][3][4].
  • HY-15256
    Faldaprevir

    BI 201335

    		 HCV Protease Infection
    Faldaprevir (BI 201335) is a potent, orally active and selective noncovalent inhibitor of NS3/4A protease of HCV (hepatitis C virus) genotypes 1a and 1b, with Ki values of 2.6 and 2.0 nM, respectively. Faldaprevir inhibits HCV RNA replication, with EC50 values of 6.5 and 3.1 nM, respectively. Faldaprevir has potent antiviral activity against chronic HCV infection.
  • HY-A0241
    Dalfopristin

    RP54476

    		 Bacterial Antibiotic Infection
    Dalfopristin is a semi-synthetic streptogramin antibiotic. Quinupristin/Dalfopristin (Q/D) is a valuable alternative antibiotic to vancomycin for the treatment of multi-agent resistant Enterococcus faecium infections.
  • HY-B1190S
    Cefadroxil-d4 hydrate

    BL-S 578-d4 (hydrate)

    		 Bacterial Antibiotic Infection
    Cefadroxil-d4 (hydrate) is the deuterium labeled Cefadroxil. Cefadroxil is a broad-spectrum antibiotic of the cephalosporin type, effective in Gram-positive and Gram-negative bacterial infections.
  • HY-20685S
    Palmitoylethanolamide-d4

    Palmidrol-d4; Loramine P 256-d4

    		 Influenza Virus Endogenous Metabolite Infection
    Palmitoylethanolamide-d4 is the deuterium labeled Palmitoylethanolamide. Palmitoylethanolamide (Palmidrol) is an active endogenous compound which can used for preventing virus infection of the respiratory tract.
  • HY-A0062
    Telithromycin

    HMR3647; RU66647

    		 Bacterial Antibiotic Infection Inflammation/Immunology
    Telithromycin (HMR3647) is a novel ketolide antibiotic that structurally resembles macrolides. Telithromycin belongs to the ketolide family that is characterized by a keto group at position 3 of the macrolide ring and is active against bacteria causing community-acquired pneumonia, acute exacerbation of chronic bronchitis, and acute sinusitis. Telithromycin also has similar immunomodulatory effects as macrolides. Telithromycin can be used for the research of respiratory infections including bronchial asthma.
  • HY-B0974
    Methicillin sodium salt

    Meticillin sodium

    		 Bacterial Antibiotic Infection
    Methicillin sodium salt (Meticillin sodium) is a β-lactam, semi-synthetic antibiotic related to penicillin antibiotic. Methicillin sodium salt inhibits penicillin-binding proteins involved in the synthesis of peptidoglycan. Methicillin sodium salt inhibits S. aureus with a MIC value of 2.1 μg/mL. Methicillin sodium salt can be used for the research of inflammation.
  • HY-B1050
    Gemifloxacin mesylate

    SB-265805S; LB-20304a

    		 Bacterial Antibiotic DNA/RNA Synthesis Topoisomerase Infection
    Gemifloxacin mesylate (SB-265805S; LB-20304a) is an orally active broad-spectrum quinolone antibacterial antibiotic. Gemifloxacin mesylate inhibits DNA synthesis by inhibiting DNA gyrase and Topoisomerase IV activities. Gemifloxacin mesylate has potent antibacterial activities against gram-positive bacteria in vitro efficacy study, particularly Streptococci and Staphylococci. Gemifloxacin mesylate has been used in the research of respiratory tract infections.
  • HY-B2033S
    Pyrimethanil-13C,15N2

    		Fungal Infection
    Pyrimethanil- 13C, 15N2 is the 13C-labeled and 15N-labeled Pyrimethanil. Pyrimethanil is an anilinopyrimidine and broad-spectrum contact fungicide for the control of Botrytis spp. on a wide variety of crops[1]. Pyrimethanil inhibits the biosynthesis of methionine and other amino acids in Botrytis cinerea. Pyrimethanil can be used for the research of fungal diseases prevention on fruit, vegetable and ornamental plants with mold infection[3].
  • HY-N6798
    Myriocin

    Thermozymocidin; ISP-I

    		 HCV Antibiotic Infection
    Myriocin (Thermozymocidin), a fungal metabolite could be isolated from Myriococcum albomyces, Isaria sinclairi and Mycelia sterilia, is a potent inhibitor of serine-palmitoyl-transferase (SPT) and a key enzyme in de novo synthesis of sphingolipids. Myriocin suppresses replication of both the subgenomic HCV-1b replicon and the JFH-1 strain of genotype 2a infectious HCV, with an IC50 of 3.5 µg/mL for inhibiting HCV infection.
  • HY-17624
    Framycetin

    Neomycin B; Fradiomycin B

    		 Bacterial Antibiotic Infection
    Framycetin (Neomycin B), an aminoglycoside antibiotic, is a potent RNase P cleavage activity inhibitor with a Ki of 35 μM. Framycetin competes for specific divalent metal ion binding sites in RNase P RNA. Framycetin inhibits hammerhead ribozyme with a Ki of 13.5 μM. Framycetin, a 5″-azido neomycin B precursor, binds the Drosha site in miR-525 and is used for hepatic encephalopathy and enteropathogenic E. coli infections.
  • HY-W049875
    Nitroxynil

    		Parasite Infection
    Nitroxynil, anthelmintic agent, is active against parasites in both adult and immature stages. Nitroxynil is widely used for the research of infection of Fasciola hepatica.
  • HY-151102
    Fabimycin

    		Antibiotic Bacterial Infection
    Fabimycin is a FabI inhibitor with potent antibacterial activity against gram-negative bacteria. Fabimycin is effective against drug-resistant gram-negative Infections in vivo.
  • HY-N10194
    P-orlandin

    		Parasite Endogenous Metabolite Infection
    P-orlandin, a fungal metabolite, prevents FREP1 from binding to gametocytes or ookinetes. P-orlandin effectively inhibits P. falciparum infection in mosquitoes.
  • HY-B0299
    Oxibendazole

    		Parasite Apoptosis Infection
    Oxibendazole is an effective benzimidazole anthelmintic and is against nema-tode infections. Oxibendazole can induces apoptosis and has anti-cancer and anti-inflammation activities.
  • HY-N6680
    Virginiamycin S1

    		Bacterial Antibiotic Infection
    Virginiamycin S1 is a cyclic hexadepsipeptide antibiotic, inhibits bacterial protein synthesis at the level of aminoacyl-tRNA binding and peptide bond formation. Virginiamycin S1 belongs to the type B compounds in the streptogramin family and is produced by Streptomyces virginiae, shows a strong bactericidal activity against a wide range of Gram-positive bacteria. Virginiamycin S1 together with virginiamycin M1 is more effective in treat multidrug-resistant bacterial infections[1][2].
  • HY-139602
    (+)-JNJ-A07

    		Virus Protease Infection
    (+)-JNJ-A07 is a highly potent, orally active pan-serotype dengue virus inhibitor targeting the NS3-NS4B interaction. (+)-JNJ-A07 exerts nanomolar to picomolar activity against a panel of 21 clinical isolates. (+)-JNJ-A07 has a favourable pharmacokinetic profile that results in outstanding efficacy against dengue virus infection in mouse infection models.
  • HY-17624A
    Framycetin sulfate

    Neomycin B sulfate; Fradiomycin B sulfate

    		 Antibiotic Bacterial Infection
    Framycetin sulfate (Neomycin B sulfate), an aminoglycoside antibiotic, is a potent RNase P cleavage activity inhibitor with a Ki of 35 μM. Framycetin sulfate competes for specific divalent metal ion binding sites in RNase P RNA. Framycetin sulfate inhibits hammerhead ribozyme with a Ki of 13.5 μM. Framycetin sulfate, a 5″-azido neomycin B precursor, binds the Drosha site in miR-525 and is used for hepatic encephalopathy and enteropathogenic E. coli infections.
  • HY-112258
    IMP-1088

    		DNA/RNA Synthesis Infection
    IMP-1088 is a potent human N-myristoyltransferases NMT1 and NMT2 dual inhibitor with IC50s of <1 nM for HsNMT1 and HsNMT2. IMP-1088 has a Kd of <210 pM for HsNMT1. IMP-1088 efficiently blocks rhinovirus replication by blocking rhinovirus virus-encoded protein (VP0) N-myristoylation. IMP-1088 protects host cells from the cytotoxic effects of viral infection.
  • HY-P99584
    Suvizumab

    KD-247

    		 HIV Infection
    Suvizumab (KD-247) is an neutralizing antibody anti-HIV-1. Suvizumab effectively neutralizes HIV-1MN, HIV-1SF2 and HIV-189.6 with IC50 values of 0.1 µg/mL, 1.0 µg/mL and 0.2 µg/mL, respectively. Suvizumab reduces the viral load of HIV. Suvizumab has good tolerance and can be used to prevent HIV infection.
  • HY-139056
    SU0268

    		Others Cancer Infection Inflammation/Immunology
    SU0268 is a potent and specific inhibitor of 8-Oxoguanine DNA glycosylase 1 (OGG1). SU0268 regulates inflammatory responses during Pseudomonas aeruginosa infection.
  • HY-W035409
    RPW-24

    		Bacterial Infection
    RPW-24 protects C. elegans from bacterial infection by stimulating the host immune response of the nematode. RPW-24 has antibacterial activity.
  • HY-W040128
    Kanamycins sulfate

    		Antibiotic Bacterial Infection
    Kanamycins sulfate is a broad-spectrum antibiotic, can be used in certain severe staphylococcal or Gram-negative bacillary infections. Kanamycin sulfate has certain ototoxicity.
  • HY-B0593A
    Ceftazidime pentahydrate

    GR20263 pentahydrate

    		 Bacterial Antibiotic Infection Cancer
    Ceftazidime (GR20263) pentahydrate , an antibiotic, has a broad spectrum activity against Gram-positive and Gram-negative aerobic bacteria. Ceftazidime pentahydrate is also active against Enterobacteriaceae (including β-lactamase-positive strains) and is resistant to hydrolysis by most β-lactamases.
  • HY-144252
    Antibacterial agent 69

    		ROS Kinase Infection
    Antimicrobial agent 69 is a novel structural antimicrobial regulator and has been used to fight deadly multidrug-resistant bacterial infections, and its < b > MICs < / b > value is 2.978 μM。
  • HY-B0439
    Sulfadoxine

    Sulphadoxine

    		 Parasite HIV Antibiotic Endogenous Metabolite Infection
    Sulfadoxine(Sulphadoxine) is a long acting sulfonamide that is used, usually in combination with other agents, for respiratory, urinary tract and malarial infections. Sulfadoxine inhibits HIV replication in peripheral blood mononuclear cells.
  • HY-146417
    Antiviral agent 19

    		Influenza Virus Infection
    Antiviral agent 19 (Compound 3) is a selective inhibitor against Zika virus infection with an EC50 of 1.3 µM. Antiviral agent 19 has low cytotoxicity.
  • HY-90001
    Ritonavir

    ABT 538; RTV

    		 HIV Protease HIV SARS-CoV Apoptosis Infection
    Ritonavir (ABT 538) is an inhibitor of HIV protease used to treat HIV infection and AIDS. Ritonavir is also a SARS-CoV 3CL pro inhibitor with an IC50 of 1.61 μM.
  • HY-B1637
    Ditiocarb sodium

    Sodium diethyldithiocarbamate

    		 HIV Infection
    Ditiocarb sodium (Sodium diethyldithiocarbamate) is an accelerator of the rate of copper cementation. Sodium diethyldithiocarbamate reduces the incidence of HIV infection, and also enhances adjuvant immunoresearch of high risk breast cancer.
  • HY-P2076
    Dusquetide

    SGX942

    		 Bacterial Cancer Infection
    Dusquetide (SGX942) is a first-in-class innate defense regulator (IDR). Dusquetide modulates the innate immune response to both PAMPs and DAMPs by binding to p62. Dusquetide shows activity in both reducing inflammation and increasing clearance of bacterial infection. DAMPs: damage-associated molecular patterns; PAMPs: pathogen-associated molecular patterns
  • HY-123024
    Cefatrizine

    BL-S-640; SK&F 60771

    		 Apoptosis Bacterial Antibiotic Cancer Infection
    Cefatrizine (BL-S-640) is an orally active and broad-spectrum cephalosporin antibiotic. Cefatrizine is also a eEF2K inhibitor, with anti-proliferative activity in human breast cancer cells, which could induce ER stress, leading to cell death. Cefatrizine can be used in studies of cancer and bacterial infection.
  • HY-150699
    TXA6101

    		Bacterial Infection
    TXA6101 is a bacterial protein FtsZ (filamentous temperature-sensitive protein Z) inhibitor that inhibits bacterial division. TXA6101 has antimicrobial activity against MRSA isolates expressing either the G193D or G196S mutant FtsZ with the MIC value of 1 μg/mL, retains significant activity against the TXA707-resistant FtsZ mutant. TXA6101 can be used as a potential method against Gram-negative bacterial infections.
  • HY-B1906
    Streptomycin

    Agrept; Agrimycin; Streptomycin A

    		 Antibiotic Bacterial Infection Neurological Disease
    Streptomycin (Agrept) is an effective antibiotic against M. tuberculosis, is used for the research of tuberculosis (TB). Streptomycin also is a bacteriocidal agent that can be used for the research of a number of bacterial infections. Streptomycin can bind strongly to nucleic acids, interferes and blocks protein synthesis while permitting continued RNA and DNA synthesis. Streptomycin, as a common antibiotic used in culture media, also is a blocker of stretch-activated and mechanosensitive ion channels in neurons and cardiac myocytes .
  • HY-17035
    Doramectin

    		Parasite Antibiotic Bacterial Infection
    Doramectin is a derivative of Ivermectin (HY-15310). Doramectin is a potent antiparasitic antibiotic. Doramectin is an active compound against S.mansoni in an NMRI mouse infection model.
  • HY-18062S
    Pyrimethamine-d3

    		Antifolate Parasite Infection
    Pyrimethamine-d3 is the deuterium labeled Pyrimethamine. Pyrimethamine is a medication used for protozoal infections; interferes with tetrahydrofolic acid synthesis from folic acid by inhibiting the enzyme dihydrofolate reductase (DHFR)[1][2].
  • HY-146418
    Antiviral agent 20

    		Influenza Virus Infection
    Antiviral agent 20 (Compound 17b) is a selective inhibitor against Zika virus infection with an EC50 of 4.5 µM. Antiviral agent 20 has low cytotoxicity.
  • HY-129060
    Flutrimazole

    		Fungal Infection
    Flutrimazole is an imidazole antifungal with dual anti-inflammatory and antifungal activity. Flutrimazole shows scarce transdermal penetration. Flutrimazole has the advantageous in the research of topical fungal infections with an inflammatory component.
  • HY-12888
    AZD5099

    		Topoisomerase Bacterial Infection
    AZD5099, an antibacterial agent, is a potent and selective bacterial topoisomerase II inhibitor. AZD5099 potently inhibits the infections caused by Gram-positive and fastidious Gram-negative bacteria.
  • HY-150217
    CpG ODN 10101

    ODN 10101

    		 Toll-like Receptor (TLR) HCV Infection Inflammation/Immunology
    CpG ODN 10101, a synthetic oligodeoxynucleotide (ODN),  is a toll-like receptor 9 (TLR9) agonist. CpG ODN 10101 is a potent inducer of cytokine/chemokine expression ex vivo when used in combination with HH2(VQLRIRVAVIRA-NH2). CpG ODN 10101 induces IFN- secretion from dendritic cells (DCs) and stimulates B-cells.CpG ODN 10101 has antiviral and immunomodulatory properties that can influence chronic infection with HCV.
  • HY-P2076A
    Dusquetide TFA

    SGX942 TFA

    		 Bacterial Cancer Infection
    Dusquetide (SGX942) TFA is a first-in-class innate defense regulator (IDR). Dusquetide TFA modulates the innate immune response to both PAMPs and DAMPs by binding to p62. Dusquetide TFA shows activity in both reducing inflammation and increasing clearance of bacterial infection. DAMPs: damage-associated molecular patterns; PAMPs: pathogen-associated molecular patterns
  • HY-121268
    Demeclocycline

    		Antibiotic Bacterial Cancer Infection Inflammation/Immunology
    Demeclocycline is an orally active tetracycline antibiotic. Demeclocycline impairs protein synthesis by binding to the 30S ribosomal subunit to inhibit binding of aminoacyl tRNA. Demeclocycline shows anti-bacterial activitise to a wide variety of bacterial infections.
  • HY-A0281
    4-Phenylbutyric acid

    4-PBA; Benzenebutyric acid

    		 HDAC Virus Protease Cancer Infection
    4-Phenylbutyric acid (4-PBA) is an inhibitor of HDAC and endoplasmic reticulum (ER) stress, used in cancer and infection research.
  • HY-U00007A
    Stilbamidine dihydrochloride

    Ba 2652 dihydrochloride; Stilbamidin dihydrochloride

    		 Fungal Cancer Infection
    Stilbamidine dihydrochloride is a diamidine compound derived from Stilbene and used chiefly in the form of its crystalline isethionate salt in treating various fungal infections.
  • HY-U00007
    Stilbamidine

    Ba 2652; Stilbamidin

    		 Fungal Cancer Infection
    Stilbamidine is a diamidine compound derived from Stilbene and used chiefly in the form of its crystalline isethionate salt in treating various fungal infections.
  • HY-B1636
    Dithiazanine iodide

    		Parasite Infection
    Dithiazanine iodide is an effective broad-spectrum anthelmintic. Dithiazanine iodide can be used for the research of trichuriasis, strongyloidiasis, enterobiasis, ascariasis, and hookworm infection. Dithiazanine iodide is also a cyanine dye.
  • HY-B0147A
    Pefloxacin mesylate

    Pefloxacinium mesylate

    		 Bacterial Antibiotic Infection
    Pefloxacin mesylate is a an antibacterial agent and prevents bacterial DNA replication by inhibiting DNA gyrase (topoisomerse) Target: DNA gyrase Pefloxacin is a synthetic chemotherapeutic agent used to treat severe and life-threatening bacterial infections.
  • HY-B0957
    Erythromycin Ethylsuccinate

    Erythromycin ethyl succinate; EES

    		 Bacterial HIV Autophagy Antibiotic Infection
    Erythromycin Ethylsuccinate is an antibiotic useful for the treatment of a number of bacterial infections, has an antimicrobial spectrum similar to or slightly wider than that of penicillin. Erythromycin Ethylsuccinate has antiviral activity against HIV-1.
  • HY-B0147
    Pefloxacin

    Pefloxacinium

    		 Bacterial Antibiotic Infection
    Pefloxacin is a an antibacterial agent and prevents bacterial DNA replication by inhibiting DNA gyrase (topoisomerse) Target: DNA gyrase Pefloxacin is a synthetic chemotherapeutic agent used to treat severe and life-threatening bacterial infections.
  • HY-B1267S1
    Sulfaguanidine-13C6

    		Isotope-Labeled Compounds Bacterial Antibiotic Infection
    Sulfaguanidine- 13C6 is the 13C6 labeled Sulfaguanidine. Sulfaguanidine is an orally active antimicrobial agent/antibiotic of sulfonamide class. Sulfaguanidine can be used for the research of enteric infections such as bacillary dysentery.
  • HY-136466
    A2ti-2

    		Virus Protease HPV Infection
    A2ti-2 is a selective and low-affinity annexin A2/S100A10 heterotetramer (A2t) inhibitor with an IC50 of 230 μM. A2ti-2 specifically disrupts the protein-protein interaction (PPI) between A2 and S100A10. A2ti-2 prevents human papillomavirus type 16 (HPV16) infection.
  • HY-136465
    A2ti-1

    		Virus Protease HPV Infection
    A2ti-1 is a selective and high-affinity annexin A2/S100A10 heterotetramer (A2t) inhibitor with an IC50 of 24 μM. A2ti-1 specifically disrupts the protein-protein interaction (PPI) between A2 and S100A10. A2ti-1 prevents human papillomavirus type 16 (HPV16) infection.
  • HY-W013266S
    N4-Acetylsulfamethoxazole-d4

    Acetylsulfamethoxazole-d4

    		 Bacterial Infection Metabolic Disease
    N4-Acetylsulfamethoxazole-d4 is the deuterium labeled N4-Acetylsulfamethoxazole. N4-Acetylsulfamethoxazole (Acetylsulfamethoxazole) is a metabolite of Sulfamethoxazole (HY-B0322). Sulfamethoxazole is a sulfonamide bacteriostatic antibiotic, used for bacterial infections[1].
  • HY-153335
    Enpp-1-IN-16

    		Phosphodiesterase (PDE) Cancer Infection Metabolic Disease Inflammation/Immunology Cardiovascular Disease
    Enpp-1-IN-16 (compound 54) is an ENPP1 inhibitor. Enpp-1-IN-16 has the potential to study cancer, especially in cases of high ENPP1 expression or elevated cytoplasmic DNA levels. Enpp-1-IN-16 can also be used in other diseases mediated by ENPP1, such as bacterial or viral infections, insulin resistance and type II diabetes, chondrocalcinosis and osteoarthritis, calcium pyrophosphate deposition disorder (CPPD), low Phosphatase disease and soft tissue calcification disorders.
  • HY-145592
    Ruzotolimod

    		Toll-like Receptor (TLR) Infection
    Ruzotolimod is the agonist of TLR7. Ruzotolimod has the potential for the research of HBV, COVID-19 or SARS-CoV-2 infection (extracted from patent WO2021130195A1).
  • HY-B1004
    Dinitolmide

    Zoalene

    		 Parasite Infection
    Dinitolmide (Zoalene), a fodder additive for poultry, has anti-coccidial effect. Dinitolmide can be used to prevent infections induced by Eimeria, such as Eimeria tenella, Eimeria necatrix, Eimeria brunette, and so on.
  • HY-B0147B
    Pefloxacin mesylate dihydrate

    Pefloxacinium mesylate dihydrate

    		 Bacterial Antibiotic Infection
    Pefloxacin mesylate dehydrate is a an antibacterial agent and prevents bacterial DNA replication by inhibiting DNA gyrase (topoisomerse) Target: DNA gyrase Pefloxacin is a synthetic chemotherapeutic agent used to treat severe and life-threatening bacterial infections.
  • HY-B1267S
    Sulfaguanidine-d4

    		Isotope-Labeled Compounds Bacterial Antibiotic Infection
    Sulfaguanidine-d4 is the deuterium labeled Sulfaguanidine. Sulfaguanidine, belongs to the class of sulfonamide agent, is an orally active antibiotic. Sulfaguanidine can be used for the research of enteric infections such as bacillary dysentery[1][2].
  • HY-139798
    Iboxamycin

    		Bacterial Infection
    Iboxamycin is a potent antibiotic candidate bearing a fused bicyclic amino acid residue. Iboxamycin is orally bioavailable, safe and effective in researching both Gram-positive and Gram-negative bacterial infections in mice.
  • HY-108387
    Morantel citrate

    		Parasite Infection
    Morantel citrate is a veterinary anthelmintic agent that inhibits parasitic infections in cattle, sheep and goats. Morantel citrate paralyzes the nervous system of the parasite, helping the animal expel the dead parasite from the body.
  • HY-132598
    Miravirsen

    SPC-3649

    		 MicroRNA HCV Infection Inflammation/Immunology
    Miravirsen (SPC-3649) is a potent miR-122 inhibitor and inhibits the biogenesis of miR-122. Miravirsen is a 15-nucleotide locked nucleic acid-modified phosphorothioate antisense oligonucleotide. Miravirsen inhibits HCV replication. Miravirsen can be used in research of HCV infection.
  • HY-16764
    Avarofloxacin

    JNJ-Q2

    		 Bacterial Antibiotic Infection Inflammation/Immunology
    Avarofloxacin (JNJ-Q2) is a broad-spectrum fluoroquinolone antibacterial agent being developed for the treatment of acute bacterial skin and skin-structure infections and community-acquired pneumonia. Avarofloxacin (JNJ-Q2) is an aminoethylidenylpiperidine fluoroquinolone that demonstrates antibacterial effect against numerous Gram-positive bacteria with a mean 0.12 mg/L MIC90 value. Avarofloxacin (JNJ-Q2) has potential for treatment of methicillin-resistant Staphylococcus aureus (MRSA) infections.
  • HY-W012531
    2-Hydroxycinnamic acid

    		HIV SARS-CoV Endogenous Metabolite Infection
    2-Hydroxycinnamic acid is isolated from the methanol extract of Cinnamomum cassia. 2-Hydroxycinnamic acid shows inhibitory effects on infection of HIV/SARS-CoV S pseudovirus with an IC50 of 0.3 mM
  • HY-N3270
    Methyl orsellinate

    		Fungal Lipoxygenase Infection
    Methyl orsellinate is a phytotoxic compound with antifungal activities. Methyl orsellinate is a 5-lipoxygenase inhibitor with an IC50 value of 59.6 μM. Methyl orsellinate can be used for fungal infection research.
  • HY-107902
    RIG-1 modulator 1

    		HBV HCV HIV Influenza Virus Infection
    RIG-1 modulator 1 is an anti-viral compound which can be useful for the treatment of viral infections including influenza virus, HBV, HCV and HIV extracted from patent WO 2015172099 A1.
  • HY-N0172S
    Caffeic acid-13C3

    3,4-Dihydroxycinnamic acid-13C3

    		 Bacterial Fungal Infection
    Caffeic acid- 13C3 is an 13C labeled caffeic acid. Caffeic acid is a phytonutrient belonging to the flavonoids. Caffeic acid and its derivatives, are potential antimicrobial agents, chronic infection induced by microbes such as bacteria, fungi, and viruses[1].
  • HY-136303
    GS-704277

    		Drug Metabolite Infection
    GS-704277 is an alanine metabolite of Remdesivir. Remdesivir, a nucleoside analogue with effective antiviral activity, is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro.
  • HY-13231
    CDK9-IN-1

    		CDK HIV Infection
    CDK9-IN-1 is a novel, selective CDK9 inhibitor for the treatment of HIV infection, with an IC50 of 39 nM for CDK9/CycT1, extracted from reference, compound 87.
  • HY-W008833
    3-Aminobutanoic acid

    		Bacterial Infection
    3-Aminobutanoic acid is a β-amino acid. 3-Aminobutanoic acid can protect plant against a challenge infection with P. infestans. 3-Aminobutanoic acid has various levels of susceptibility for the pathogen.
  • HY-108009
    Rezafungin

    Biafungin; CD101; SP-3025

    		 Fungal Infection
    Rezafungin (Biafungin) is a next-generation, broad-spectrum, and long-lasting echinocandin. Rezafungin shows potent antifungal activity against Candida spp., Aspergillus spp., and Pneumocystis spp..
  • HY-108009A
    Rezafungin acetate

    Biafungin acetate; CD101 acetate; SP-3025 acetate

    		 Fungal Infection
    Rezafungin acetate (Biafungin acetate) is a next-generation, broad-spectrum, and long-lasting echinocandin. Rezafungin acetate shows potent antifungal activity against Candida spp., Aspergillus spp., and Pneumocystis spp..
  • HY-121570
    Noxytiolin

    Noxythiolin

    		 Others Infection
    Noxytiolin (Noxythiolin) is an anti-infective agent and used for irrigation of the peritoneum.
  • HY-145055
    HBV-IN-11

    		HBV Infection
    HBV-IN-11 is a potent HBsAg secretion inhibitor with an EC50 of 0.46 µM (From patent WO2018085619A1, example 28).
  • HY-138094
    N-(2-Hydroxyethyl)oxamic acid

    		Drug Metabolite Infection
    N-(2-hydroxyethyl)-oxamic acid is formed when Metronidazole is reduced either chemically or by the action of the intestinal bacteria. Metronidazole, a nitroimidazole antibiotic, has activity against various protozoans and most Gram-negative and Gram-positive anaerobic bacteria.
  • HY-111532
    (3R,4R)-A2-32-01

    		Bacterial Infection
    (3R,4R)-A2-32-01 (compound 24(R,R)), the (R,R)-enantiomer of A2-32-01, is a Staphylococcus aureus caseinolytic protease (SaClpP) inhibitor.
  • HY-138061
    DENV-IN-2

    		DNA/RNA Synthesis Infection
    DENV-IN-2 is a potent dengue viral replication inhibitor extracted from patent WO2018215315A1, compound 6AB, has an EC50 of 0.016 nM. DENV-IN-2 shows high potent activity against all four serotypes of the Dengue virus with EC50s ranging from 0.013 to 0.029 nM.
  • HY-P1783A
    M2e, human TFA

    		Influenza Virus Infection
    M2e, human TFA, consisting of the 23 extracellular residues of M2 (the third integral membrane protein of influenza A), has been remarkably conserved in all human influenza A. M2e, human TFA is a valid and versatile vaccine candidate to protect against any strain of human influenza A.
  • HY-P1783
    M2e, human

    		Influenza Virus Infection
    M2e, human, consisting of the 23 extracellular residues of M2 (the third integral membrane protein of influenza A), has been remarkably conserved in all human influenza A, which is a valid and versatile vaccine candidate to protect against any strain of human influenza A.
  • HY-124498
    Oxantel

    CP-14445

    		 nAChR Parasite Infection
    Oxantel (CP-14445), a m-oxyphenol derivative of Pyrantel (HY-12641), is a N-subtype AChR agonist. Oxantel is an anthelmintic, with excellent trichuricidal properties.
  • HY-B0455S
    Lomefloxacin-d5 hydrochloride

    		Isotope-Labeled Compounds Inflammation/Immunology
    Lomefloxacin-d5 (hydrochloride) is the deuterium labeled Lomefloxacin hydrochloride. Lomefloxacin (SC47111A) hydrochloride is a broad-spectrum quinolone antibiotic, with antimicrobial activity. Lomefloxacin hydrochloride is used for the research of respiratory tract infections, genitourinary infections, gastrointestinal infections, ENT infections, etc.[1][2].
  • HY-N6711
    Equisetin

    		HIV Integrase Infection
    Equisetin is an N-methylserine-derived acyl tetramic acid isolated from a terrestrial fungus Fusarium equiseti NRRL 5537. Equisetin is a tetramate-containing natural product with antibiotic and cytotoxic activity. Equisetin inhibits the growth of Gram-positive bacteria and HIV-1 integrase activity but shows no activity against Gram-negative bacteria. Equisetin is a Quorum-sensing inhibitor (QSI) that attenuates QS-regulated virulence phenotypes in P. aeruginosa without affecting the growth of bacterias, serves as a leading compound for the treatment of P. aeruginosa infections.
  • HY-136205
    IA-Alkyne

    Iodoacetamide-alkyne; N-Hex-5-ynyl-2-iodo-acetamide

    		 TRP Channel Infection Inflammation/Immunology
    IA-Alkyne (Iodoacetamide-alkyne; N-Hex-5-ynyl-2-iodo-acetamide) is a TRP channel (TRPC) agonist and has the potential for the study of respiratory infection. IA-Alkyne can be used to develop an isotopically tagged probe for quantitative cysteine-reactivity profiling.
  • HY-17591S
    Penicillin G-d5 potassium

    Benzylpenicillin-d5 (potassium)

    		 Bacterial Antibiotic Infection
    Penicillin G-d5 (potassium) is the deuterium labeled Penicillin G potassium. Penicillin G potassium is a fast-acting antibiotic; used to treat bacterial infections that affect the blood, heart, lungs, joints, and genital areas[1][2].
  • HY-130581
    Lipid X

    		Bacterial Antibiotic Infection
    Lipid X is a novel monosaccharide precursor of Lipid A (the active moiety of gram-negative endotoxin). Lipid X is protective against endotoxin administered to mice and sheep and against life-threatening gram-negative infections in mice.
  • HY-W002198
    2-Hydroxyacetophenone

    Phenacyl alcohol

    		 HIV SARS-CoV Infection
    2-Hydroxyacetophenone is a principal root volatile of the Carissa edulis. 2-Hydroxyacetophenone shows inhibitory effects on infection of HIV/SARS-CoV S pseudovirus with an IC50 of 1.8 mM.
  • HY-N3515
    Multicaulisin

    		Bacterial Infection
    Multicaulisin, a new Diels-Alder type adduct from Morus multicaulis roots, potently effects against Staphylococcus aureus (MRSA) isolates. Multicaulisin is an antibacterial agent and has the potential for MRSA infections research.
  • HY-120097
    R-10015

    		LIM Kinase (LIMK) Reverse Transcriptase Infection
    R-10015, a broad-spectrum antiviral compound for HIV infection, acts as a potent and selective inhibitor of LIM domain kinase (LIMK) and binds to the ATP-binding pocket, with an IC50 of 38 nM for human LIMK1.
  • HY-B0293A
    Butoconazole

    		Fungal Infection
    Butoconazole, an imidazole antifungal agent, is active against Candida spp. and effective against vaginal infections due to Candida albicans. Butoconazole is presumed to function as other imidazole derivatives via inhibition of steroid synthesis.
  • HY-17413S
    Zidovudine-d3

    Azidothymidine-d3; AZT-d3; ZDV-d3

    		 Isotope-Labeled Compounds HIV CRISPR/Cas9 Infection
    Zidovudine-d3 is the deuterium labeled Zidovudine. Zidovudine is a nucleoside reverse transcriptase inhibitor (NRTI), widely used to treat HIV infection. Zidovudine increases CRISPR/Cas9-mediated editing frequency.
  • HY-106541
    Neticonazole

    		Fungal Cancer Infection
    Neticonazole is an imidazole derivative and a potent and long-acting antifungal agent. Neticonazole has anti-infection and anti-cancer effects.
  • HY-14603
    Clioquinol

    Iodochlorohydroxyquinoline

    		 Fungal Autophagy Mitophagy Antibiotic Parasite Infection Cancer
    Clioquinol (Iodochlorhydroxyquin) is a topical antifungal agent with anticancer activity. Clioquinol acts as an oral antimicrobial agent for the research of diarrhea and skin infections. Antibiotic.
  • HY-128365
    Neticonazole hydrochloride

    		Fungal Cancer Infection
    Neticonazole hydrochloride is an imidazole derivative and a potent and long-acting antifungal agent. Neticonazole hydrochloride has anti-infection and anti-cancer effects.
  • HY-108402
    Cefodizime

    		Bacterial Antibiotic Infection
    Cefodizime is a third generation cephalosporin antibiotic with a broad spectrum of antibacterial activity. Cefodizime has no renal toxic effect, good tolerance and immune regulation activity, and has the potential for severe infections of the respiratory and urinary tracts.
  • HY-149058
    Neuraminidase-IN-13

    		Influenza Virus Infection
    Neuraminidase-IN-13 (Compound 10) is a neuraminidase inhibitor with antiviral activity and low cytotoxicity. Neuraminidase-IN-13 significantly inhibits NDV infection of Vero cells by preventing the release of viral particles from infected cells.
  • HY-146345
    Antiviral agent 18

    		Antibiotic Infection
    Antiviral agent 18 (Compound 5) is an anti-infection agent. Antiviral agent 18 results in good antiviral activity against murine norovirus. Antiviral agent 18 has the potential for the research of infectious and malignant diseases.
  • HY-B0035
    Sulfamethazine

    Sulfadimidine; Sulfadimerazine

    		 Bacterial Antibiotic Infection
    Sulfamethazine (Sulfadimidine) is an antimicrobial that is widely used to treat and prevent various animal diseases (such as gastrointestinal and respiratory tract infections). In China and the European Commission, the maximum residue level for Sulfamethazine in animal product is set at 100 µg/kg.
  • HY-B0213S1
    Sulfameter-13C6

    Sulfametoxydiazine-13C6; 5-Methoxysulfadiazine-13C6

    		 Antibiotic Bacterial Infection
    Sulfameter- 13C6 is the 13C6 labeled Sulfameter. Sulfameter (Sulfametoxydiazine; 5-Methoxysulfadiazine) is an effective long-acting sulfonamide antibiotic with antibacterial activities. Sulfameter can be used for the research of urinary tract infections and lepriasis.
  • HY-B0035A
    Sulfamethazine sodium

    Sulfadimidine sodium; Sulfadimerazine sodium

    		 Bacterial Antibiotic Infection
    Sulfamethazine sodium (Sulfadimidine sodium) is an antimicrobial that is widely used to treat and prevent various animal diseases (such as gastrointestinal and respiratory tract infections). In China and the European Commission, the maximum residue level for Sulfamethazine sodium in animal product is set at 100 µg/kg.
  • HY-147531
    Antibacterial agent 106

    		Bacterial Infection
    Antibacterial agent 106 (compound 8) is an orally active and potent antibacterial agent with antibiofilm activity. Antibacterial agent 106 shows potent antibacterial effect against multi-agent resistant (MDR)-Gram positive pathogens. Antibacterial agent 106 is highly effective in clearing 99.7% of the intracellular methicillin-resistant S. aureus (MRSA) harbored inside macrophages.
  • HY-W035051
    TSPP tetrasodium

    		Fluorescent Dye Cancer Infection
    TSPP tetrasodium is a photosensitizer that has shown impressive effects in in vivo regression of cancer and microorganism infections (Ex: 413 nm, Em: 640 nm).
  • HY-124237A
    N-Octanoyl-L-homoserine lactone

    		Bacterial Infection
    N-octanoyl-L-Homoserine lactone is a small diffusible signaling molecule involved in quorum sensing, thereby controlling gene expression and affecting cellular metabolism. N-octanoyl-L-Homoserine lactone can be used for the infection prevention and regulation of virulence in cystic fibro.
  • HY-148560B
    cis-ccc_R08

    		HBV Infection
    cis-ccc_R08 (compound 1) is a flavonoid derivative that can be used in the study of hepatitis B virus (HBV) infection. cis-ccc_R08 is a cccDNA (covalently closed circular DNA) inhibitor.
  • HY-108402A
    Cefodizime sodium

    		Bacterial Antibiotic Infection
    Cefodizime sodium is a third generation cephalosporin antibiotic with a broad spectrum of antibacterial activity. Cefodizime sodium has no renal toxic effect, good tolerance and immune regulation activity, and can be used for the research of severe infections of the respiratory and urinary tracts.
  • HY-B0751
    Fumagillin

    Amebacilin; NSC9168

    		 Parasite HIV Antibiotic Infection
    Fumagillin(NSC9168) is an antimicrobial compound first isolated in 1949 from the fungus Aspergillus fumigatu. Fumagillin can inhibits HIV‐1 infection through the inhibition of HIV-1 viral protein R (Vpr) activity.
  • HY-B0439S
    Sulfadoxine-d4

    Sulphadoxine-d4

    		 Parasite HIV Antibiotic Endogenous Metabolite Infection
    Sulfadoxine-d4 is the deuterium labeled Sulfadoxine. Sulfadoxine(Sulphadoxine) is a long acting sulfonamide that is used, usually in combination with other agents, for respiratory, urinary tract and malarial infections. Sulfadoxine inhibits HIV replication in peripheral blood mononuclear cells.
  • HY-N0091S1
    Hypoxanthine-13C,15N2

    Purin-6-o-13C,15N2; Sarcine-13C,15N2

    		 Bacterial Infection
    Hypoxanthine- 13C, 15N2 is a 15N-labeled and 13C-labled Furaltadone. Furaltadone, a nitrofuran agent, has the potential for the study in infections of chickens with salmonella enteritidis. Furaltadone is inhibitory and bactericidal in vitro for staphylococci
  • HY-19378
    MIV-150

    PC 815

    		 HIV Infection
    MIV-150 is a nonnucleoside reverse transcriptase (NNRT) inhibitor, blocking HIV-1 and HIV-2 infections, with an EC50<1 nM against HIV-1/HIV-2MN.
  • HY-17427S
    Emtricitabine-15N,d2

    BW1592-15N,d2

    		 HIV Reverse Transcriptase Endogenous Metabolite Infection
    Emtricitabine- 15N,d2 is a 15N-labeled and deuterium labeled Emtricitabine. Emtricitabine is a nucleoside reverse transcriptase inhibitor (NRTI) with an EC50 of 0.01 μM in PBMC cell. It is an antiviral agent for the treatment of HIV infection.
  • HY-B1175
    (2S,5R,6R)-Ticarcillin disodium

    		Bacterial Antibiotic Infection
    (2S,5R,6R)-Ticarcillin disodium is an injectable antibiotic for the treatment of Gram-negative bacteria, particularly Pseudomonas aeruginosa. It is also one of the few antibiotics capable of treating Stenotrophomonas maltophilia infections.
  • HY-146381
    SARS-CoV-2-IN-20

    		SARS-CoV Infection
    SARS-CoV-2-IN-20 (Compound 1a) is a potent inhibitor of SARS-CoV-2 with an EC50 of 6.5 μM. SARS-CoV-2-IN-20 has the potential for the research of infection diseases.
  • HY-B0126
    Marbofloxacin

    		Bacterial Antibiotic Infection
    Marbofloxacin is a third generation fluoroquinolone and orally active antimicrobial agent, which has a broad spectrum bactericidal activity and good efficacy. Marbofloxacin can be used for the research of infections by Gram-positive and Gram-negative bacteria and Mycoplasma.
  • HY-136597
    Remdesivir O-desphosphate acetonide impurity

    		DNA/RNA Synthesis SARS-CoV Infection
    Remdesivir O-desphosphate acetonide impurity is an impurity of Remdesivir. Remdesivir (GS-5734), a nucleoside analogue with effective antiviral activity and is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro.
  • HY-P99817
    Pegaldesleukin

    		Interleukin Related HIV Infection
    Pegaldesleukin is a conjugate of polyethylene glycol and interleukin-2 (PEG-IL2). Pegaldeslukin has antiviral activity and has potential applications in HIV, possibly delaying the progression of HIV infection by retaining the immune repertoire.
  • HY-B0126A
    Marbofloxacin hydrochloride

    		Bacterial Antibiotic Infection
    Marbofloxacin hydrochloride is a third generation fluoroquinolone and orally active antimicrobial agent, which has a broad spectrum bactericidal activity and good efficacy. Marbofloxacin hydrochloride can be used for the research of infections by Gram-positive and Gram-negative bacteria and Mycoplasma.
  • HY-17413
    Zidovudine

    Azidothymidine; AZT; ZDV

    		 HIV CRISPR/Cas9 Infection Cancer
    Zidovudine is a nucleoside reverse transcriptase inhibitor (NRTI), widely used to treat HIV infection. Zidovudine increases CRISPR/Cas9-mediated editing frequency.
  • HY-B0293
    Butoconazole nitrate

    RS 35887

    		 Fungal Infection
    Butoconazole nitrate (RS 35887), an imidazole antifungal agent, is active against Candida spp. and effective against vaginal infections due to Candida albicans. Butoconazole nitrate is presumed to function as other imidazole derivatives via inhibition of steroid synthesis.
  • HY-144798
    FWM-5

    		SARS-CoV Infection
    FWM-5 is a potent NSP13 helicase inhibitor. SARS-COV-2 NSP13 helicase enzyme plays crucial role in the virus life cycle. FWM-5 has the potential for the research of infection diseases.
  • HY-90001S
    Ritonavir-d6

    ABT 538-d6; RTV-d6

    		 HIV Protease HIV SARS-CoV Apoptosis Infection
    Ritonavir-d6 is the deuterium labeled Ritonavir. Ritonavir (ABT 538) is an inhibitor of HIV protease used to treat HIV infection and AIDS. Ritonavir is also a SARS-CoV 3CLpro inhibitor with an IC50 of 1.61 μM[1][2].
  • HY-B0441
    Tobramycin

    Nebramycin Factor 6; Deoxykanamycin B

    		 Bacterial Antibiotic Infection Cancer
    Tobramycin (Nebramycin Factor 6) is a parenterally administered, broad spectrum aminoglycoside antibiotic that is widely used in the treatment of moderate to severe bacterial infections due to sensitive organisms.
  • HY-W040073
    Nifurtimox

    		Parasite Lactate Dehydrogenase Cancer Infection
    Nifurtimox, an antiprotozoal agent, which is generally used for the treatment of infections with Trypanosoma cruzi, has been used in the therapy of neuroblastoma. Nifurtimox affects enzyme activity of lactate dehydrogenase (LDH).
  • HY-17413S1
    Zidovudine-13C,d3

    Azidothymidine-13C,d3; AZT-13C,d3; ZDV-13C,d3

    		 Isotope-Labeled Compounds HIV CRISPR/Cas9 Infection
    Zidovudine- 13C,d3 is the 13C- and deuterium labeled Zidovudine. Zidovudine is a nucleoside reverse transcriptase inhibitor (NRTI), widely used to treat HIV infection. Zidovudine increases CRISPR/Cas9-mediated editing frequency.
  • HY-151614
    Anti-infective agent 7

    		Bacterial Infection
    Anti-infective agent 7 is a potent anti-infectious agent. Anti-infective agent 7 has anti-infection activity against P. falciparum (IC50=2.5 μM) and M. tuberculosis (MIC=9 μM).
  • HY-15781
    Morinidazole

    		Bacterial Infection
    Morinidazole is an orally active and 5-nitroimidazole antimicrobial agent that undergoes extensive metabolism in humans via N +-glucuronidation and sulfation. Morinidazole can be used for bacterial infections research including appendicitis and pelvic inflammatory disease (PID) caused by anaerobic bacteria.
  • HY-136149A
    Mpro inhibitor N3 hemihydrate

    		SARS-CoV Virus Protease Infection
    Mpro inhibitor N3 hemihydrate is a potent inhibitor of SARS-CoV-2 Mpro with an EC50 of 16.77 μM for SARS-CoV-2. Mpro inhibitor N3 hemihydrate specifically inhibits Mpro from multiple coronaviruses, including SARS-CoV and MERS-CoV. Mpro inhibitor N3 hemihydrate displays inhibition against HCoV-229E, FIPV, and MHV-A59 with individual IC50 of 4.0 μM, 8.8 μM, and 2.7 μM, respectively.
  • HY-150625
    SARS-CoV-2 nsp13-IN-4

    		SARS-CoV Infection
    SARS-CoV-2 nsp13-IN-4 (C4 (d)) is a potent and selective nsp13 helicase small-molecule inhibitor and inhibit the ssDNA+ ATPase activity of nsp13 with an IC50 value of 57 μM. SARS-CoV-2 nsp13-IN-4 is agentlike molecule with molecular weight of less than 450Da and can provide a broad-spectrum antiviral effect.
  • HY-107566
    Conessine

    		Histamine Receptor Parasite Infection
    Conessine, a steroidal alkaloid, is a potent and selective histamine H3 receptor antagonist with Kis of 5.4, 6.0, 5.7 and 25 nM for human, dog, guinea pig, and rat H H3 receptor, respectively. Anti-malarial activity.
  • HY-146330
    FtsZ-IN-2

    		Bacterial Infection
    FtsZ-IN-2 (Compound 19) is an inhibitor of the bacterial cell division protein FtsZ with GTPase inhibitory activity. FtsZ-IN-2 exhibits anti-staphylococcal activity with MIC values of 2 µg/ml for MSSA and MRSA.
  • HY-110253
    18A

    HIV-1 inhibitor 18A

    		 HIV Infection
    18A (HIV-1 inhibitor 18A) is a reversible broad-spectrum HIV-1 inhibitor. 18A exhibits broad inhibitory activity against multiple HIV-1 strains by blocking the function of Env.
  • HY-14588
    Lopinavir

    ABT-378

    		 HIV HIV Protease SARS-CoV Infection
    Lopinavir (ABT-378) is a highly potent, selective peptidomimetic inhibitor of the HIV-1 protease, with Kis of 1.3 to 3.6 pM for wild-type and mutant HIV protease. Lopinavir acts by arresting maturation of HIV-1 thereby blocking its infectivity. Lopinavir is also a SARS-CoV 3CL pro inhibitor with an IC50 of 14.2 μM.
  • HY-A0161S
    Chlophedianol-13C6

    Clofedanol-13C6; Calmotusin-13C6; NSC 113595-13C6

    		 Isotope-Labeled Compounds Infection
    Chlophedianol- 13C6 is the 13C labeled Chlophedianol (HY-A0161). Chlophedianol is an orally active and potent antitussive agent. Chlophedianol can be used for the research of acute cough due to upper respiratory tract infections (URIs)[1][2][3].
  • HY-138102
    SSAA09E3

    		SARS-CoV Infection
    SSAA09E3 is a SARS-CoV entry inhibitor that inhibits SARS/HIV pseudotyped virus entry with an EC50 of 9.7 μM in 293T cells and inhibits SARS-CoV infection of Vero cells with an EC50 of 0.15 μM.
  • HY-90001S1
    Ritonavir-13C,d3

    ABT 538-13C,d3; RTV-13C,d3

    		 HIV Protease HIV SARS-CoV Apoptosis Infection
    Ritonavir- 13C,d3 is the 13C- and deuterium labeled Ritonavir. Ritonavir (ABT 538) is an inhibitor of HIV protease used to treat HIV infection and AIDS. Ritonavir is also a SARS-CoV 3CLpro inhibitor with an IC50 of 1.61 μM.
  • HY-10394
    Linezolid

    PNU-100766

    		 Bacterial Antibiotic Infection
    Linezolid (PNU-100766) is the first member of the class of oxazolidinone synthetic antibiotic. Linezolid acts by inhibiting the initiation of bacterial protein synthesis. Linezolid is used for the treatment of serious infections caused by Gram-positive bacteria that are resistant to several other antibiotics.
  • HY-16957
    LJ001

    		HCV HIV Infection
    LJ001 is a broad-spectrum and orally active antiviral agent. LJ001 exerts antiviral activities by binding to viral membranes. LJ001 inhibits TGEV and PDCoV infection. LJ001 decreases TGEV N and PDCoV N-protein expression.
  • HY-116229
    Gemifloxacin

    SB-265805; LB20304

    		 Antibiotic Bacterial Infection
    Gemifloxacin, a fluoroquinolone, is a potent and orally active antipneumococcal agent. Gemifloxacin shows bactericidal activity against highly quinolone-resistant pneumococci.Gemifloxacin can be used for the research of respiratory infections, such as community-acquired pneumonia (CAP) and acute exacerbation of chronic bronchitis (AECB).
  • HY-P1222
    LL-37, human

    		Bacterial Infection
    LL-37, human is a 37-residue, amphipathic, cathelicidin-derived antimicrobial peptide, which exhibits a broad spectrum of antimicrobial activity. LL-37, human could help protect the cornea from infection and modulates wound healing.
  • HY-B1370A
    (S)-Hydroxychloroquine

    (S)-HCQ

    		 Parasite Toll-like Receptor (TLR) SARS-CoV Autophagy Infection
    (S)-Hydroxychloroquine ((S)-HCQ) is the enantiomer of Hydroxychloroquine. Hydroxychloroquine, a synthetic antimalarial agent, inhibits Toll-like receptor 7/9 (TLR7/9) signaling, and shows efficiently inhibits SARS-CoV-2 infection in vitro.
  • HY-15781A
    (R)-Morinidazole

    		Bacterial Infection
    (R)-Morinidazole is an orally active and 5-nitroimidazole antimicrobial agent that undergoes extensive metabolism in humans via N +-glucuronidation and sulfation. (R)-Morinidazole can be used for bacterial infections research including appendicitis and pelvic inflammatory disease (PID) caused by anaerobic bacteria.
  • HY-115440
    CRS3123 dihydrochloride

    REP-3123 dihydrochloride

    		 Bacterial Antibiotic Infection
    CRS3123 (REP-3123) dihydrochloride, a fully synthetic antibacterial agent, potently inhibits methionyl-tRNA synthetase (MetRS) of Clostridioides difficile, inhibiting Clostridioides difficile toxin production and spore formation. CRS3123 dihydrochloride is an oral agent for the research of Clostridioides difficile infection (CDI).
  • HY-B0441A
    Tobramycin sulfate

    Nebramycin Factor 6 sulfate; Deoxykanamycin B sulfate

    		 Bacterial Antibiotic Infection Cancer
    Tobramycin sulfate (Nebramycin Factor 6 sulfate) is a parenterally administered, broad spectrum aminoglycoside antibiotic that is widely used in the treatment of moderate to severe bacterial infections due to sensitive organisms.
  • HY-17362
    Vancomycin hydrochloride

    		Bacterial Autophagy Antibiotic Infection Cancer
    Vancomycin hydrochloride is an antibiotic for the treatment of bacterial infections. It acts by inhibiting the second stage of cell wall synthesis of susceptible bacteria. Vancomycin also alters the permeability of the cell membrane and selectively inhibits ribonucleic acid synthesis.
  • HY-130997
    17-GMB-APA-GA

    		HSP ADC Cytotoxin Cancer Infection
    17-GMB-APA-GA is an ADC Cytotoxin. 17-GMB-APA-GA is a potent HSP90 inhibitor and used for latent T. gondii infection research.
  • HY-126363
    Ditiocarb

    Diethyldithiocarbamic acid

    		 HIV Cancer Infection
    Ditiocarb (Diethyldithiocarbamic acid) is an accelerator of the rate of copper cementation. Ditiocarb (Diethyldithiocarbamic acid) reduces the incidence of HIV infection, and also enhances adjuvant immunoresearch of high risk breast cancer.
  • HY-P2124
    Cyclo(L-Trp-L-Trp)

    		Antibiotic Bacterial Infection
    Cyclo(L-Trp-L-Trp) is an antibiotic, and shows antimicrobial activity. Cyclo(L-Trp-L-Trp) can inhibit A. baumannii, as well as Candida albicans, Bacillus subtilis, Micrococcus luteus, Saccharomyces cerevisiae, Aspergillus niger, Staphylococcus aureus. Cyclo(L-Trp-L-Trp) can be used in microbial infection research.
  • HY-B1370B
    (R)-Hydroxychloroquine

    (R)-HCQ

    		 Parasite Toll-like Receptor (TLR) SARS-CoV Autophagy Infection
    (R)-Hydroxychloroquine is the enantiomer of Hydroxychloroquine. Hydroxychloroquine is a synthetic antimalarial agent which can also inhibit Toll-like receptor 7/9 (TLR7/9) signaling. Hydroxychloroquine is efficiently inhibits SARS-CoV-2 infection in vitro.
  • HY-152259
    TMV-IN-4

    		TMV Infection
    TMV-IN-4 (compound 3) is a tobacco mosaic virus (TMV) inhibitor that effectively induces resistance and enhances plant tolerance to TMV infection by interacting with TMV helicase. TMV-IN-4 enhances peroxidase and superoxide dismutase activity, thereby increasing resistance to TMV in tobacco.
  • HY-146373
    Antibacterial agent 95

    		Bacterial Infection
    The minimum inhibitory concentration (MIC) of a new 2- (quinoline-4-methoxy) acetamide antituberculotic agent against the reference strain of Mycobacterium tuberculosis H37Rv was as low as 0.3 μ M. It also inhibited the growth of Mycobacterium tuberculosis in the macrophage model of tuberculosis infection.
  • HY-103583
    KDU731

    		PI4K Parasite Infection
    KDU731, an orally active C. parvum PI4K inhibitor with an IC50 value of 25 nM, blocks Cryptosporidium infection in vitro and in vivo. KDU731 is a promising agent candidate for the treatment of diarrhea caused by Cryptosporidium and meets a broad range of safety.
  • HY-N7121
    Erythromycin estolate

    		Bacterial Infection
    Erythromycin estolate, erythromycin derivative, is a macrolide antibiotic used in the treatment of a wide variety of bacterial infections. Erythromycin estolate causes several cases of liver injury which mostly include cholestatic hepatitis. Erythromycin estolate toxicity is related to its inhibitory effect on bile acid transport.
  • HY-107212
    Selamectin

    		Parasite Chloride Channel P-glycoprotein Bacterial Infection
    Selamectin, a semi-synthetic macrocyclic lactone, is a potent parasiticide and anthelminthic. Selamectin activates glutamate-gated chloride channels in neurons and pharyngeal muscles to prevent heartworm, Lymphatic filariae, and nematode infection. Selamectin is also a potent P-glycoprotein substrate and a P-glycoprotein inhibitor with an IC50 of 120 nM.
  • HY-B0024
    Prulifloxacin

    NM441

    		 Bacterial Antibiotic Infection
    Prulifloxacin (NM441) is an orally active fluoroquinolone antibiotic with a broad spectrum of activity against Gram-positive and -negative bacteria. Prulifloxacin is a proagent of a thiazeto-quinoline carboxylic acid derivative Ulifloxacin (NM394). Prulifloxacin has the potential for lower urinary tract infections and exacerbations of chronic bronchitis.
  • HY-P1222A
    LL-37, human TFA

    		Bacterial Infection
    LL-37, human TFA is a 37-residue, amphipathic, cathelicidin-derived antimicrobial peptide, which exhibits a broad spectrum of antimicrobial activity. LL-37, human TFA could help protect the cornea from infection and modulates wound healing.
  • HY-148104
    ACSS2-IN-2

    		Others Cancer Infection Metabolic Disease Inflammation/Immunology Neurological Disease
    ACSS2-IN-2 is an acyl-CoA synthetase short-chain family member 2 (ACSS2) inhibitor. ACSS2-IN-2 can inhibit ACSS2 activity with an IC50 value of 3.8 nM. ACSS2-IN-2 can be used for the research of several diseases, such as viral infection, metabolic disorders, neuropsychiatric diseases, inflammatory/autoimmune conditions and cancer.
  • HY-B0126S
    Marbofloxacin-d8

    		Bacterial Antibiotic Infection
    Marbofloxacin-d8 is the deuterium labeled Marbofloxacin. Marbofloxacin is a third generation fluoroquinolone and orally active antimicrobial agent, which has a broad spectrum bactericidal activity and good efficacy. Marbofloxacin can be used for the research of infections by Gram-positive and Gram-negative bacteria and Mycoplasma[1][2][3].
  • HY-W015591
    Mandelic acid

    (±)-Mandelic acid; DL-Mandelic acid

    		 Bacterial Endogenous Metabolite Infection
    Mandelic acid ((±)-Mandelic acid), an alpha-hydroxycarboxylic acid, has been widely used as an intermediate of pharmaceutical and fine chemicals. Mandelic acid shows antimicrobial activity and has been used for the research of urinary tract infections and vaginal trichomoniasis. Mandelic acid exhibits high sperm-immobilizing activity and low vaginal irritation.
  • HY-147014
    Cyclic HPMPC

    		CMV Orthopoxvirus Infection
    Cyclic HPMPC is a potent antiviral agent. Cyclic HPMPC can increase arterial oxygen saturation levels in lethal vaccinia virus (IHD strain)-infected mice. Cyclic HPMPC improves the outcome of congenital guinea pig cytomegalovirus (GPCMV) infection and decreases viral replication in guinea pig model.
  • HY-149057
    Neuraminidase-IN-12

    		Influenza Virus Infection
    NDV-IN-1 is an antiviral agent with high neuraminidase inhibitory activity. NDV-IN-1 exhibits in vitro inhibitory activity against Newcastle disease virus (NDV). NDV-IN-1 significantly inhibits NDV infection of Vero cells by preventing the release of virus particles from infected cells.
  • HY-B0957S
    Erythromycin ethylsuccinate-13C,d3

    Erythromycin ethyl succinate-13C,d3; EES-13C,d3

    		 Bacterial HIV Autophagy Antibiotic Infection
    Erythromycin ethylsuccinate- 13C,d3 is the 13C- and deuterium labeled Erythromycin Ethylsuccinate. Erythromycin Ethylsuccinate is an antibiotic useful for the treatment of a number of bacterial infections, has an antimicrobial spectrum similar to or slightly wider than that of penicillin. Erythromycin Ethylsuccinate has antiviral activity against HIV-1.
  • HY-B0510S
    Trimethoprim-d9

    		Antifolate Bacterial Antibiotic Infection
    Trimethoprim-d9 is the deuterium labeled Trimethoprim. Trimethoprim is a bacteriostatic antibiotic and an orally active dihydrofolate reductase inhibitor. Trimethoprim is active against a wide range of Gram-positive and Gram-negative aerobic bacteria. Trimethoprim has the potential for urinary tract infections, Shigellosis and Pneumocystis pneumonia treatment[1][2][3].
  • HY-137958A
    Bemnifosbuvir

    AT-511

    		 HCV SARS-CoV Infection
    Bemnifosbuvir (AT-511) is a potent and orally active HCV viral replication inhibitor. Bemnifosbuvir is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC90=0.47 μM). Bemnifosbuvir has pangenotypic antiviral activity.
  • HY-17430
    Amprenavir

    VX-478

    		 HIV HIV Protease SARS-CoV Infection Cancer
    Amprenavir (VX-478) is a HIV protease inhibitor (Ki=0.6 nM) used to treat HIV infection. Amprenavir is also a SARS-CoV 3CL pro inhibitor with an IC50 of 1.09 μM.
  • HY-B0177
    Tinidazole

    		Bacterial Antibiotic Parasite Infection Cancer
    Tinidazole, an orally available antibacterial agent, is a 5-nitroimidazole with selective activity against anaerobic bacteria and protozoa.
  • HY-N10197
    Pulixin

    		Parasite Endogenous Metabolite Infection
    Pulixin prevents FREP1 from binding to P. falciparum-infected cell lysate. Pulixin blocks the transmission of the parasite to mosquitoes with an EC50 of 11 µM. Pulixin also inhibits the proliferation of asexual-stage P. falciparum with an EC50 of 47 nM.
  • HY-N7701A
    L-Triguluronic acid

    		Fungal Infection
    L-Triguluronic acid is a linear polysaccharide copolymer composed of three L-guluronic acid (G) and can be used to from Alginate. Alginate is a generic name of unbranched polyanionic polysaccharides and can be used for the research of anti-fungal agents delivery carries.
  • HY-139982
    OX11

    		Bacterial Infection
    OX11 is a selective inhibitor of S. pneumoniae, P. aeruginosa, and E. coli bacterial strains.
  • HY-16776
    Censavudine

    OBP-601; BMS-986001

    		 HIV Reverse Transcriptase Nucleoside Antimetabolite/Analog Infection
    Censavudine (OBP-601; BMS-986001), a nucleoside analog, is a nucleoside reverse transcriptase inhibitor. Censavudine is a potent HIV inhibitor with EC50 ranges from 30 nM to 81 nM and 450 nM to 890 nM for HIV-2 and HIV-1, respectively.
  • HY-146331
    PC190723

    		Bacterial Antibiotic Infection
    PC190723 (Compound 2) is an inhibitor of the bacterial cell division protein FtsZ with an IC50 of 55 ng/ml. FtsZ-IN-3 exhibits anti-staphylococcal activity with MIC values of 1 µg/ml for MSSA and MRSA.
  • HY-136259
    ML188

    		SARS-CoV Virus Protease Infection
    ML188, a first in class probe, is a selective non-covalent SARS-CoV 3CLpro inhibitor with an IC50 of 1.5 μM. Antiviral activity.
  • HY-N7701C
    L-Pentaguluronic acid

    		Others Infection
    L-Pentaguluronic acid is a linear polysaccharide copolymer composed of four L-guluronic acid (G).
  • HY-133894
    Bofutrelvir

    FB2001

    		 SARS-CoV Infection
    Bofutrelvir (FB2001) is a SARS-CoV-2 main protease M pro inhibitor with an IC50 value of 53 nM and an EC50 value of 0.53 μM. Bofutrelvir exhibits potent antiviral efficacy against several current SARS-CoV-2 variants with EC50 values of 0.26-0.42 μM. Bofutrelvir has an additive antiviral effect when combined with Remdesivir (HY-104077).
  • HY-N7701
    L-Diguluronic acid

    		Fungal Infection
    L-Diguluronic acid is a linear polysaccharide copolymer composed of two L-guluronic acid (G) and can be used to from Alginate. Alginate is a generic name of unbranched polyanionic polysaccharides and can be used for the research of antifungal agents delivery carries.
  • HY-B0319
    Tioconazole

    UK-20349

    		 Fungal Antibiotic Infection
    Tioconazole (UK-20349) is an antifungal imidazole derivative with broad spectrum activity. Tioconazole has inhibitory active aginst several dermatophytes and several yeasts with MIC50s <3.12 mg/L and <9 mg/L, respectively.
  • HY-151442
    Antifungal agent 43

    		Fungal Infection
    Antifungal agent 43 (compound B05) is an antifungal agent. Antifungal agents 43 has antifungal activity by inhibiting biofilm formation. Antifungal agent 43 has low toxicity in human cancer cell lines.
  • HY-N7701D
    L-Hexaguluronic acid

    		Others Infection
    L-Hexaguluronic acid is a linear polysaccharide copolymer composed of six L-guluronic acid (G).
  • HY-151440
    Antifungal agent 42

    		Fungal Infection
    Antifungal agent 42 is an antifungal agent. Antifungal agent 42 has an inhibitory effect on lanosterol 14α-demethylase (CYP51) of C.alb.. Antifungal agent 42 inhibits biofilm formation.
  • HY-132987
    Avibactam tomilopil

    ARX-1796; AV-006

    		 Bacterial Infection
    Avibactam tomilopil (ARX-1796, AV-006), an Avibactam proagent, is an orally bioavailable β-lactamase inhibitor. Avibactam has a spectrum of inhibition of class A and C β-lactamases, including ESBLs, AmpC and Klebsiella pneumoniae carbapenemase (KPC) enzymes.
  • HY-B0806
    Proguanil

    		Parasite Antifolate Infection
    Proguanil, an antimalarial proagent, is metabolized to the active metabolite Cycloguanil (HY-12784). Proguanil is a dihydrofolate reductase (DHFR) inhibitor.
  • HY-N2562
    Norwogonin

    5,7,8-Trihydroxyflavone

    		 Enterovirus Infection
    Norwogonin, isolated from Scutellaria baicalensis Georgi, possesses antiviral activity against Enterovirus 71 (EV71) with an IC50 of 31.83 μg/ml
  • HY-N7701B
    L-Tetraguluronic acid

    		Others Infection
    L-Tetraguluronic acid is a linear polysaccharide copolymer composed of four L-guluronic acid (G).
  • HY-B0806A
    Proguanil hydrochloride

    		Parasite Antifolate Infection
    Proguanil hydrochloride, an antimalarial proagent, is metabolized to the active metabolite Cycloguanil (HY-12784). Proguanil hydrochloride is a dihydrofolate reductase (DHFR) inhibitor.
  • HY-138247
    β-Lactamase-IN-2

    EX-A4764; UUN51204

    		 Bacterial Antibiotic Infection
    β-Lactamase-IN-2 is a beta-lactamase inhibitor, extracted from patent WO 2019075084 A1, compound 1. β-Lactamase-IN-2 has anti-microbial and anti-bacterial effects.
  • HY-106922A
    Sanfetrinem sodium

    GV104326 sodium

    		 Antibiotic Bacterial Infection
    Sanfetrinem (GV104326) sodium is a beta-lactamase-stable antibiotic. Sanfetrinem sodium has broad-spectrum activity against gram-positive and gram-negative bacteria.
  • HY-151437
    Antifungal agent 40

    		Fungal Infection
    Antifungal agent 40 is an antifungal agent which extends into the narrow hydrophobic pocket II of C.alb. CYP51. Antifungal agent 40 has an inhibitory effect on lanosterol 14α-demethylase (CYP51). Antifungal agent 40 inhibits biofilm formation.
  • HY-18980
    Rottlerin

    Mallotoxin; NSC 56346; NSC 94525

    		 PKC Autophagy Apoptosis HIV RABV Infection Cancer
    Rottlerin, a natural product purified from Mallotus Philippinensis, is a specific PKC inhibitor, with IC50 values for PKCδ of 3-6 μM, PKCα,β,γ of 30-42 μM, PKCε,η,ζ of 80-100 μM. Rottlerin acts as a direct mitochondrial uncoupler, and stimulates autophagy by targeting a signaling cascade upstream of mTORC1. Rottlerin induces apoptosis via caspase 3 activation. Rottlerin inhibits HIV-1 integration and Rabies virus (RABV) infection.
  • HY-P1698
    Reltecimod

    AB-103

    		 Bacterial CD28 Infection Inflammation/Immunology
    Reltecimod (AB-103) is a T-cell-specific surface glycoprotein CD28 (TP44) antagonist. Reltecimod has beneficial effects against different bacterial infections, their exotoxins and endotoxins, and ionizing radiation. Reltecimod modulates the inflammatory response by targeting and attenuating the critical CD28/B7-2 co-stimulatory pathway, without inhibiting it. Reltecimod can be used to research necrotizing soft-tissue infections (NSTIs).
  • HY-B0510S2
    Trimethoprim-d3

    		Antifolate Bacterial Antibiotic Infection
    Trimethoprim-d3is the deuterium labeled Trimethoprim. Trimethoprim is a bacteriostatic antibiotic and an orally active dihydrofolate reductase inhibitor. Trimethoprim is active against a wide range of Gram-positive and Gram-negative aerobic bacteria. Trimethoprim has the potential for urinary tract infections, Shigellosis and Pneumocystis pneumonia treatment[1][2][3].
  • HY-17580
    Fidaxomicin

    OPT-80; PAR-101

    		 DNA/RNA Synthesis Bacterial Apoptosis Antibiotic Infection
    Fidaxomicin (OPT-80), a macrocyclic antibiotic, is an orally active and potent RNA polymerase inhibitor. Fidaxomicin has a narrow spectrum of antibacterial activity and a good anti-Clostridium difficile activity (MIC90=0.12 μg/mL). Fidaxomicin can be used for Clostridium difficile infection (CDI) research.
  • HY-B0488
    Clorsulon

    L631529; MK401

    		 Parasite Infection
    Clorsulon (L631529; MK401) is an orally active flukicidal agent against liver flukes (Fasciola hepatica and Fasciola gigantica) infections in calves and sheep. Clorsulon is also a competitive inhibitor of both 3-phosphoglycorate and ATP andinhibits glucose utilization and acetate and propionate formation by mature Fasciola hepatica in vitro.
  • HY-13859
    Clevudine

    L-FMAU

    		 HBV DNA/RNA Synthesis Orthopoxvirus Infection
    Clevudine (L-FMAU), a nucleoside analog of the unnatural L-configuration, has potent anti-HBV activity with long half-life, low toxicity. Clevudine is a non-competitive inhibitor that is not incorporated into the viral DNA but rather binds to the polymerase. Clevudine is active against cowpox virus respiratory infection in mice.
  • HY-146116
    Antifungal agent 32

    		Fungal Infection
    Antifungal agent 32 (compound 1a) is a potent antifungal agent. Antifungal agent 32 inhibits Candida albicans filamentation and biofilm formation. Antifungal agent 32 inhibits the morphological switching of Candida albicans and its adherence to epithelial cells. Antifungal agent 32 can be used for Candida albicans infections research.
  • HY-N2036
    Mosloflavone

    		Enterovirus Bacterial Infection
    Mosloflavone is a flavonoid isolated from Scutellaria baicalensis Georgi with  anti-EV71 activity. Mosloflavone  inhibits VP2 virus replication and protein expression during the initial stage of virus infection and inhibits viral VP2 capsid protein synthesis. Mosloflavone is a promising biocide and inhibits P. aeruginosa virulence and biofilm formation.
  • HY-A0281S
    4-Phenylbutyric acid-d11

    4-PBA-d11; Benzenebutyric acid-d11

    		 HDAC Virus Protease Cancer Infection
    4-Phenylbutyric acid-d11 is the deuterium labeled 4-Phenylbutyric acid. 4-Phenylbutyric acid (4-PBA) is an inhibitor of HDAC and endoplasmic reticulum (ER) stress, used in cancer and infection research.
  • HY-N6647
    Luteolin-7-rutinoside

    		Fungal Infection Inflammation/Immunology
    Luteolin-7-rutinoside has both anti-arthritic and antifungal activities, can result in a combination therapy for the treatment of fungal arthritis due to C. albicans infection.
  • HY-B1148B
    Furaltadone L-tartrate

    Altafur L-tartrate

    		 Bacterial Infection Inflammation/Immunology
    Furaltadone L-tartrate (Altafur L-tartrate), a nitrofuran agent, has the potential for the study in infections of chickens with salmonella enteritidis. Furaltadone is inhibitory and bactericidal in vitro for staphylococci .
  • HY-W040073S
    Nifurtimox-d4

    		Parasite Lactate Dehydrogenase Cancer Infection
    Nifurtimox-d4 is deuterium labeled Nifurtimox. Nifurtimox, an antiprotozoal agent, which is generally used for the treatment of infections with Trypanosoma cruzi, has been used in the therapy of neuroblastoma. Nifurtimox affects enzyme activity of lactate dehydrogenase (LDH).
  • HY-146344
    Antiviral agent 17

    		Antibiotic Infection
    Antiviral agent 17 (Compound 4) is an anti-infection agent. Antiviral agent 17 retains its antiviral effect in a human replicon assay (EC50 = 0.015 μM). Antiviral agent 17 results in good antiviral activity against murine norovirus. Antiviral agent 17 has the potential for the research of infectious and malignant diseases.
  • HY-17395S
    Terbinafine-d3 hydrochloride

    TDT 067-d3 (hydrochloride)

    		 Fungal Bacterial Antibiotic Infection
    Terbinafine-d3 (hydrochloride) is the deuterium labeled Terbinafine hydrochloride. Terbinafine hydrochloride (TDT 067 hydrochloride) is an antifungal medication used to treat fungal infections. It is a potent non-competitive inhibitor of squalene epoxidase from Candida with a Ki of 30 nM[1][2]. Terbinafine hydrochloride also antibacterial activity against certain Gram-positive and Gram-negative bacteria[3].
  • HY-124801
    ABMA

    		Bacterial Influenza Virus Parasite Infection
    ABMA is a broad-spectrum inhibitor of intracellular toxins and pathogens. ABMA efficiently protects cells against various toxins and pathogens including viruses, intracellular bacteria and parasite. ABMA selectively acts at host cell late endosomes rather than targeting toxin or pathogen itself. ABMA has broad-spectrum anti-infection activity.
  • HY-17395AS
    Terbinafine-d7

    TDT 067-d7

    		 Fungal Bacterial Antibiotic Infection
    Terbinafine-d7 is the deuterium labeled Terbinafine. Terbinafine (TDT 067) is an antifungal medication used to treat fungal infections. It is a potent non-competitive inhibitor of squalene epoxidase from Candida with a Ki of 30 nM[1][2]. Terbinafine also antibacterial activity against certain Gram-positive and Gram-negative bacteria[3].
  • HY-B1159S
    Nitroxoline-D4

    8-Hydroxy-5-nitroquinoline-d4; 5-Nitro-8-quinolinol-d4

    		 Bacterial Autophagy Antibiotic Infection Cancer
    Nitroxoline-d4 is the deuterium labeled Nitroxoline. Nitroxoline is an antibiotic that has proven to be very effective at combating biofilm infections. Nitroxoline functions by chelating Fe2+ and Zn2+ ions from the biofilm matrix[1][2].
  • HY-15872A
    FTI-277 hydrochloride

    		Farnesyl Transferase Apoptosis Ras Cancer Infection
    FTI-277 hydrochloride is an inhibitor of farnesyl transferase (FTase); a highly potent Ras CAAX peptidomimetic which antagonizes both H- and K-Ras oncogenic signaling. FTI-277 hydrochloride can inhibit hepatitis delta virus (HDV) infection.
  • HY-15872
    FTI-277

    		Farnesyl Transferase Apoptosis Ras Cancer Infection
    FTI-277 is an inhibitor of farnesyl transferase (FTase); a highly potent Ras CAAX peptidomimetic which antagonizes both H- and K-Ras oncogenic signaling. FTI-277 can inhibit hepatitis delta virus (HDV) infection.
  • HY-134116
    Isoflupredone acetate

    		Others Infection Inflammation/Immunology
    Isoflupredone acetate is a corticosteroids with anti-inflammatory activity. Isoflupredone acetate can be used for research ketosis, musculoskeletal disorders, hypersensitivity, infections, inflammatory diseases in cows, horse, pigs, et al..
  • HY-P99177
    Enibarcimab

    		SARS-CoV Infection Cardiovascular Disease
    Enibarcimab is a humanised murine monoclonal immunoglobulin G1 (IgG1) antibody, could be used for acute heart failure, COVID-19 infections and septic shock research.
  • HY-142932
    BTK-IN-6

    		Btk Cancer Inflammation/Immunology Neurological Disease
    BTK-IN-6 is a potent inhibitor of Bruton's Tyrosine Kinase (BTK). BTK is a member of the Tec family of tyrosine kinases and plays an important role in the regulation of early B-cell development and mature B-cell activation and survival. BTK-IN-6 has the potential for the research of immune disorders, cancer, cardiovascular diseases, viral infections, inflammation, metabolism/endocrine function disorders, and neurological disorders (extracted from patent WO2021136219A1, compound 8).
  • HY-144066
    Cap-dependent endonuclease-IN-21

    		Influenza Virus Infection
    Cap-dependent endonuclease-IN-21 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-21 inhibits the replication of influenza virus. ap-dependent endonuclease-IN-21 has the potential for the research of influenza virus infection (influenza A) (extracted from patent WO2021233302A1, compound 8B or 8A).
  • HY-148560A
    trans-ccc_R08

    		HBV Infection
    trans-ccc_R08 (compound 1-B) is a potent cccDNA (covalently closed circular DMA) inhibitor. trans-ccc_R08 inhibits HBeAg level with an IC50 value of 0.08 µM. trans-ccc_R08 has the potential for the research of Hepatitis B Virus infection (HBV).
  • HY-B1002S
    Oxolinic acid-d5

    		Bacterial Antibiotic DNA/RNA Synthesis Infection
    Oxolinic acid-d5 is the deuterium labeled Oxolinic acid. Oxolinic acid is an antibiotic against both Gram-negative and Gram-positive bacteria. Oxolinic acid can be used for the research of acute and chronic urinary tract infections. Oxolinic acid is a DNA/RNA synthesis inhibitor. Oxolinic acid acts a dopamine uptake inhibitor and stimulants locomotor effect in mice[1][2][3].
  • HY-15303B
    Pritelivir mesylate hydrate

    AIC316 mesylate hydrate; BAY 57-1293 mesylate hydrate

    		 HSV Infection
    Pritelivir mesylate hydrate (BAY 57-1293 mesylate hydrate), an inhibitor of the viral helicase-primase complex, exhibits antiviral activity in vitro and in animal models of herpes simplex virus (HSV) infection. Pritelivir mesylate hydrate is active against herpes simplex virus types 1 and 2 (HSV-1 and HSV-2) with the IC50 of 0.02 μM against HSV1-2.
  • HY-13801
    Fexinidazole

    HOE 239

    		 Parasite Infection
    Fexinidazole (HOE 239) is an orally active, potent nitroimidazole antitrypanosomal agent. Fexinidazole shows trypanocidal activity against T. brucei subspecies and strains with IC50s of 0.7-3.3 μM (0.2-0.9 μg/ml). Fexinidazol has the potential for human sleeping sickness (HAT) caused by infection with T. brucei.
  • HY-15303
    Pritelivir

    AIC316; BAY 57-1293

    		 HSV Infection
    Pritelivir (AIC316), an inhibitor of the viral helicase-primase complex, exhibits antiviral activity in vitro and in animal models of herpes simplex virus (HSV) infection. Pritelivir is active against herpes simplex virus types 1 and 2 (HSV-1 and HSV-2) with the IC50 of 0.02 μM against HSV1-2.
  • HY-144067
    Cap-dependent endonuclease-IN-23

    		Influenza Virus Infection
    Cap-dependent endonuclease-IN-23 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-23 inhibits the replication of influenza virus. ap-dependent endonuclease-IN-23 has the potential for the research of influenza virus infection (influenza A) (extracted from patent WO2021233302A1, compound 8A or 8B).
  • HY-15303A
    Pritelivir mesylate

    AIC316 mesylate; BAY 57-1293 mesylate

    		 HSV Infection
    Pritelivir mesylate (BAY 57-1293 mesylate), an inhibitor of the viral helicase-primase complex, exhibits antiviral activity in vitro and in animal models of herpes simplex virus (HSV) infection. Pritelivir mesylate is active against herpes simplex virus types 1 and 2 (HSV-1 and HSV-2) with the IC50 of 0.02 μM against HSV1-2.
  • HY-P1258A
    PSI TFA

    Proteasome Inhibitor 1 TFA

    		 Proteasome Cancer Infection
    PSI (TFA) is a potent proteasome inhibitor. PSI (TFA) inhibits the proliferation of primary effusion lymphoma (PEL) cells. PSI (TFA) can be used for the research of Kaposi’s sarcoma-associated herpesvirus (KSHV) infection and KSHV-associated lymphomas.
  • HY-P1258
    PSI

    Proteasome Inhibitor 1

    		 Proteasome Cancer Infection
    PSI (Proteasome Inhibitor 1) is a potent proteasome inhibitor. PSI inhibits the proliferation of primary effusion lymphoma (PEL) cells. PSI has the potential for the research of Kaposi’s sarcoma-associated herpesvirus (KSHV) infection and KSHV-associated lymphomas.
  • HY-W031727
    Hydroxychloroquine

    		Parasite Toll-like Receptor (TLR) SARS-CoV Autophagy Cancer Infection
    Hydroxychloroquine is a synthetic antimalarial agent which can also inhibit Toll-like receptor 7/9 (TLR7/9) signaling. Hydroxychloroquine is efficiently inhibits SARS-CoV-2 infection in vitro.
  • HY-13672
    LY2334737

    		Nucleoside Antimetabolite/Analog Enterovirus Cancer Infection
    LY2334737 is an nucleoside analog and is an orally active proagent of Gemcitabine. LY2334737 exhibits inhibitory activity against enterovirus A71 (EV-A71) infection. LY2334737 has antiviral and anticancer effects.
  • HY-143288
    NTPDase-IN-2

    		Phosphatase Cancer Infection Inflammation/Immunology
    NTPDase-IN-2 (compound 5g) is a selective NTPDase inhibitor with IC50s of 0.04 and 2.27 µM for h-NTPDase-2/-8, respectively. NTPDase-IN-2 non-competitively inhibits h-NTPDase-1/-2 with a Km of 74 µM for h-NTPDase-2. NTPDase-IN-2 can be used in studies of cancer, immunologic disorders as well as bacterial infections.
  • HY-148837
    c-Myc inhibitor 7

    		c-Myc Casein Kinase Cancer Infection Cardiovascular Disease
    c-Myc inhibitor 7 is a c-Myc inhibitor and a multiple target protein degrader. c-Myc inhibitor 7 effective degrades c-MYC, CK1α, GSPT1 and IKZF1/2/3 proteins in a variety of tumor cells. c-Myc inhibitor 7 can be used for c-Myc high expression related disease research, such as cancer, cardiovascular and cerebrovascular diseases, and viral infection.
  • HY-111003
    Isothiafludine

    NZ-4

    		 HBV Infection
    Isothiafludine is an orally active non-nucleosidic anti-HBV compound. Isothiafludine inhibits hepatitis B virus replication by blocking pregenomic RNA encapsidation.
  • HY-145439
    Colistin adjuvant-1

    		Bacterial NF-κB Infection
    Colistin adjuvant-1 is a colistin adjuvant, shows increased colistin potentiation activity against Gram-negative bacteria. Colistin adjuvant-1 inhibits NF-κB with an IC50 of 0.209 μM.
  • HY-19509
    IQP-0528

    		Reverse Transcriptase HIV Infection
    IQP-0528 is a highly potent nonnucleoside reverse transcriptase inhibitor (NNRTI). IQP-0528 shows nanomolar activity against both HIV-1 and HIV-2, with an HIV-1 EC50 of 0.2 nM and an HIV-2 EC50 of 100 nM.
  • HY-145440
    Colistin adjuvant-2

    		Bacterial Infection
    Colistin adjuvant-2 is a colistin adjuvant, shows increased colistin potentiation activity against Gram-negative bacteria.
  • HY-117684
    Cabamiquine

    DDD107498; DDD-498; M5717

    		 Parasite CaMK Infection
    Cabamiquine (DDD107498) is a potent and orally active antimalarial agent, inhibits multiple life-cycle stages of the parasite, with an EC50 of 1 nM against P. falciparum 3D7. Cabamiquine inhibits protein synthesis by targeting eEF2/CaMKIII, with an EC50 of 2 nM for WT-PfeEF2.
  • HY-148077
    Phosphoglycolohydroxamic acid

    		Bacterial Fungal Infection
    Phosphoglycolohydroxamic acid is a potent aldolase and triose-phosphate isomerase inhibitor. Phosphoglycolohydroxamic acid can be used in the research of antibacterial and antifungal area.
  • HY-18649
    Galidesivir hydrochloride

    BCX4430 hydrochloride; Immucillin-A hydrochloride

    		 DNA/RNA Synthesis SARS-CoV Filovirus Infection
    Galidesivir (BCX4430) hydrochloride, an adenosine analog and a direct-acting antiviral agent, disrupts viral RNA-dependent RNA polymerase (RdRp) activity. Galidesivir hydrochloride is active in vitro against many RNA viral pathogens, including the filoviruses and emerging infectious agents such as MERS-CoV, SARS-CoV, and SARS-CoV-2. Galidesivir hydrochloride inhibits some negative-sense RNA viruses with EC50s ranging from ~3 to ~68 μM.
  • HY-147255A
    (S)-Canocapavir

    (S)-ZM-H1505R

    		 Others Infection
    (S)-Canocapavir is the isomer of Canocapavir (HY-147255A). Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B.
  • HY-100373
    Isavuconazonium sulfate

    BAL8557-002

    		 Fungal Infection
    Isavuconazonium sulfate (BAL8557-002), the proagent of the active triazole Isavuconazole, is an orally active antifungal agent. Isavuconazonium sulfate is used for invasive aspergillosis and mucormycosis.
  • HY-145053
    HBV-IN-10

    		HBV Infection
    HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). From patent WO2021204258A1, compound 6.
  • HY-145060
    HBV-IN-13

    		HBV Infection
    HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor. From patent WO2021204252A1, compound 1_B.
  • HY-117684A
    Cabamiquine succinate

    DDD107498 succinate; DDD-498 succinate; M5717 succinate

    		 Parasite CaMK Infection
    Cabamiquine (DDD107498) succinate is a potent and orally active antimalarial agent, inhibits multiple life-cycle stages of the parasite, with an EC50 of 1 nM against P. falciparum 3D7. Cabamiquine succinate inhibits protein synthesis by targeting eEF2/CaMKIII, with an EC50 of 2 nM for WT-PfeEF2.
  • HY-145059
    HBV-IN-12

    		HBV Infection
    HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). HBV-IN-12 shows anti-HBV DNA activity (0.001 μM＜EC50 ≤0.02 μM). From patent WO2021204252A1, compound 15.
  • HY-18649A
    Galidesivir

    BCX4430; Immucillin-A

    		 DNA/RNA Synthesis SARS-CoV Filovirus Infection
    Galidesivir (BCX4430), an adenosine analog and a direct-acting antiviral agent, disrupts viral RNA-dependent RNA polymerase (RdRp) activity. Galidesivir is active in vitro against many RNA viral pathogens, including the filoviruses and emerging infectious agents such as MERS-CoV, SARS-CoV, and SARS-CoV-2. Galidesivir inhibits some negative-sense RNA viruses with EC50s ranging from ~3 to ~68 μM.
  • HY-126085
    (±)-Alliin

    (±)-L-Alliin

    		 SARS-CoV Infection
    (±)-Alliin is the main active component of garlic. (±)-Alliin is a putative inhibitor of the main protease of SARS-CoV-2 (Mpro).
  • HY-117766
    PC945

    		Fungal Cytochrome P450 Infection
    PC945, a potent, long-acting antifungal triazole, possesses activity against a broad range of both azole-susceptible and azole-resistant strains of Aspergillus fumigatus. PC945 is also a potent, tightly binding inhibitor of A. fumigatus sterol 14α-demethylase activity, CYP51A and CYP51B, with IC50s of 0.23 μM and 0.22 μM, respectively.
  • HY-145053A
    (5S,8R)-HBV-IN-10

    		HBV Infection
    (5S,8R)-HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). From patent WO2021204258A1, compound 6.
  • HY-147255
    Canocapavir

    ZM-H1505R

    		 HBV Infection
    Canocapavir (ZM-H1505R) has orally antiviral activity. Canocapavir is a HBV capsid inhibitor that can be used in the research of Chronic hepatitis B. .
  • HY-136425
    Fosetyl-aluminum

    Fosetyl-Al

    		 Fungal Infection
    Fosetyl-aluminum (Fosetyl-Al) is an active ingredient in many fungicides against downy mildew. Fosetyl-aluminum is used to control many diseases caused by Phytophthora spp. on agricultural and horticultural crops.
  • HY-106228
    HLF1-11

    		Fungal Bacterial Glutathione Peroxidase Infection
    HLF1-11, a human lactoferrin-derived peptide, is a broad spectrum antimicrobial agent. HLF1-11 inhibits human MPO activity. HLF1-11 also directs GM-CSF-driven monocyte differentiation toward macrophages, and enhances immune responses.
  • HY-125713
    Ganoderic acid Y

    		Glucosidase Enterovirus Infection
    Ganoderic acid Y is a α-glucosidase inhibitor with an IC50 of 170 μM for yeast α-glucosidase. Ganoderic acid Y inhibits enterovirus 71 (EV71) replication through blocking EV71 uncoating.
  • HY-122943
    Moracin D

    		Fungal Apoptosis Cancer Infection
    Moracin D is a flavonoid that can be isolated from Morus alba. Moracin D induces cell apoptosis and shows hypoglycemic, antiadipogenic, antifungal and antitumor effects. Moracin D can be used for fungal infection and breast cancer research.
  • HY-128780B
    SPR206 acetate

    		Bacterial Antibiotic Infection
    SPR206 acetate is a polymyxin analog with antibiotic activity against Gram-negative pathogens, including multidrug-resistant (MDR) variants. SPR206 acetate has an anti-bacterial infection effect by interacting with the bacterium’s outer membrane. The MIC values of SPR206 acetate against Pseudomonas aeruginosa Pa14 and Acinetobacter baumannii NCTC13301 are both 0.125 mg/L.
  • HY-143287
    NTPDase-IN-1

    		Phosphatase Cancer Infection Inflammation/Immunology
    NTPDase-IN-1 (compound 5a) is a selective NTPDase inhibitor with IC50s of 0.05, 0.23 and 0.54 µM for h-NTPDase-1/-2/-8, respectively. NTPDase-IN-1 non-competitively inhibits h-NTPDase-1/-2 with a Km of 21 µM for h-NTPDase-1. NTPDase-IN-1 can be used in studies of cancer, immunologic disorders as well as bacterial infections.
  • HY-10367A
    Canertinib dihydrochloride

    CI-1033 dihydrochloride; PD-183805 dihydrochloride

    		 EGFR Orthopoxvirus Cancer Infection
    Canertinib dihydrochloride (CI-1033 dihydrochloride) is a potent and irreversible EGFR inhibitor; inhibits cellular EGFR and ErbB2 autophosphorylation with IC50s of 7.4 and 9 nM. Canertinib dihydrochloride is active against vaccinia virus respiratory infection in mice.
  • HY-12457
    Rachelmycin

    CC-1065; NSC 298223

    		 Antibiotic DNA/RNA Synthesis Cancer Infection
    Rachelmycin (CC-1065) is an antitumor antibiotic and a DNA-alkylating agent. Rachelmycin has cytotoxic potency that can be used as a cytotoxin to synthesis ADC. Rachelmycin effectively inhibits DNA synthesis. Rachelmycin can be used for cancer and infection research.
  • HY-13234
    Rifaximin

    		Bacterial Antibiotic DNA/RNA Synthesis Infection Cancer
    Rifaximin, a gastrointestinal-selective antibiotic, binds the β-subunit of bacterial DNA-dependent RNA polymerase, resulting in inhibition of bacterial RNA synthesis. Rifaximin susceptibility is higher against Gram-positive strains (MIC: 0.03-5 mg/ml) compared to Gram-negative bacteria (MIC: 8-50 mg/mL).
  • HY-B0255
    Adefovir dipivoxil

    GS 0840

    		 HBV Reverse Transcriptase Orthopoxvirus Endogenous Metabolite Infection Cancer
    Adefovir dipivoxil, an adenosine analogue, is an oral proagent of the nucleoside reverse transcriptase inhibitor Adefovir. Adefovir dipivoxil inhibits both the wild type and HBV Lamivudine-resistant strains. Adefovir dipivoxil shows anti-orthopoxvirus activity.
  • HY-B0307A
    Idoxuridine hydrate

    5-Iodo-2′-deoxyuridine hydrate; 5-IUdR hydrate; IdUrd hydrate

    		 Phosphatase Infection
    Idoxuridine (5-Iodo-2′-deoxyuridine, 5-IUdR, IdUrd) hydrate is an iodinated thymidine analogue that competitively inhibits phosphorylases. Idoxuridine can inhibit viral activity, particularly viral eye infections, including herpes simplex keratitis, by inhibiting DNA polymerase and affecting viral replication. Idoxuridine against feline herpesvirus has the IC50 value of 4.3 μM.
  • HY-B0693A
    Ranitidine bismuth citrate

    		Histamine Receptor Bacterial SARS-CoV Infection
    Ranitidine bismuth citrate is an orally active Histamine H2-receptor antagonist with an IC50 of 3.3 μM. Ranitidine bismuth citrate has high selectivity for SARS-CoV-2-infected cells. Ranitidine bismuth citrate is a commonly used agent anti-Helicobacter pylori infection with an MIC90 value of 16 ng/L.
  • HY-145949
    Remdesivir de(ethylbutyl 2-aminopropanoate)

    		Drug Metabolite Infection
    Remdesivir de(ethylbutyl 2-aminopropanoate) is an impurity of Remdesivir. Remdesivir, a nucleoside analogue with effective antiviral activity, has EC50s of 74 nM for SARS-CoV and MERS-CoV in HAE cells, and 30 nM for murine hepatitis virus in delayed brain tumor cells. Remdesivir is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro.
  • HY-N10177
    Peniterphenyl A

    		HSV Infection
    Peniterphenyl A is a natural product obtained from a deep-sea-derived Penicillium sp. Peniterphenyl A inhibits HSV-1/2 virus entry into cells and may block HSV-1/2 infection through direct interaction with virus envelope glycoprotein D to interfere with virus adsorption and membrane fusion. Peniterphenyl A is a promising lead compound against HSV-1/2.
  • HY-143750
    Cap-dependent endonuclease-IN-7

    		Influenza Virus Infection
    Cap-dependent endonuclease-IN-7 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-7 Inhibits the synthesis of viral mRNA and eventually inhibits virus proliferation. Cap-dependent endonuclease-IN-7 has the potential for the research of viral infections (including influenza A, influenza B and influenza C) (extracted from patent WO2020177715A1, compound 5)
  • HY-P1649
    SPR741

    NAB741

    		 Bacterial Antibiotic Infection
    SPR741 (NAB741) is a cationic peptide derived from polymyxin B and is a potentiator molecule. SPR741 increases the permeability of the outer membrane of Gram-negative bacteria and is used to treat severe Gram-negative bacteria infections. SPR741 inhibits multidrug-resistant Gram-negative bacteria. The spectrum of activity of the antibiotic can be widened when used in combination with SPR741.
  • HY-137958
    Bemnifosbuvir hemisulfate

    AT-527

    		 HCV SARS-CoV Infection
    Bemnifosbuvir hemisulfate (AT-527), a hemisulfate salt of AT-511, a guanosine nucleotide proagent, is a potent and orally active HCV viral replication inhibitor. Bemnifosbuvir hemisulfate is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC90=0.47 μM). Bemnifosbuvir hemisulfate has pangenotypic antiviral activity.
  • HY-111243
    Ganoderone A

    		HSV Cancer Infection
    Ganoderone A is a triterpene compound that can be isolated from the fruiting body of Ganoderma pfeifferi and Ganoderma calidophilum. Ganoderone A has antiviral activity against HSV with IC50 value of 0.3 µg/mL. Ganoderone A has potential applications in viral infections and tumors.
  • HY-17430S1
    Amprenavir-d4-1

    VX-478-d4-1

    		 HIV HIV Protease SARS-CoV Infection Cancer
    Amprenavir-d4-1 is deuterium labeled Amprenavir. Amprenavir (VX-478) is a HIV protease inhibitor (Ki=0.6 nM) used to treat HIV infection. Amprenavir is also a SARS-CoV 3CLpro inhibitor with an IC50 of 1.09 μM.
  • HY-B1370
    Hydroxychloroquine sulfate

    HCQ sulfate

    		 Parasite Toll-like Receptor (TLR) SARS-CoV Autophagy Cancer Infection
    Hydroxychloroquine sulfate (HCQ sulfate) is a synthetic antimalarial agent which can also inhibit Toll-like receptor 7/9 (TLR7/9) signaling. Hydroxychloroquine sulfate is efficiently inhibits SARS-CoV-2 infection in vitro.
  • HY-108062A
    BLI-489 hydrate

    		Bacterial Infection
    BLI-489 hydrate, a penem β-lactamase inhibitor, is active against class A and class C as well as some class D β-lactamases. The combination of Piperacillin and BLI-489 hydrate is efficacious against murine infections caused by class A (including extended-spectrum β-lactamases), class C (AmpC), and class D β-lactamase-expressing pathogens.
  • HY-104077S1
    Remdesivir-d4

    GS-5734-d4

    		 DNA/RNA Synthesis SARS-CoV Infection
    Remdesivir-d4 is deuterium labeled Remdesivir. Remdesivir (GS-5734), a nucleoside analogue with effective antiviral activity, has EC50s of 74 nM for SARS-CoV and MERS-CoV in HAE cells, and 30 nM for murine hepatitis virus in delayed brain tumor cells. Remdesivir is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro[1][2].
  • HY-123319A
    Antofloxacin

    		Bacterial Antibiotic Infection
    Antofloxacin is a well tolerate, orally active and broad-spectrum 8-amino-fluoroquinolone with potent antibacterial activities. Antofloxacin shows superior antibacterial activity against gyrA mutation-positive H. pylori strains, especially in Asn87- mutated strains, compared to levofloxacin. Antofloxacin is a weak, reversible inhibitor of CYP1A2 for the research of infections caused by a diverse group of bacterial species.
  • HY-P1649B
    SPR741 acetate

    NAB741 acetate

    		 Bacterial Antibiotic Infection
    SPR741 acetate (NAB741 acetate) is a cationic peptide derived from polymyxin B and is a potentiator molecule. SPR741 acetate increases the permeability of the outer membrane of Gram-negative bacteria and is used to treat severe Gram-negative bacteria infections. SPR741 acetate inhibits multidrug-resistant Gram-negative bacteria. The spectrum of activity of the antibiotic can be widened when used in combination with SPR741 acetate.
  • HY-123319
    Antofloxacin hydrochloride

    		Bacterial Antibiotic Infection
    Antofloxacin hydrochloride is a well tolerate, orally active and broad-spectrum 8-amino-fluoroquinolone with potent antibacterial activities. Antofloxacin hydrochloride shows superior antibacterial activity against gyrA mutation-positive H. pylori strains, especially in Asn87- mutated strains, compared to levofloxacin. Antofloxacin hydrochloride is a weak, reversible inhibitor of CYP1A2 for the research of infections caused by a diverse group of bacterial species.
  • HY-122209
    DVR-01

    		HBV Infection
    DVR-01 is a HBV inhibitor with EC50 values of 1.7 and 1.6 μM in AML12HBV10 and HepDES19 cells, respectively. DVR-01 shows antiviral activity against drug-resistant HBV mutants with EC50s of 2.403-3.273 μM. DVR-01 can be used for the research of HBV infection and related diseases.
  • HY-17430S
    Amprenavir-d4

    		HIV HIV Protease SARS-CoV Infection Cancer
    Amprenavir-d4 is the deuterium labeled Amprenavir. Amprenavir (VX-478) is a HIV protease inhibitor (Ki=0.6 nM) used to treat HIV infection. Amprenavir is also a SARS-CoV 3CLpro inhibitor with an IC50 of 1.09 μM[1][2].
  • HY-103697
    Gardiquimod

    		Toll-like Receptor (TLR) HIV Cancer Infection
    Gardiquimod, an imidazoquinoline analog, is a TLR7/8 agonist. Gardiquimod could inhibit HIV-1 infection of macrophages and activated peripheral blood mononuclear cells (PBMCs). Gardiquimod specifically activates TLR7 when used at concentrations below 10 μM.
  • HY-122571
    Retro-2

    		Filovirus Parasite Autophagy Cancer Infection
    Retro-2 is a selective inhibitor of retrograde protein trafficking at the endosome-trans-Golgi network interface. Retro-2 is an ebolavirus (EBOV) infection inhibitor with an EC50 of 12.2 µM in HeLa cells. Retro-2 induces cell autophagy.
  • HY-14957AS
    Ozenoxacin-d3 hydrochloride

    T-3912-d3 (hydrochloride)

    		 Bacterial Antibiotic Inflammation/Immunology
    Ozenoxacin-d3 (hydrochloride) is the deuterium labeled Ozenoxacin hydrochloride. Ozenoxacin hydrochloride is a nonfluorinated quinolone antibacterial, which shows potent activities against the main microorganisms isolated from skin and soft tissue infections[1][2][3].
  • HY-125654
    Olanexidine

    		Bacterial Infection Inflammation/Immunology
    Olanexidine is an antibacterial agent. Olanexidine is active against a wide range of bacteria, imcluding both Gram-positive and Gram-negative bacteria Olanexidine is also an antiseptic. Olanexidine can be used in the research of infection and inflammation.
  • HY-145871
    BA38017

    		HBV Infection
    BA38017 is a potent HBV core protein assembly modulator. BA38017 inhibits HBV replication with an EC50 of 0.20 μM.
  • HY-U00124
    Tromantadine

    		HSV Infection
    Tromantadine hydrochloride, an Amantadine derivative with antiherpetic activity, inhibits herpes simplex virus type 1 (HSV-1) and HSV-2 replication.
  • HY-13998A
    Dasabuvir sodium

    ABT-333 sodium

    		 HCV DNA/RNA Synthesis Infection
    Dasabuvir (ABT-333) sodium is a nonnucleoside hepatitis C virus (HCV) polymerase inhibitor. Dasabuvir sodium inhibits RNA-dependent RNA polymerase encoded by the HCV NS5B gene. Dasabuvir sodium inhibits genotype 1a (strain H77) and 1b (strain Con1) replicons, with EC50 values of 7.7 and 1.8 nM, respectively.
  • HY-15899
    Des(benzylpyridyl) Atazanavir

    		HIV Protease HIV Drug Metabolite Infection
    Des(benzylpyridyl) Atazanavir (compound M1) is a N-dealkylation product of Atazanavir (HY-17367) metabolite. Atazanavir is a highly selective HIV-1 protease inhibitor. Des(benzylpyridyl) Atazanavir may contribute to the effectiveness Atazanavir but also to the toxicity and interactions. Des(benzylpyridyl) Atazanavir can be used for further research of Atazanavir effects.
  • HY-135221
    Cefcapene pivoxil hydrochloride

    		Bacterial Antibiotic Infection
    Cefcapene pivoxil hydrochloride, an antibiotic, is an orally active and potent 3rd-generation cephalosporin with a wide spectrum of anti-bacterial activity.Cefcapene pivoxil hydrochloride has the potential for the palmoplantar pustulosis (PPP) treatment.
  • HY-B1497
    Silver sulfadiazine

    AgSD

    		 Bacterial DNA/RNA Synthesis Antibiotic Infection
    Silver sulfadiazine (AgSD), a sulfonamide antibiotic, effects a dual inhibitory action on bacterial growth by its sulfa moiety (SD-SDZ) that prevents bacterial folate absorption and subsequent DNA synthesis. The silver that is released from Silver sulfadiazine binds and disrupts the DNA structure, precluding bacterial DNA replication.
  • HY-17395B
    Terbinafine lactate

    TDT 067 lactate

    		 Antibiotic Fungal Bacterial Infection
    Terbinafine lactate (TDT 067 lactate) is an orally active and potent antifungal agent. Terbinafine lactate is a potent non-competitive inhibitor of squalene epoxidase from Candida, with a Ki of 30 nM. Terbinafine lactate also shows antibacterial activity against certain Gram-positive and Gram-negative bacteria.
  • HY-13836
    ELQ-300

    		Parasite Infection
    ELQ-300 is a potent and orally bioavailable antimalarial agent, acts as an inhibitor of the reductive (Qi) site of the cytochrome bc1 complex (cyt bc1). ELQ-300 inhibits growth of P. falciparum Dd2, Tm90-C2B, and D1 with IC50 values of 6.6, 4.6 and 160 nM, respectively. ELQ-300 can be used for the research of antimalarial.
  • HY-19936A
    ACHN-975 TFA

    		Bacterial Infection
    ACHN-975 TFA is a selective LpxC inhibitor and exhibits a subnanomolar LpxC inhibitory activity. ACHN-975 TFA is against a wide range of gram-negative bacterias with low MIC values (≤1 μg/mL).
  • HY-17395
    Terbinafine hydrochloride

    TDT 067 hydrochloride

    		 Fungal Bacterial Antibiotic Infection
    Terbinafine hydrochloride (TDT 067 hydrochloride) is an orally active and potent antifungal agent. Terbinafine hydrochloride is a potent non-competitive inhibitor of squalene epoxidase from Candida, with a Ki of 30 nM. Terbinafine hydrochloride also shows antibacterial activity against certain Gram-positive and Gram-negative bacteria.
  • HY-D0976
    NF279

    		P2X Receptor HIV Infection
    NF279 is a potent selective and reversible P2X1 receptor antagonist, with an IC50 of 19 nM. NF279 displays good selectivity over P2X2, P2X3 (IC50=1.62 μM), P2X4 (IC50>300 μM). NF279 is a dual HIV-1 coreceptor inhibitor that interferes with the functional engagement of CCR5 and CXCR4 by Env.
  • HY-17395A
    Terbinafine

    TDT 067

    		 Fungal Bacterial Antibiotic Infection
    Terbinafine (TDT 067) is an orally active and potent antifungal agent. Terbinafine is a potent non-competitive inhibitor of squalene epoxidase from Candida, with a Ki of 30 nM. Terbinafine also shows antibacterial activity against certain Gram-positive and Gram-negative bacteria.
  • HY-U00124B
    Tromantadine hydrochloride

    		HSV Infection
    Tromantadine hydrochloride, an Amantadine derivative with antiherpetic activity, inhibits herpes simplex virus type 1 (HSV-1) and HSV-2 replication.
  • HY-119728
    FR198248

    		Influenza Virus Infection
    FR198248 is an anti-influenza agent and peptide deformylase (PDF) inhibitor. FR198248 can be isolated from Aspergillus flavipes. FR198248 potently inhibits the PDF of Staphylococcus aureus with an IC50 of 3.6 µM. FR198248 can be used for antiviral and antibacterial research.
  • HY-13998
    Dasabuvir

    ABT-333

    		 HCV DNA/RNA Synthesis Infection
    Dasabuvir (ABT-333) is a nonnucleoside hepatitis C virus (HCV) polymerase inhibitor. Dasabuvir inhibits RNA-dependent RNA polymerase encoded by the HCV NS5B gene. Dasabuvir inhibits genotype 1a (strain H77) and 1b (strain Con1) replicons, with EC50 values of 7.7 and 1.8 nM, respectively.
  • HY-151151
    Trypanothione synthetase-IN-3

    		Parasite Infection
    Trypanothione synthetase-IN-3 is a noncompetitive mixed hyperbolic Trypanothione synthetase (TryS) inhibitor (Ki: 0.8 μM). Trypanothione synthetase-IN-3 can be used in the study of parasites, such as L. infantum.
  • HY-136267
    HCV-IN-30

    		HCV Infection
    HCV-IN-30 (compound 48) is a HCV NS5A replication complex inhibitor, with IC50s of 901 and 102 nM for genotypes 1a and 1b replicons, respectively.
  • HY-W015591S
    Mandelic acid-2,3,4,5,6-d5

    (±)-Mandelic acid-2,3,4,5,6-d5; DL-Mandelic acid-2,3,4,5,6-d5

    		 Bacterial Endogenous Metabolite Infection
    Mandelic acid-2,3,4,5,6-d5 is the deuterium labeled Mandelic acid. Mandelic acid ((±)-Mandelic acid), an alpha-hydroxycarboxylic acid, has been widely used as an intermediate of pharmaceutical and fine chemicals. Mandelic acid shows antimicrobial activity and has been used for the research of urinary tract infections and vaginal trichomoniasis. Mandelic acid exhibits high sperm-immobilizing activity and low vaginal irritation[1][2].
  • HY-N1474
    Picfeltarraenin IA

    		Cholinesterase (ChE) Cancer Infection Inflammation/Immunology
    Picfeltarraenin IA, a triterpenoid obtained from Picriafel-terrae Lour (P.fel-terrae), is an acetylcholinesterase (AChE) inhibitor. Picfeltarraenin IA can be used for the treatment of herpes infections, cancer and inflammation.
  • HY-N5076
    Picfeltarraenin IV

    		Cholinesterase (ChE) Cancer Infection Inflammation/Immunology
    Picfeltarraenin IV, a triterpenoid obtained from Picriafel-terrae Lour (P.fel-terrae), is an acetylcholinesterase (AChE) inhibitor. Picfeltarraenin IV can be used for the treatment of herpes infections, cancer and inflammation.
  • HY-N2211
    Picfeltarraenin IB

    		Cholinesterase (ChE) Cancer Infection Inflammation/Immunology
    Picfeltarraenin IB, a triterpenoid obtained from Picriafel-terrae Lour (P.fel-terrae), is an acetylcholinesterase (AChE) inhibitor. Picfeltarraenin IB can be used for the treatment of herpes infections, cancer and inflammation.
  • HY-10367
    Canertinib

    CI-1033; PD-183805

    		 EGFR Orthopoxvirus Cancer Infection
    Canertinib (CI-1033;PD-183805) is a potent and irreversible EGFR inhibitor; inhibits cellular EGFR and ErbB2 autophosphorylation with IC50s of 7.4 and 9 nM. Canertinib is active against vaccinia virus respiratory infection in mice.
  • HY-A0032S
    Valganciclovir-d5 TFA

    		CMV
    Valganciclovir-d5 (TFA) is the deuterium labeled Valganciclovir TFA[1]. Valganciclovir, the L-valyl ester of ganciclovir, is actually a proagent for ganciclovir. Valganciclovir is an antiviral medication used to treat cytomegalovirus infections[2][3][4].
  • HY-113471A
    (S)-(-)-Perillic acid

    		Apoptosis Bacterial Cancer Infection
    (S)-(-)-Perillic acid is a terpenoid plant extract with antimicrobial and anticancer activities. (S)-(-)-Perillic acid induces cell apoptosis and cell cycle arrest, and increases the levell of Bax, Bcl2, p21 and caspase-3 proteins. (S)-(-)-Perillic acid can be used for cancer and infection research.
  • HY-104077S2
    Remdesivir impurity 9-d4

    		DNA/RNA Synthesis SARS-CoV Infection
    Remdesivir impurity 9-d4 is deuterium labeled Remdesivir. Remdesivir (GS-5734), a nucleoside analogue with effective antiviral activity, has EC50s of 74 nM for SARS-CoV and MERS-CoV in HAE cells, and 30 nM for murine hepatitis virus in delayed brain tumor cells. Remdesivir is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro[1][2].
  • HY-P1649A
    SPR741 TFA

    NAB741 TFA

    		 Bacterial Antibiotic Infection
    SPR741 TFA (NAB741 TFA) is a cationic peptide derived from polymyxin B and is a potentiator molecule. SPR741 TFA increases the permeability of the outer membrane of Gram-negative bacteria and is used to treat severe Gram-negative bacteria infections. SPR741 TFA inhibits multidrug-resistant Gram-negative bacteria. The spectrum of activity of the antibiotic can be widened when used in combination with SPR741 TFA.
  • HY-B0977
    Dicloxacillin Sodium hydrate

    Dicloxacillin sodium salt monohydrate

    		 Bacterial Antibiotic Infection Inflammation/Immunology
    Dicloxacillin Sodium hydrate (Dicloxacillin sodium salt monohydrate) is a narrow-spectrum β-Lactam antibiotic of the penicillin class, is used to treat infections caused by susceptible Gram-positive bacteria, active against beta-lactamase-producing organisms such as Staphylococcus aureus.
  • HY-103697A
    Gardiquimod diTFA

    		Toll-like Receptor (TLR) HIV Cancer Infection
    Gardiquimod diTFA, an imidazoquinoline analog, is a TLR7/8 agonist. Gardiquimod diTFA could inhibit HIV-1 infection of macrophages and activated peripheral blood mononuclear cells (PBMCs). Gardiquimod diTFA specifically activates TLR7 when used at concentrations below 10 μM.
  • HY-B0425A
    Novobiocin sodium

    Albamycin sodium; Cathomycin sodium

    		 Bacterial Antibiotic Orthopoxvirus Apoptosis DNA/RNA Synthesis HSP Infection Cancer
    Novobiocin (Albamycin) sodium is a potent and orally active antibiotic. Novobiocin sodium also is a DNA gyrase inhibitor and a heat shock protein 90 (Hsp90) antagonist. Novobiocin sodium has the potential for the research of highly beta-lactam-resistant pneumococcal infections. Novobiocin sodium shows anti-orthopoxvirus activity.
  • HY-147979
    CXCR4 antagonist 9

    		CXCR Cancer Infection
    CXCR4 antagonist 9 (Compound 2) is a CXCR4 antagonist with an IC50 of 15 nM. CXCR4 antagonist 9 inhibits CXCL12 induced cytosolic calcium increase with an IC50 of 1.3 nM.
  • HY-147978
    CXCR4 antagonist 8

    		CXCR Cancer Infection
    CXCR4 antagonist 8 (Compound 3) is a CXCR4 antagonist with an IC50 of 57 nM. CXCR4 antagonist 8 inhibits CXCL12 induced cytosolic calcium increase with an IC50 of 0.24 nM. CXCR4 antagonist 8 inhibits CXLC12/CXCR4 mediated cell migration.
  • HY-W009168
    Tazobactam sodium

    		Bacterial Antibiotic Infection Cancer
    Tazobactam sodium is an antibiotic of the beta-lactamase inhibitor class. Ceftolozane combines with Tazobactam, extends the activity of ceftolozane against many ESBL-producing Enterobacteriaceae and some Bacteroides spp..
  • HY-N0081
    (±)-Praeruptorin A

    		Calcium Channel Infection
    (±)-Praeruptorin A is the di-esterified product of cis-khellactone (CKL) and the major active ingredient in Peucedani Radix which consists of the dried roots of Peucedanum praeruptorumDunn (Apiaceae). (±)-Praeruptorin A has been widely employed as one of the famous traditional Chinese medicines (TCMs) for the treatment of cough with thick sputum and dyspnea, nonproductive cough and upper respiratory infections for centuries in China. (±)-Praeruptorin A has dramatically therapeutic effects on hypertension mainly through acting as a Ca 2+-influx blocker.
  • HY-143744
    Cap-dependent endonuclease-IN-3

    		Influenza Virus Infection
    Cap-dependent endonuclease-IN-3 is a potent inhibitor of cap-dependent endonuclease (CEN). Not only can Cap-dependent endonuclease-IN-3 inhibit influenza virus well, but also has lower cytotoxicity, better in vivo agent kinetic properties and in vivo pharmacodynamic properties. Cap-dependent endonuclease-IN-3 has the potential for the research of influenza A and influenza B infection (extracted from patent WO2019141179A1, compound VI-1).
  • HY-19727
    FOY 251 free base

    		Ser/Thr Protease SARS-CoV Infection Metabolic Disease
    FOY 251 free base, an anti-proteolytic active metabolite of Camostate (HY-13512), acts as a proteinase inhibitor. FOY 25 free base inhibits SARS-CoV-2 infection in cells assay.
  • HY-W031727S
    Hydroxychloroquine-d4-1 sulfate

    		Parasite Toll-like Receptor (TLR) SARS-CoV Autophagy Cancer Infection
    Hydroxychloroquine-d4-1 (sulfate) is the deuterium labeled Hydroxychloroquine. Hydroxychloroquine is a synthetic antimalarial agent which can also inhibit Toll-like receptor 7/9 (TLR7/9) signaling. Hydroxychloroquine is efficiently inhibits SARS-CoV-2 infection in vitro[1][2][3].
  • HY-B1150
    Clofoctol

    		Bacterial SARS-CoV Antibiotic Cancer Infection
    Clofoctol is a bacteriostatic antibiotic. Clofoctol is used in the treatment of respiratory tract and ear, nose and throat infections caused by Gram-positive bacteria. Clofoctol is only functional against Gram-positive bacteria and can penetrate into human lung tissue. Clofoctol is also an inhibitor of prostate cancer. Clofoctol has antiviral potency.
  • HY-B0425
    Novobiocin

    Albamycin; Cathomycin

    		 Antibiotic DNA/RNA Synthesis HSP Apoptosis Bacterial Orthopoxvirus Cancer Infection
    Novobiocin (Albamycin) is a potent and orally active antibiotic. Novobiocin also is a DNA gyrase inhibitor and a heat shock protein 90 (Hsp90) antagonist. Novobiocin has the potential for the research of highly beta-lactam-resistant pneumococcal infections. Novobiocin shows anti-orthopoxvirus activity.
  • HY-15287S
    Nelfinavir-d3

    		HIV Protease HIV Infection Cancer
    Nelfinavir-d3 (AG1341-d3) is the deuterium labeled Nelfinavir. Nelfinavir (AG-1341) is a potent and orally bioavailable HIV-1 protease inhibitor (Ki=2 nM) for HIV infection. Nelfinavir is a broad-spectrum, anticancer agent[1][2][3].
  • HY-145052
    HBV-IN-9

    		HBV Infection
    HBV-IN-9 is a potent HBsAg (HBV Surface antigen) inhibitor (IC50=10 nM) and HBV DNA production inhibitor (IC50=0.15 nM in HepG2.2.15 cells). From patent WO2018001952A1, example 20.
  • HY-136071
    QPX7728 methoxy acetoxy methy ester

    		Bacterial Infection
    QPX7728 methoxy acetoxy methy ester is a boronic acid β-lactamase inhibitor, exacted from WO2018005662A1, compound 43.
  • HY-147314
    HIV-IN-6

    		HIV Src Infection
    HIV-IN-6 is a HIV-Ⅰ viral replication inhibitor by targeting Src family kinases (SFK) that interact with Nef protein of the virus, such as Hck.
  • HY-136070
    QPX7728 bis-acetoxy methyl ester

    		Bacterial Infection
    QPX7728 bis-acetoxy methyl ester is a boronic acid β-lactamase inhibitor, exacted from WO2018005662A1, compound 42.
  • HY-144280
    MsbA-IN-2

    		Bacterial Infection
    MsbA-IN-2 (compound 12) is a potent lipopolysaccharide transporter MsbA inhibitor with an IC50 of 2 nM for E. coli MsbA.
  • HY-151551
    Mtb-cyt-bd oxidase-IN-4

    		Bacterial Infection
    Mtb-cyt-bd oxidase-IN-4 (compound 1g) is a Mycobacterium tuberculosis cytochrome bd oxidase (Mtb cyt-bd oxidase) inhibitor with an IC50 value of 0.25 μM. Mtb-cyt-bd oxidase-IN-4 inhibits the growth of Mycobacterium tuberculosis (MIC=8 μM). Mtb-cyt-bd oxidase-IN-4 can be used in tuberculosis research.
  • HY-117318
    PDE12-IN-1

    		Phosphodiesterase (PDE) Infection
    PDE12-IN-1 is a potent and selective PDE12 inhibitor with a pIC50 value for enzyme inhibition of 9.1. PDE12-IN-1 increases 2′,5′-linked adenylate polymers (2-5A) levels, and the pEC50 value is 7.7. PDE12-IN-1 shows antiviral activity.
  • HY-113074
    Glycolithocholic acid 3-sulfate

    Glycolithocholate sulfate; Sulfolithocholylglycine; SLCG

    		 HIV Endogenous Metabolite Infection Inflammation/Immunology
    Glycolithocholic acid 3-sulfate (SLCG) is a cholic acid derivative and a metabolite of glycolithocholic acid. Glycolithocholic acid 3-sulfate inhibits replication of HIV-1 in vitro. Glycolithocholic acid 3-sulfate can be used for the research of HIV infection and gallbladder disease.
  • HY-137522
    Zidovudine O-β-D-glucuronide sodium

    3'-Azido-3'-deoxythymidine β-D-glucuronide sodium

    		 Drug Metabolite Others
    Zidovudine O-β-D-glucuronide (3'-Azido-3'-deoxythymidine β-D-glucuronide) sodium is the major metabolite of Zidovudine. Zidovudine is a nucleoside reverse transcriptase inhibitor (NRTI), widely used to treat HIV infection.
  • HY-139597
    Temocillin disodium

    BRL 17421 disodium

    		 Bacterial Infection Inflammation/Immunology
    Temocillin disodium, a 6-α-methoxy penicillin, possesses antibacterial activity.
  • HY-12305
    Q-VD-OPh

    QVD-OPH; Quinoline-Val-Asp-Difluorophenoxymethylketone

    		 Caspase HIV Cancer Infection
    Q-VD-OPh is an irreversible pan-caspase inhibitor with potent antiapoptotic properties; inhibits caspase 7 with an IC50 of 48 nM and 25-400 nM for other caspases including caspase 1, 3, 8, 9, 10, and 12. Q-VD-OPh can inhibits HIV infection. Q-VD-OPh is able to cross the blood-brain barrier.
  • HY-B0497
    Niclosamide

    BAY2353

    		 STAT Parasite Antibiotic Infection Cancer
    Niclosamide (BAY2353) is an orally active antihelminthic agent used in parasitic infection research. Niclosamide is a STAT3 inhibitor with an IC50 of 0.25 μM in HeLa cells. Niclosamide has biological activities against cancer, inhibits DNA replication in Vero E6 cells.
  • HY-B0497A
    Niclosamide sodium

    BAY2353 sodium

    		 Antibiotic STAT Parasite Cancer Infection
    Niclosamide (BAY2353) sodium is an orally active antihelminthic agent used in parasitic infection research. Niclosamide sodium is a STAT3 inhibitor with an IC50 of 0.25 μM in HeLa cells. Niclosamide sodium has biological activities against cancer, and inhibits DNA replication in Vero E6 cells.
  • HY-B0497B
    Niclosamide monohydrate

    BAY2353 monohydrate

    		 STAT Antibiotic Parasite Cancer Infection
    Niclosamide (BAY2353) monohydrate is an orally active antihelminthic agent used in parasitic infection research. Niclosamide monohydrate is a STAT3 inhibitor with an IC50 of 0.25 μM in HeLa cells. Niclosamide monohydrate has biological activities against cancer, and inhibits DNA replication in Vero E6 cells.
  • HY-19915
    Contezolid

    MRX-I

    		 Bacterial Antibiotic Monoamine Oxidase Infection Inflammation/Immunology
    Contezolid (MRX-I), a new and orally active oxazolidinone, is an antibiotic in study for complicated skin and soft tissue infections (cSSTI) caused by resistant Gram-positive bacteria. Contezolid (MRX-I) markedly reduces potential for myelosuppression and monoamine oxidase inhibition (MAOI).
  • HY-124623
    DNDI-8219

    		Parasite Infection
    DNDI-8219 (compound 58) is a potent selective and orally active trypanocidal agent, possessing inhibitory activity against Trypanosoma cruzi (T.?cruzi) with an IC50 of 0.4 μM. DNDI-8219 has low cytotoxicity (L6 cells IC50 > 100 μM). DNDI-8219 can effectively cure chronic T.?cruzi infection and markedly reduce parasite burdens in mouse model. DNDI-8219 has good solubility, metabolic stability and safety.
  • HY-N1836
    3-Acetonyl-3-hydroxyoxindole

    3-Hydroxy-3-acetonyloxindole

    		 Others Infection
    3-Acetonyl-3-hydroxyoxindole (AHO) is a potent systemic acquired resistance (SAR) inducer in plants. 3-Acetonyl-3-hydroxyoxindole induces resistance in tobacco plants against infection with tobacco mosaic virus (TMV) and the fungal pathogen Erysiphe cichoracearum. 3-Acetonyl-3-hydroxyoxindole increases the level of pathogenesis-related gene 1 (PR-1) expression, salicylic acid (SA) accumulation and phenylalanine ammonia-lyase activity.
  • HY-120568
    M4284

    		Bacterial Infection Inflammation/Immunology
    M4284 is a selective and orally active biphenyl mannoside FimH antagonist. M4284 has activities against different UPEC (Urinary tract infections (UTI) caused by uropathogenic E. coli) strains in different host genetic backgrounds and gut microbial community contexts.
  • HY-P35433
    Tifuvirtide

    T-1249

    		 HIV Inflammation/Immunology
    Tifuvirtide (T-1249) is a peptide human immunodeficiency virus type-1 (HIV-1) fusion inhibitor. Tifuvirtide is a synthetically designed hybrid retroviral envelope polypeptide. Tifuvirtide has antiretroviral activity. Tifuvirtide can be used for the research of HIV infection.
  • HY-15356
    BIO-acetoxime

    BIA

    		 GSK-3 Apoptosis HSV Infection Inflammation/Immunology Neurological Disease
    BIO-acetoxime (BIA) is a potent and selective GSK-3 inhibitor, with IC50s of both 10 nM for GSK-3α/β. BIO-acetoxime has anticonvulsant and anti-infection activity.
  • HY-B1078
    Cefazolin sodium

    Cephazolin sodium

    		 Bacterial Antibiotic Infection Inflammation/Immunology Neurological Disease
    Cefazolin sodium is a first-generation cephalosporin antibiotic and can be used in varieties of bacterial infections research. Cefazolin sodium has anti-inflammatory effect and can attenuate post-operative cognitive dysfunction (POCD).
  • HY-B1370S
    Hydroxychloroquine-d4 sulfate

    HCQ-d4 (sulfate)

    		 Parasite Toll-like Receptor (TLR) SARS-CoV Autophagy Cancer Infection
    Hydroxychloroquine-d4 (sulfate) is the deuterium labeled Hydroxychloroquine sulfate. Hydroxychloroquine sulfate (HCQ sulfate) is a synthetic antimalarial agent which can also inhibit Toll-like receptor 7/9 (TLR7/9) signaling. Hydroxychloroquine sulfate is efficiently inhibits SARS-CoV-2 infection in vitro[1][2][3].
  • HY-B0497C
    Niclosamide olamine

    BAY2353 olamine

    		 STAT Parasite Antibiotic Cancer Infection
    Niclosamide (BAY2353) olamine is an orally active antihelminthic agent used in parasitic infection research. Niclosamide olamin is a STAT3 inhibitor with an IC50 of 0.25 μM in HeLa cells. Niclosamide olamin has biological activities against cancer, and inhibits DNA replication in Vero E6 cells.
  • HY-N0677
    Dehydroandrographolide succinate

    		Influenza Virus Infection Inflammation/Immunology Cancer
    Dehydroandrographolide succinate, extracted from herbal medicine Andrographis paniculata (Burm f) Nees, is widely used for the treatment of viral pneumonia and viral upper respiratory tract infections because of its immunostimulatory, anti-infective and anti-inflammatory effect.
  • HY-B1892
    Cefazolin

    Cephazolin

    		 Antibiotic Bacterial Infection Inflammation/Immunology Neurological Disease
    Cefazolin (Cephazolin) is a first-generation cephalosporin antibiotic and can be used in varieties of bacterial infections research. Cefazolin has anti-inflammatory effect and can attenuate post-operative cognitive dysfunction (POCD).
  • HY-100603
    GSK-F1

    		PI4K PI3K Infection
    GSK-F1 (Compound F1) is an orally active PI4KA inhibitor with pIC50 values of 8.0, 5.9, 5.8, 5.9, 5.9 and 6.4 against PI4KA, PI4KB, PI3KA, PI3KB, PI3KG and PI3KD, respectively. GSK-F1 can be used for HCV infection research.
  • HY-N4117
    Hamamelitannin

    		Bacterial Infection
    Hamamelitannin, a polyphenol extracted from the bark of Hamamelis virginiana, is a quorum-sensing (QS) inhibitor. Hamamelitannin increases antibiotic susceptibility of staphylococcus aureus biofilms by affecting peptidoglycan biosynthesis and eDNA release.
  • HY-146023
    Antifungal agent 27

    		Bacterial Fungal Infection
    Antifungal agent 27 (compound 7) is a antifungal agent. Antifungal agent 27 shows moderate antibacterial and weak antifungal activities against MRSA and C. albicans SS5314, with MIC values of 8 and 32 μg/mL, respectively.
  • HY-146024
    Antifungal agent 28

    		Fungal Infection
    Antifungal agent 28 (compound 18) is a potent and selective antifungal agent. Antifungal agent 28 inhibits pathogenic strains of C. albicans and non-albicans species including fluconazole-resistant strains. Antifungal agent 28 inhibits Cryptococcus and Aspergillus strains. Antifungal agent 28 disrupts mature Candida biofilm.
  • HY-B1147
    Diloxanide furoate

    		Parasite Infection
    Diloxanide furoate is the proagent of Diloxanide. Diloxanide furoate is a potent and orally active anti-protozoal agent and can be used for the research of amebiasis, mild intestinal amebiasis or asymptomatic cyst carriers.
  • HY-B2115
    Sulfogaiacol

    		Bacterial Inflammation/Immunology
    Sulfogaiacol is a antitussive agent. Sulfogaiacol is used for acute respiratory tract infections, cough and other conditions.
  • HY-19827
    Aeroplysinin 1

    (+)-Aeroplysinin-1

    		 Bacterial HIV Apoptosis Cancer Infection
    Aeroplysinin 1 ((+)-Aeroplysinin-1), a secondary metabolite isolated from marine sponges, shows potent antibiotic effects on Gram-positive bacteria and exerts antiviral activity against HIV-1 (IC50=14.6 μM). Aeroplysinin 1 has anti-inflammatory, anti-angiogenic and anti-tumor activities. Aeroplysinin 1 induces apoptosis in endothelial cells.
  • HY-P3601
    Brain Derived Basic Fibroblast Growth Factor (1-24)

    FGF basic (1-24)

    		 Bacterial HBV Infection Inflammation/Immunology
    Brain Derived Basic Fibroblast Growth Factor (1-24) (FGF basic 1-24) is a synthetic peptide, shows anti-bacterial and anti-HBV activities. Brain Derived Basic Fibroblast Growth Factor (1-24) can be used in infection disease and immune disease research.
  • HY-17422A
    Acyclovir sodium

    Aciclovir sodium; Acycloguanosine sodium

    		 HSV Apoptosis Antibiotic Bacterial Cancer Infection
    Acyclovir (Aciclovir) sodium is a potent, orally active antiviral agent. Acyclovir sodium has antiherpetic activity with IC50 values of 0.85 μM and 0.86 μM for HSV-1 and HSV-2, respectively. Acyclovir sodium induces cell cycle perturbation and apoptosis. Acyclovir sodium prevents bacterial infections during induction therapy for acute leukaemia.
  • HY-146413
    HF50731

    		CXCR HIV Cancer Infection
    HF50731 (compound 21) is a potent CXCR4 antagonist. HF50731 shows strong CXCR4 binding affinity, with IC50 of 19.8 nM. HF50731 effectively inhibits calcium mobilization, cell migration, and HIV-1 infection via CXCR4 coreceptor, with IC50 values of 119.2 nM, 621.4 nM and 1.5 μM.
  • HY-17422
    Acyclovir

    Aciclovir; Acycloguanosine

    		 HSV Apoptosis Antibiotic Bacterial Cancer Infection
    Acyclovir (Aciclovir) is a potent, orally active antiviral agent. Acyclovir has antiherpetic activity with IC50 values of 0.85 μM and 0.86 μM for HSV-1 and HSV-2, respectively. Acyclovir induces cell cycle perturbation and apoptosis. Acyclovir prevents bacterial infections during induction therapy for acute leukaemia.
  • HY-P2200
    Siamycin I

    BMY-29304

    		 HIV Antibiotic Infection Inflammation/Immunology
    Siamycin I (BMY-29304), a 21-residue tricyclic peptide, is a secondary metabolite in actinomycetes. Siamycin I is a HIV fusion inhibitor with ED50s of 0.05 to 5.7 μM for acute HIV type 1 (HIV-1) and HIV-2 infections. Siamycin I inhibits the gelatinase and gelatinase biosynthesis-activating pheromone (GBAP) signaling via the FsrC-FsrA two-component regulatory system in a noncompetitive manner. Siamycin I suppresses the expression of both fsrBDC and gelE-sprE transcripts. Siamycin I, a lasso peptide, interacts with lipid II and inhibits cell wall biosynthesis. Siamycin I, an antibiotic, has the potential for enterococcal infections research.
  • HY-113478S
    Ursodeoxycholic acid-2,2,4,4-d4

    		Isotope-Labeled Compounds Infection Metabolic Disease
    Ursodeoxycholic acid-2,2,4,4-d4 is the deuterium labeled Ursodeoxycholic acid (HY-13771). Ursodeoxycholic acid is a secondary bile acid issued from the transformation of (cheno)deoxycholic acid by intestinal bacteria, acting as a key regulator of the intestinal barrier integrity and essential for lipid metabolism. Ursodeoxycholic acid acts as signaling molecule, exerting its effects by interacting with bile acid activated receptors, including G-protein coupled bile acid receptor 5 (TGR5, GPCR19) and the farnesoid X receptor (FXR). Ursodeoxycholic acid can be used for the research of a variety of hepatic and gastrointestinal diseases. Ursodeoxycholic acid also reduces ACE2 expression and is beneficial for reducing SARS-CoV-2 infection[1][2][3][4][5].
  • HY-B0756
    Cefazolin sodium pentahydrate

    Cephazolin sodium pentahydrate

    		 Antibiotic Bacterial Infection Inflammation/Immunology Neurological Disease
    Cefazolin sodium pentahydrate is a first-generation cephalosporin antibiotic and can be used in varieties of bacterial infections research. Cefazolin sodium pentahydrate has anti-inflammatory effect and can attenuate post-operative cognitive dysfunction (POCD).
  • HY-14956
    Nemonoxacin

    TG-873870

    		 Antibiotic Bacterial Infection Inflammation/Immunology
    Nemonoxacin (TG-873870) is an orally active and potent broad-spectrum antibiotic. Nemonoxacin shows good inhibitory activity against different species of staphylococci, streptococci, and enterococci, Neisseria gonorrhoeae, and Haemophilus influenza. Nemonoxacin can be used in the study of bacterial infections and community-acquired pneumonia.
  • HY-19915B
    Contezolid acefosamil sodium

    MRX-4 sodium

    		 Bacterial Antibiotic Monoamine Oxidase Infection Inflammation/Immunology
    Contezolid acefosamil sodium (MRX-4), a new and orally active oxazolidinone, is an antibiotic in study for complicated skin and soft tissue infections (cSSTI) caused by resistant Gram-positive bacteria. Contezolid acefosamil sodium (MRX-4) markedly reduces potential for myelosuppression and monoamine oxidase inhibition (MAOI).
  • HY-100751
    N-563

    		Fungal Others
    N-563 is an analogue of deoxyspergualin with an immunostimulating activity,it promotes resistance to Candida albicans infection in mice.
  • HY-Y0493
    HODHBt

    HOOBt

    		 STAT HIV Cancer Infection
    HODHBt (HOOBt) inhibits STAT5-SUMO interaction by blocking SUMOylation of phosphorylated STAT5. HODHBt enhances the magnitude of IL-15 signaling and significantly increases the natural killer (NK) cell cytotoxicity phenotype and function and the generation of cytokine-induced memory-like (CIML) natural killer (NK) cells. HODHBt can be used for research of HIV-infection and cancer.
  • HY-147849
    JMI-105

    		Parasite Infection
    JMI-105 is a potent PfFP-2 (Plasmodium falciparum falcipain-2 protease) inhibitor. JMI-105 inhibits the growth of CQ S (3D7; IC50=8.8 µM) and CQ R (RKL-9; IC50=14.3 µM) strains of P. falciparum. JMI-105 significantly decreases parasitemia and prolonged host survival in a murine model with P. berghei ANKA infection. JMI-105 has the potential to be used as an anti-malarial agent.
  • HY-N1549
    Prunin

    Naringenin 7-0-glucoside

    		 Enterovirus Phosphatase Infection Metabolic Disease
    Prunin is a potent inhibitor of human enterovirus A71 (HEVA71). Prunin shows strong inhibitory activity against protein tyrosine phosphatase 1B (PTP1B), with an IC50 of 5.5 µM.
  • HY-P1180
    Pam3CSK4

    Pam3Cys-Ser-(Lys)4

    		 Toll-like Receptor (TLR) Infection Inflammation/Immunology
    Pam3CSK4 is a toll-like receptor 1/2 (TLR1/2) agonist with an EC50 of 0.47 ng/mL for human TLR1/2.
  • HY-P3466
    Nisin Z

    		Bacterial Fungal Infection Inflammation/Immunology
    Nisin Z is an antimicrobial and anti-inflammatory peptide. Nisin Z is effective against Gram-positive bacteria and fungi, such as C. albicans.
  • HY-P1405
    Pam3CSK4-Biotin

    Pam3Cys-Ser-(Lys)4-Biotin

    		 Toll-like Receptor (TLR) Infection Inflammation/Immunology
    Pam3CSK4-Biotin is biotinylated Pam3CSK4. Pam3CSK4-Biotin is a Toll-like receptor 1/2 (TLR1/2) agonist.
  • HY-B1599
    Chloramphenicol palmitate

    		Bacterial Antibiotic Infection
    Chloramphenicol palmitate is an orally active broad spectrum antibiotic and has a broad spectrum of activity against gram positive and gram negative bacteria. Chloramphenicol palmitate inhibits bacterial protein synthesis by blocking the peptidyl transferase step. Chloramphenicol palmitate can be used as bacterial selection agent in transformed cells containing chloramphenicol resistance genes.
  • HY-W041988
    Fmoc-Glu-OMe

    		Bacterial Infection
    Fmoc-Glu-OMe, a glutamic acid derivative, shows antibacterial activity and gelation property in AgNO3 solution. Fmoc-Glu-OMe is a mouldable wound healing biomaterial.
  • HY-136943
    K-41

    		Antibiotic Parasite Bacterial Infection
    K-41 is an orally active antibiotic. K-41 can be obtained from Streptomyces hygroscopicus. K-41 has antibacterial and antiplasmodial activity.
  • HY-144334
    CHIKV-IN-3

    		DNA/RNA Synthesis Infection
    CHIKV-IN-3 is a potent against two low-passage CHIKV inhibitor with EC50 values of 1.55 and 0.14 µM for CHIKV-122508 and CHIKV-6708, respectively. CHIKV-IN-3 acts on the host cells to interfere with the viral replication. CHIKV-IN-3 displays minimal cytotoxic liability(CC50 > 100 µM). Prophylactic effect.
  • HY-135853
    Molnupiravir

    EIDD-2801; MK-4482

    		 SARS-CoV Influenza Virus Infection
    Molnupiravir (EIDD-2801) is an orally bioavailable proagent of the ribonucleoside analog EIDD-1931. Molnupiravir has broad spectrum antiviral activity against influenza virus and multiple coronaviruses, such as SARS-CoV-2, MERS-CoV, SARS-CoV. Molnupiravir has the potential for the research of COVID-19, and seasonal and pandemic influenza.
  • HY-N0677A
    Kalii Dehydrographolidi Succinas

    Potassium dehydroandrographolide succinate

    		 Antibiotic Infection Inflammation/Immunology Cancer
    Kalii Dehydrographolidi Succinas (Potassium dehydroandrographolide succinate), extracted from herbal medicine Andrographis paniculata (Burm f) Nees, is widely used for the treatment of viral pneumonia and viral upper respiratory tract infections because of its immunostimulatory, anti-infective and anti-inflammatory effect.
  • HY-N0158
    Oxymatrine

    		TGF-beta/Smad Apoptosis Cancer Infection Inflammation/Immunology
    Oxymatrine, an alkaloid from Sophora flavescens Alt. with anti-inflammatory, antifibrosis, and antitumor effects, inhibits the iNOS expression and TGF-β/Smad pathway. Oxymatrine inhibits bocavirus minute virus of canines (MVC) replication, reduces viral gene expression and decreases apoptosis induced by viral infection.
  • HY-152254
    CB2R/FAAH modulator-3

    		FAAH Cannabinoid Receptor Cancer Infection Inflammation/Immunology Neurological Disease
    CB2R/FAAH modulator-3 (compound 27) is a dual targeting modulator that acts as a CB2R agonist and FAAH inhibitor. The Ki values for CB2R/FAAH modulator-3 are 20.1 and 67.6 nM for CB2R and CB1R, respectively, and the IC50 value for FAAH is 3.4 μM. CB2R/FAAH modulator-3 can be used in studies related to cancer, deleterious inflammatory cascades occurring in neurodegenerative diseases, and COVID-19 infection.
  • HY-152253
    CB2R/FAAH modulator-2

    		FAAH Cannabinoid Receptor Cancer Infection Inflammation/Immunology Neurological Disease
    CB2R/FAAH modulator-2 (compound 26) is a dual targeting modulator that acts as a CB2R agonist and FAAH inhibitor. The Ki values for CB2R/FAAH modulator-2 are 10.8 and 152.9 nM for CB2R and CB1R, respectively, and the IC50 value for FAAH is 6.2 μM. CB2R/FAAH modulator-2 can be used in studies related to cancer, deleterious inflammatory cascades occurring in neurodegenerative diseases, and COVID-19 infection.
  • HY-N7378A
    N-Hydroxypipecolic acid potassium

    1-Hydroxy-2-piperidinecarboxylic acid potassium; NHP potassium

    		 Bacterial Inflammation/Immunology
    N-Hydroxypipecolic acid potassium (1-Hydroxy-2-piperidinecarboxylic acid potassium), a plant metabolite and a systemic acquired resistance (SAR) regulator, orchestrates SAR establishment in concert with the immune signal salicylic acid. N-Hydroxypipecolic acid potassium accumulates systemically in the plant foliage in response to pathogen attack. N-Hydroxypipecolic acid potassium induces SAR to bacterial and oomycete infection.
  • HY-P2296
    Abz-FRLKGGAPIKGV-EDDNP TFA

    		Fluorescent Dye Others
    Abz-FRLKGGAPIKGV-EDDNP TFA is a fluorogenic substrate used to measure the enzymatic activities of protease forms, such as papain-like protease 2 (PLP2) from severe acute respiratory syndrome coronavirus (SARS-CoV). Abz-FRLKGGAPIKGV-EDDNP TFA has the potential for study 2019-nCoV (COVID-19) infection.
  • HY-N7378
    N-Hydroxypipecolic acid

    1-Hydroxy-2-piperidinecarboxylic acid; NHP

    		 Bacterial Inflammation/Immunology
    N-Hydroxypipecolic acid (1-Hydroxy-2-piperidinecarboxylic acid), a plant metabolite and a systemic acquired resistance (SAR) regulator, orchestrates SAR establishment in concert with the immune signal salicylic acid. N-Hydroxypipecolic acid accumulates systemically in the plant foliage in response to pathogen attack. N-Hydroxypipecolic acid induces SAR to bacterial and oomycete infection.
  • HY-17592
    Bithionol

    		Parasite Bacterial Cancer Infection
    Bithionol is an antibacterial, anthelmintic, and algaecide agent. Bithionol is also a potent inhibitor of soluble adenylyl cyclase through binding to the allosteric activator site (IC50: 4 μM).
  • HY-N4331
    Rivulariapeptolides 1185

    		Ser/Thr Protease Cancer Infection
    Rivulariapeptolides 1185 is a high potent and selective serine protease inhibitor with IC50 values of 13.17 nM, 23.59 nM and 55.26 nM for chymotrypsin, elastase and proteinase K, respectively.
  • HY-N4333
    Rivulariapeptolides 988

    		Ser/Thr Protease Cancer Infection
    Rivulariapeptolides 988 is a high potent and selective serine protease inhibitor with IC50 values of 95.46 nM, 15.29 nM and 85.50 nM for chymotrypsin, elastase and proteinase K, respectively.
  • HY-109195
    Vebicorvir

    ABI-H0731

    		 HBV Infection Inflammation/Immunology
    Vebicorvir (ABI-H0731) is a first-generation hepatitis B virus (HBV) core protein inhibitor. Vebicorvir (ABI-H0731) suppresses covalently closed circular DNA (cccDNA) formation in two de novo infection models with EC50s from 1.84 μM to 7.3 μM.
  • HY-15311
    Avermectin B1

    Abamectin; Avermectin B1a-Avermectin B1b mixt.

    		 Parasite Autophagy Apoptosis Reactive Oxygen Species Antibiotic Infection Inflammation/Immunology
    Avermectin B1 (Abamectin) is a mixture of two similar segments of avermectin. Avermectin B1 is an orally anti-infection agent, which can be used in the research of parasitic worms, insect pests, agriculture and animal husbandry. Avermectin B1 can also induce the production of ROS and induces cytotoxicity, apoptosis and autophagy.
  • HY-W094474
    Lithium chloride hydrate

    hydrate/monohydrateortrihydrate

    		 GSK-3 Apoptosis Infection Neurological Disease
    Lithium chloride hydrate, an orally active mood stabilizer, is a potent virus inhibitor and effective immunomodulatory agent. Lithium chloride hydrate has antidepressant activity by inhibiting GSK3β and promoting neurogenesis. Lithium chloride hydrate alleviates cognition dysfunction and the symptoms of acute mania and depression. Lithium chloride hydrate can also be used for research of virus infection and Alzheimer's disease.
  • HY-B0097
    Floxuridine

    5-Fluorouracil 2'-deoxyriboside

    		 Nucleoside Antimetabolite/Analog DNA/RNA Synthesis Bacterial CMV HSV Apoptosis Cancer Infection
    Floxuridine (5-Fluorouracil 2'-deoxyriboside) is a pyrimidine analog and known as an oncology antimetabolite. Floxuridine inhibits Poly(ADP-Ribose) polymerase and induces DNA damage by activating the ATM and ATR checkpoint signaling pathways in vitro. Floxuridine is a extreamly potent inhibitor for S. aureus infection and induces cell apoptosis. Floxuridine has antiviral effects against HSV and CMV.
  • HY-B1814
    Vitamin K5

    Synkamin; Synkamin base

    		 Pyruvate Kinase Bacterial Fungal Cancer Infection
    Vitamin K5 (Synkamin) is a photosensitizer and a antimicrobial agent. Vitamin K5 is a specific PKM2 inhibitor with IC50 values of 28, 191 and 120 μM for PKM2, PKM1 and PKL. Vitamin K5 induces apoptosis of colon 26 cells. Vitamin K5 can be used for the research of infection and cancer, and it also can be used as a preservative for pharmaceuticals, foods, and beverages.
  • HY-137565
    Hydroxy ritonavir

    		Drug Metabolite Others
    Hydroxy ritonavir is a metabolite of Ritonavir. Ritonavir is an inhibitor of HIV protease used to treat HIV infection and AIDS.
  • HY-P2251
    T-peptide

    		HIV Microtubule/Tubulin Cancer Infection Inflammation/Immunology
    T-peptide, a Tuftsin analog, can be used for the research of human immunodeficiency virus (HIV) infection. T-peptide prevents cellular immunosuppression and improves survival rate in septic mice. T-peptide also can inhibit the growth of residual tumor cells after surgical resection.
  • HY-120072
    PF-3450074

    PF-74

    		 HIV Infection
    PF-3450074 (PF-74) is a specifical inhibitor of HIV-1 capsid protein (CA) and displays a broad-spectrum inhibition of HIV isolates with submicromolar potency (EC50=8-640 nM). PF-3450074 (PF-74) acts at an early stage of HIV-1 infection, inhibits viral replication by directly competing with the binding of CPSF6 and NUP153, and blocks the uncoating, assembly, and the reverse transcription steps of the viral life cycle. CPSF6: nuclear host factors cleavage and polyadenylation specific factor 6; NUP153: nucleoporin 153.
  • HY-124662
    IHVR-19029

    		Glucosidase Infection
    IHVR-19029 is a potent endoplasmic reticulum (ER) α-glucosidases I and II inhibitor, with an IC50 of 0.48 μM for ER a-glucosidase I. IHVR-19029 efficiently blocks the replication of several hemorrhagic fever viruses, such as Dengue virus (DENV), Ebola virus (EBOV) and Rift Valley fever virus. The combination of IHVR-19029 with Favipiravir (HY-14768) improves the antiviral efficacy.
  • HY-150044
    Type II topoisomerase inhibitor 1

    		DNA/RNA Synthesis Topoisomerase Bacterial Infection
    Type II topoisomerase inhibitor 1 is a potent and selective E. coli DNA gyrase inhibitor (IC50: 1.7 nM), and forms hydrogen bonds with Asp73 residue. Type II topoisomerase inhibitor 1 inhibits topoisomerase IV activity (IC50: 0.98 μM). Type II topoisomerase inhibitor 1 can be used in the research of antibacterial area.
  • HY-B0519B
    Tylosin phosphate

    		Bacterial Antibiotic Infection
    Tylosin phosphate is a macrolide antibiotic found naturally as a fermentation product of Streptomyces fradiae. Tylosin tartrate exerts potent antimicrobial activity against Gram-positive bacteria. Tylosin phosphate is widely used as a feed additive for promoting animal growth. Tylosin phosphate is used for veterinary purposes against bacterial dysentery and respiratory diseases in poultry, pigs and cattle.
  • HY-B0519A
    Tylosin

    Tylosin A

    		 Bacterial Antibiotic Infection
    Tylosin (Tylosin A) is a macrolide antibiotic found naturally as a fermentation product of Streptomyces fradiae. Tylosin exerts potent antimicrobial activity against Gram-positive bacteria. Tylosin is widely used as a feed additive for promoting animal growth. Tylosin is used for veterinary purposes against bacterial dysentery and respiratory diseases in poultry, pigs and cattle.
  • HY-B0519
    Tylosin tartrate

    		Bacterial Antibiotic Infection
    Tylosin tartrate is a macrolide antibiotic found naturally as a fermentation product of Streptomyces fradiae. Tylosin tartrate exerts potent antimicrobial activity against Gram-positive bacteria. Tylosin tartrate is widely used as a feed additive for promoting animal growth. Tylosin tartrate is used for veterinary purposes against bacterial dysentery and respiratory diseases in poultry, pigs and cattle.
  • HY-B0307
    Idoxuridine

    5-Iodo-2′-deoxyuridine; 5-IUdR; IdUrd

    		 Phosphatase Orthopoxvirus Infection Cancer
    Idoxuridine (5-Iodo-2′-deoxyuridine, 5-IUdR, IdUrd) is an iodinated thymidine analogue that competitively inhibits phosphorylases. Idoxuridine can inhibit viral activity, particularly viral eye infections, including herpes simplex keratitis, by inhibiting DNA polymerase and affecting viral replication. Idoxuridine against feline herpesvirus has the IC50 value of 4.3 μM. Idoxuridine shows anti-orthopoxvirus activity.
  • HY-P2320
    IDR-1

    		Bacterial Infection Inflammation/Immunology
    IDR-1 is an antimicrobial peptide that is active against Gram-positive and Gram-negative bacteria. IDR-1 counters infection by selective modulation of innate immunity without obvious toxicities. IDR-1 has anti-inflammatory and anti-infective properties, enhances the levels of monocyte chemokines, and attenuates pro-inflammatory cytokine release.
  • HY-122920
    Soyasaponin II

    		HSV CMV Influenza Virus HIV NOD-like Receptor (NLR) YB-1 Infection Inflammation/Immunology
    Soyasaponin II is a saponin with antiviral activity. Soyasaponin II inhibits the replication of HSV-1, HCMV, influenza virus, and HIV-1. Soyasaponin II shows potent inhibition on HSV-1 replication. Soyasaponin II serves as a inhibitor for YB-1 phosphorylation and NLRP3 inflammasome priming and could protect mice against LPS/GalN induced acute liver failure.
  • HY-B1148
    Furaltadone hydrochloride

    Altafur hydrochloride

    		 Bacterial Inflammation/Immunology
    Furaltadone hydrochloride, a nitrofuran agent, has the potential for the study in infections of chickens with salmonella enteritidis. Furaltadone is inhibitory and bactericidal in vitro for staphylococci .
  • HY-151134
    HBV-IN-25

    		HBV Infection
    HBV-IN-25 is a good potency, orally active novel HBV cccDNA reducer. HBV-IN-25 has anti-HBeAg potency and anti-HBV activity with IC50 values of 0.58 μM and 1.15 μM, respectively. HBV-IN-25 has good aqueous solubility (LYSA＞452 μg/mL) and good PK property with no cellular toxicity.
  • HY-129047
    Trypsin

    		Ser/Thr Protease Protease Activated Receptor (PAR) Infection Inflammation/Immunology
    Trypsin is a serine protease enzyme, and hydrolyzes proteins at the carboxyl side of the Lysine or Arginine. Trypsin activates PAR2 and PAR4. Trypsin induces cell-to-cell membrane fusion in PDCoV infection by the interaction of S glycoprotein of PDCoV and pAPN. Trypsin also promotes cell proliferation and differentiation. Trypsin can be used in the research of wound healing and neurogenic inflammation.
  • HY-15654
    Sodium 4-phenylbutyrate

    4-PBA sodium; 4-Phenylbutyric acid sodium; Benzenebutyric acid sodium

    		 HDAC Autophagy Apoptosis Cancer
    Sodium 4-phenylbutyrate (4-PBA sodium) is an inhibitor of HDAC and endoplasmic reticulum (ER) stress, used in cancer and infection research.
  • HY-N0736
    Coptisine chloride

    		Indoleamine 2,3-Dioxygenase (IDO) Bacterial Influenza Virus Cancer Infection Metabolic Disease
    Coptisine chloride is an alkaloid from Chinese goldthread, and acts as an efficient uncompetitive IDO inhibitor with a Ki value of 5.8 μM and an IC50 value of 6.3 μM. Coptisine chloride is a potent H1N1 neuraminidase (NA-1) inhibitor with an IC50 of 104.6 μg/mL and can be used for influenza A (H1N1) infection.
  • HY-13560
    AVN-944

    VX-944

    		 Arenavirus DNA/RNA Synthesis Apoptosis Caspase Bcl-2 Family Cancer Infection
    AVN-944 (VX-944) is an orally active, potent, selective, noncompetitive and specific inhibitor of IMPDH (inosine monophosphate dehydrogenase). AVN-944 is an essential rate-limiting enzyme in de novo guanine nucleotide synthesis. AVN-944 is also an inhibitor of arenavirus RNA synthesis, and blocks arenavirus infection. AVN-944 has broad anti-cancer activities, and can be used for multiple myeloma (MM) and acute myeloid leukemia (AML) research.
  • HY-108307
    Micronomicin sulfate

    Gentamicin C2b sulfate; Antibiotic XK-62-2 sulfate; Sagamicin sulfate

    		 Antibiotic Bacterial Infection
    Micronomicin sulfate (Gentamicin C2b sulfate) is an aminoglycoside antibiotic isolated from Micromonospora. Micronomicin sulfate is a broad-spectrum antibiotic close to the gentamicin-type antibiotics, exhibits a high activity against Pseudomonas, Proteus, Klebsiella pneumoniae, Serratia, etc (MIC=0.001-8.3 μg/ml).
  • HY-110066
    (Z)-Guggulsterone

    		Apoptosis VEGFR Akt Angiotensin-converting Enzyme (ACE) SARS-CoV FXR Cancer
    (Z)-Guggulsterone, a constituent of Indian Ayurvedic medicinal plant Commiphora mukul, inhibits the growth of human prostate cancer cells by causing apoptosis. (Z)-Guggulsterone inhibits angiogenesis by suppressing the VEGF–VEGF-R2–Akt signaling axis. (Z)-Guggulsterone is also a potent FXR antagonist. (Z)-Guggulsterone reduces ACE2 expression and SARS-CoV-2 infection.
  • HY-107760
    Decanoyl-RVKR-CMK

    DecRVKRcmk

    		 HIV Infection Inflammation/Immunology
    Decanoyl-RVKR-CMK (DecRVKRcmk) inhibits over-expressed gp160 processing and HIV-1 replication.
  • HY-107760A
    Decanoyl-RVKR-CMK TFA

    DecRVKRcmk TFA

    		 HIV Infection Inflammation/Immunology
    Decanoyl-RVKR-CMK (DecRVKRcmk) TFA inhibits over-expressed gp160 processing and HIV-1 replication.
  • HY-109004A
    (S)-Enzaplatovir

    (S)-BTA-C585

    		 RSV Cancer
    (S)-Enzaplatovir ((S)-BTA-C585) is the S-enantiomer of Enzaplatovir. (S)-Enzaplatovir shows antiviral activities with an EC50 of 56 nM for respiratory syncytial viral (RSV) (patent WO2011094823A1 compound 77).
  • HY-17422S1
    Acyclovir-d4

    Aciclovir-d4; Acycloguanosine-d4

    		 HSV Bacterial Apoptosis Antibiotic Cancer Infection
    Acyclovir-d4 is the deuterium labeled Acyclovir. Acyclovir (Aciclovir) is a guanosine analogue and an orally active antiviral agent. Acyclovir inhibits HSV-1 (IC50 of 0.85 μM), HSV-2 (IC50 of 0.86 μM) and varicella-zoster virus. Acyclovir can be phosphorylated by viral thymidine kinase (TK), and Acyclovir triphosphate interferes with viral DNA polymerization through competitive inhibition with guanosine triphosphate and obligatory chain termination[1][2][3]. Acyclovir prevents bacterial infections during induction therapy for acute leukaemia[4].
  • HY-13062A
    Daunorubicin

    Daunomycin; RP 13057; Rubidomycin

    		 Topoisomerase DNA/RNA Synthesis ADC Cytotoxin Autophagy Bacterial Antibiotic Apoptosis Cancer Infection Neurological Disease
    Daunorubicin (Daunomycin) is a topoisomerase II inhibitor with potent anti-tumor activity. Daunorubicin inhibits DNA and RNA synthesis. Daunorubicin is a cytotoxin that inhibits cancer cell viability and induces apoptosis and necrosis. Daunorubicin is also an anthracycline antibiotic. Daunorubicin can be used in the research of infection and variety of cancers, including leukemia, non-Hodgkin lymphomas, Ewing's sarcoma, Wilms' tumor.
  • HY-13062
    Daunorubicin hydrochloride

    Daunomycin hydrochloride; RP 13057 hydrochloride; Rubidomycin hydrochloride

    		 Topoisomerase DNA/RNA Synthesis ADC Cytotoxin Bacterial Autophagy Apoptosis Antibiotic Cancer Infection Neurological Disease
    Daunorubicin (Daunomycin) hydrochloride is a topoisomerase II inhibitor with potent anti-tumor activity. Daunorubicin hydrochloride inhibits DNA and RNA synthesis. Daunorubicin hydrochloride is a cytotoxin that inhibits cancer cell viability and induces apoptosis and necrosis. Daunorubicin hydrochloride is also an anthracycline antibiotic. Daunorubicin hydrochloride can be used in the research of infection and variety of cancers, including leukemia, non-Hodgkin lymphomas, Ewing's sarcoma, Wilms' tumor.
  • HY-17589AS
    Chloroquine-d5

    		Parasite Autophagy SARS-CoV Toll-like Receptor (TLR) HIV Cancer Infection Inflammation/Immunology
    Chloroquine-d5 is deuterium labeled Chloroquine. Chloroquine is an antimalarial and anti-inflammatory agent widely used to treat malaria and rheumatoid arthritis. Chloroquine is an autophagy and toll-like receptors (TLRs) inhibitor. Chloroquine is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC50=1.13 μM)[1][2][3][4].
  • HY-17589S1
    Chloroquine-d4 phosphate

    		Parasite Autophagy SARS-CoV Toll-like Receptor (TLR) HIV Antibiotic Cancer Infection Inflammation/Immunology
    Chloroquine-d4 (phosphate) is the deuterium labeled Chloroquine phosphate. Chloroquine phosphate is an antimalarial and anti-inflammatory agent widely used to treat malaria and rheumatoid arthritis. Chloroquine phosphate is an autophagy and toll-like receptors (TLRs) inhibitor. Chloroquine phosphate is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC50=1.13 μM)[1][2][3][4].
  • HY-13718
    Oglufanide

    H-Glu-Trp-OH; L-Glutamyl-L-tryptophan

    		 VEGFR HCV Endogenous Metabolite Cancer Infection Inflammation/Immunology Cardiovascular Disease
    Oglufanide (H-Glu-Trp-OH) is a dipeptide immunomodulator isolated from calf thymus. Oglufanide inhibits vascular endothelial growth factor (VEGF). Oglufanide can stimulate the immune response to hepatitic C virus (HCV) and intracellular bacterial infections. Oglufanide shows antitumor and anti-angiogenesis activities.
  • HY-129047A
    Trypsin (MS grade)

    		Ser/Thr Protease Protease Activated Receptor (PAR) Infection Inflammation/Immunology
    Trypsin MS grade is a serine protease enzyme, and hydrolyzes proteins at the carboxyl side of the Lysine or Arginine. Trypsin MS grade activates PAR2 and PAR4. Trypsin MS grade induces cell-to-cell membrane fusion in PDCoV infection by the interaction of S glycoprotein of PDCoV and pAPN. Trypsin MS grade also promotes cell proliferation and differentiation. Trypsin MS grade can be used in the research of wound healing and neurogenic inflammation.
  • HY-B0985
    Phenazopyridine hydrochloride

    		Others Others
    Phenazopyridine hydrochloride is a chemical, which has a local analgesic effect, often used to alleviate the pain, irritation, discomfort, or urgency caused by urinary tract infections, surgery, or injury to the urinary tract.
  • HY-N2840
    Allitol

    Allodulcitol

    		 Others Cancer Metabolic Disease
    Allitol is a rare natural polyol that can be used as a sweetener. Allitol is an important intermediate for the preparation of the agents which against diabetes, cancer, and viral infections, including AIDS.
  • HY-16050
    Plitidepsin

    Aplidine; PM90001

    		 DNA/RNA Synthesis SARS-CoV Cancer Infection
    Plitidepsin (Aplidine) is a potent anti-cancer agent by targeting eEF1A2 ( KD=80 nM). Plitidepsin possesses antiviral activity and is against SARS-CoV-2 with an IC90 of 0.88 nM. Plitidepsin is usually used for multiple myeloma and advanced cancer research, and has the potential for COVID-19 research.
  • HY-17589S
    Chloroquine-d5 diphosphate

    		Parasite Autophagy SARS-CoV Toll-like Receptor (TLR) HIV Antibiotic Cancer Infection Inflammation/Immunology
    Chloroquine-d5 (diphosphate) is the deuterium labeled Chloroquine (phosphate). Chloroquine phosphate is an antimalarial and anti-inflammatory agent widely used to treat malaria and rheumatoid arthritis. Chloroquine phosphate is an autophagy and toll-like receptors (TLRs) inhibitor. Chloroquine phosphate is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC50=1.13 μM)[1][2][3][4].
  • HY-124042
    K6PC-5

    		SphK Filovirus Infection Inflammation/Immunology Neurological Disease
    K6PC-5, a ceramide derivative, is a sphingosine kinase 1(SPHK1) activator and elicites a rapid transient increase in intracellular calcium levels. K6PC-5 has the potential for skin diseases involving abnormal keratinocyte, and neurodegeneration and virus infection research.
  • HY-14648
    Dexamethasone

    Hexadecadrol; Prednisolone F

    		 Glucocorticoid Receptor SARS-CoV Autophagy Complement System Mitophagy Bacterial Antibiotic Cancer Infection Endocrinology Inflammation/Immunology
    Dexamethasone (Hexadecadrol) is a glucocorticoid receptor agonist. Dexamethasone also significantly decreases CD11b, CD18, and CD62L expression on neutrophils, and CD11b and CD18 expression on monocytes. Dexamethasone is highly effective in the control of COVID-19 infection. Dexamethasone inhibits production of exosomes containing inflammatory microRNA-155 in lipopolysaccharide-induced macrophage inflammatory responses.
  • HY-13735
    Quinacrine

    Acriquine

    		 Parasite Sodium Channel DNA Stain Apoptosis Cancer Infection Neurological Disease
    Quinacrine (Acriquine) is an antimalarial and anti-cancer agent. Quinacrine also inhibits human aldehyde oxidase (IC50: 3.3 μM). Quinacrine has affinity for nucleic acids, and stains DNA and RNA in fixed cells (Ex/Em: 436/525 nm).
  • HY-N0462
    Corilagin

    		Reverse Transcriptase Bacterial Apoptosis Autophagy Cancer Infection Inflammation/Immunology
    Corilagin, a gallotannin, has anti-tumor, anti-inflammatory and hepatoprotective activities. Corilagin inhibits activity of reverse transcriptase of RNA tumor viruses. Corilagin also inhibits the growth of Staphylococcus aureus with a MIC of 25 μg/mL. Corilagin shows anti-tumor activity on hepatocellular carcinoma and ovarian cancer model. Corilagin shows low toxicity to normal cells and tissues.
  • HY-108876
    Daunorubicin citrate

    Daunomycin(citrate); RP 13057(citrate); Rubidomycin(citrate)

    		 Topoisomerase DNA/RNA Synthesis ADC Cytotoxin Autophagy Bacterial Antibiotic Apoptosis Cancer Infection Neurological Disease
    Daunorubicin (Daunomycin) citrate is a topoisomerase II inhibitor with potent anti-tumor activity. Daunorubicin citrate inhibits DNA and RNA synthesis. Daunorubicin citrate is a cytotoxin that inhibits cancer cell viability and induces apoptosis and necrosis. Daunorubicin citrate is also an anthracycline antibiotic. Daunorubicin citrate can be used in the research of infection and variety of cancers, including leukemia, non-Hodgkin lymphomas, Ewing's sarcoma, Wilms' tumor.
  • HY-106934
    Peldesine

    BCX 34

    		 Nucleoside Antimetabolite/Analog HIV Cancer Infection Inflammation/Immunology
    Peldesine (BCX 34) is a potent, competitive, reversible and orally active purine nucleoside phosphorylase (PNP) inhibitor with IC50s of 36 nM, 5 nM, and 32 nM for human, rat, and mouse red blood cell (RBC) PNP, respectively. Peldesine is also a T-cell proliferation inhibitor with an IC50 of 800 nM. Peldesine has the potential for cutaneous T-cell lymphoma, psoriasis and HIV infection research.
  • HY-106934A
    Peldesine dihydrochloride

    BCX 34 dihydrochloride

    		 Nucleoside Antimetabolite/Analog HIV Cancer Infection Inflammation/Immunology
    Peldesine (BCX 34) dihydrochloride is a potent, competitive, reversible and orally active purine nucleoside phosphorylase (PNP) inhibitor with IC50s of 36 nM, 5 nM, and 32 nM for human, rat, and mouse red blood cell (RBC) PNP, respectively. Peldesine dihydrochloride is also a T-cell proliferation inhibitor with an IC50 of 800 nM. Peldesine dihydrochloride has the potential for cutaneous T-cell lymphoma, psoriasis and HIV infection research.
  • HY-B0985A
    Phenazopyridine

    		Others Others
    Phenazopyridine has a local analgesic effect on the urinary tract, often used to alleviate the pain, irritation, discomfort, or urgency caused by urinary tract infections, surgery, or injury to the urinary tract.
  • HY-78131C
    Ibuprofen sodium

    (±)-Ibuprofen sodium

    		 COX Apoptosis Parasite Cancer Infection Inflammation/Immunology Neurological Disease
    Ibuprofen ((±)-Ibuprofen) sodium is an orally active, selective COX-1 inhibitor with an IC50 value of 13 μM. Ibuprofen sodium inhibits cell proliferation, angiogenesis, and induces cell apoptosis. Ibuprofen sodium is a nonsteroidal anti-inflammatory agent and a nitric oxide (NO) donor. Ibuprofen sodium can be used in the research of pain, swelling, inflammation, infection, immunology, cancers.
  • HY-78131
    Ibuprofen

    (±)-Ibuprofen

    		 COX Apoptosis Parasite Cancer Infection Inflammation/Immunology Neurological Disease
    Ibuprofen ((±)-Ibuprofen) is a potent, orally active, selective COX-1 inhibitor with an IC50 value of 13 μM. Ibuprofen inhibits cell proliferation, angiogenesis, and induces cell apoptosis. Ibuprofen is a nonsteroidal anti-inflammatory agent and a nitric oxide (NO) donor. Ibuprofen ((±)-Ibuprofen) can be used in the research of pain, swelling, inflammation, infection, immunology, cancers.
  • HY-100586
    Ibuprofen L-lysine

    (±)-Ibuprofen L-lysine

    		 COX Apoptosis Parasite Cancer Infection Inflammation/Immunology
    Ibuprofen ((±)-Ibuprofen) L-lysine is a potent orally active, selective COX-1 inhibitor with an IC50 value of 13 μM. Ibuprofen L-lysine inhibits cell proliferation, angiogenesis, and induces cell apoptosis. Ibuprofen L-lysine is a nonsteroidal anti-inflammatory agent and a nitric oxide (NO) donor. Ibuprofen L-lysine can be used in the research of pain, swelling, inflammation, infection, immunology, cancers.
  • HY-18684
    SIBA

    5'-Isobutylthioadenosine; 5'-Deoxy-5'-isobutylthioadenosine

    		 Nucleoside Antimetabolite/Analog HSV Parasite Cancer Infection Metabolic Disease
    SIBA (5'-Isobutylthioadenosine) is a transmethylation inhibitor (SAH (HY-19528) analogue), with potent anti-proliferative activity. SIBA reversibly inhibits the production of HSV-1 by blocking methylation, specifically by blocking the 5' end-capping of viral mRNA. SIBA also inhibits the growth of tumour cells in vitro and metastatic spread in vivo. SIBA can be used in cancer, HSV-1 infection and anti-malaria studies.
  • HY-150509
    Apratoxin S4

    Apra S4

    		 Antibiotic Cancer Infection Cardiovascular Disease
    Apratoxin S4 (Apra S4) is a potent Sec61 inhibitor that prevents cotranslational translocation of secretory proteins into the endoplasmic reticulum (ER). Apratoxin S4 has antiviral effects against some flaviviruses with IC50 values ranging from 0.46 nM to 170 nM, and inhibits retinal vascular cell activation by suppressing multiple angiogenic pathways. Apratoxin S4 can be used for the research of viral infections, angiogenic diseases and cancers.
  • HY-N1487
    Oleanonic acid

    3-Oxooleanolic acid

    		 HIV Cancer
    Oleanonic acid (3-Oxooleanolic acid) is a triterpenoid, inhibits infection by HIV-1 in in vitro infected PBMC, naturally infected PBMC and monocyte/macrophages with EC50 of 22.7 mM, 24.6 mM and 57.4 mM, respectively.
  • HY-100083
    Dolutegravir intermediate-1

    		HIV Others
    Dolutegravir intermediate-1 is a synthetic intermediate of Dolutegravir extracted from patent WO 2016125192 A2. Dolutegravir is an integrase inhibitor developed for the treatment of human immunodeficiency virus (HIV)-1 infection.
  • HY-144639
    Carbonic anhydrase inhibitor 5

    		Carbonic Anhydrase Cancer Infection Inflammation/Immunology
    Carbonic anhydrase inhibitor 5 is a potent and selective human carbonic anhydrase (hCA) inhibitor with IC50s of 42.9, 47,6 and 6.7 nM for hCA II, hCA IX and hCA XII, respectively.
  • HY-15654S
    Phenylbutyrate-d11 sodium

    4-PBA-d11 (sodium); 4-Phenylbutyric acid-d11 (sodium); Benzenebutyric acid-d11 (sodium)

    		 HDAC Autophagy Apoptosis Cancer
    Phenylbutyrate-d11 (sodium) is deuterium labeled Sodium 4-phenylbutyrate. Sodium 4-phenylbutyrate (4-PBA sodium) is an inhibitor of HDAC and endoplasmic reticulum (ER) stress, used in cancer and infection research[1].
  • HY-144694
    HDAC/HSP90-IN-3

    		HSP HDAC Fungal Infection
    HDAC/HSP90-IN-3 (compound J5) is a potent and selective fungal Hsp90 and HDAC dual inhibitor, with IC50 values of 0.83 and 0.91 μM, respectively. HDAC/HSP90-IN-3 shows antifungal activity against azole resistant C. albicans. HDAC/HSP90-IN-3 can suppress important virulence factors and down-regulate drug-resistant genes ERG11 and CDR1.
  • HY-W352344
    2'-Deoxy-L-adenosine

    		HBV Infection
    2'-Deoxy-L-adenosine is an orally active synthon for modified oligodeoxyribonucleotides. 2'-Deoxy-L-adenosine is a potent, specific and selective inhibitor of the replication of hepatitis B virus (HBV) as well as the closely related duck and woodchuck hepatitis viruses (WHV).
  • HY-14648S2
    Dexamethasone-d4

    Hexadecadrol-d4; Prednisolone F-d4

    		 Glucocorticoid Receptor SARS-CoV Autophagy Complement System Mitophagy Bacterial Antibiotic Cancer Infection Endocrinology Inflammation/Immunology
    Dexamethasone-d4 is deuterium labeled Dexamethasone. Dexamethasone (Hexadecadrol) is a glucocorticoid receptor agonist. Dexamethasone also significantly decreases CD11b, CD18, and CD62L expression on neutrophils, and CD11b and CD18 expression on monocytes. Dexamethasone is highly effective in the control of COVID-19 infection. Dexamethasone inhibits production of exosomes containing inflammatory microRNA-155 in lipopolysaccharide-induced macrophage inflammatory responses.
  • HY-14648S1
    Dexamethasone-d5-1

    Hexadecadrol-d5-1; Prednisolone F-d5-1

    		 Glucocorticoid Receptor SARS-CoV Autophagy Complement System Mitophagy Bacterial Antibiotic Cancer Infection Endocrinology Inflammation/Immunology
    Dexamethasone-d5-1 is deuterium labeled Dexamethasone. Dexamethasone (Hexadecadrol) is a glucocorticoid receptor agonist. Dexamethasone also significantly decreases CD11b, CD18, and CD62L expression on neutrophils, and CD11b and CD18 expression on monocytes. Dexamethasone is highly effective in the control of COVID-19 infection. Dexamethasone inhibits production of exosomes containing inflammatory microRNA-155 in lipopolysaccharide-induced macrophage inflammatory responses.
  • HY-125445
    PCTR1

    		Others Inflammation/Immunology
    PCTR1 is a potent monocyte/macrophage agonist, regulating key anti-inflammatory and pro-resolving processes during bacterial infection. PCTR1 is a member of the protectin family of specialized pro-resolving mediators (SPMs).
  • HY-P2290
    Beta-defensin 1, pig

    		Bacterial Infection Inflammation/Immunology
    Beta-defensin 1, pig is an antimicrobial peptide found primarily in tongue mucosa of pig. Beta-defensin 1, pig is active against bacteria such as Escherichia coli, Salmonella typhimurium, Listeria monocytogenes, Staphylococcus aureus, Bordetella pertussis and Candida albicans.
  • HY-P2290A
    Beta-defensin 1, pig TFA

    		Bacterial Infection Inflammation/Immunology
    Beta-defensin 1, pig TFA is an antimicrobial peptide found primarily in tongue mucosa of pig. Beta-defensin 1, pig TFA is active against bacteria such as Escherichia coli, Salmonella typhimurium, Listeria monocytogenes, Staphylococcus aureus, Bordetella pertussis and Candida albicans.
  • HY-13637B
    Ganciclovir hydrate

    BW-759 hydrate; 2'-Nor-2'-deoxyguanosine hydrate

    		 CMV HSV Antibiotic Nucleoside Antimetabolite/Analog Cancer Infection
    Ganciclovir (BW 759) hydrate, a nucleoside analogue, is an orally active antiviral agent with activity against CMV. Ganciclovir hydrate also has activity in vitro against members of the herpes group and some other DNA viruses. Ganciclovir hydrate inhibits the in vitro replication of human herpes viruses (HSV 1 and 2, CMV) and adenovirus serotypes 1, 2, 4, 6, 8, 10, 19, 22 and 28. Ganciclovir hydrate has an IC50 of 5.2 μM for feline herpesvirus type-1 (FHV-1) and can diffuse into the brain.
  • HY-13637
    Ganciclovir

    BW 759; 2'-Nor-2'-deoxyguanosine

    		 CMV HSV Antibiotic Nucleoside Antimetabolite/Analog Infection Cancer
    Ganciclovir (BW 759), a nucleoside analogue, is an orally active antiviral agent with activity against CMV. Ganciclovir also has activity in vitro against members of the herpes group and some other DNA viruses. Ganciclovir inhibits the in vitro replication of human herpes viruses (HSV 1 and 2, CMV) and adenovirus serotypes 1, 2, 4, 6, 8, 10, 19, 22 and 28. Ganciclovir has an IC50 of 5.2 μM for feline herpesvirus type-1 (FHV-1) and can diffuse into the brain.
  • HY-13637A
    Ganciclovir sodium

    BW 759 sodium; 2'-Nor-2'-deoxyguanosine sodium

    		 CMV HSV Antibiotic Nucleoside Antimetabolite/Analog Infection Cancer
    Ganciclovir (BW 759) sodium, a nucleoside analogue, is an orally active antiviral agent with activity against CMV. Ganciclovir sodium also has activity in vitro against members of the herpes group and some other DNA viruses. Ganciclovir sodium inhibits the in vitro replication of human herpes viruses (HSV 1 and 2, CMV) and adenovirus serotypes 1, 2, 4, 6, 8, 10, 19, 22 and 28. Ganciclovir sodium has an IC50 of 5.2 μM for feline herpesvirus type-1 (FHV-1) and can diffuse into the brain.
  • HY-14648S
    Dexamethasone-d5

    Hexadecadrol-d5; Prednisolone F-d5

    		 Glucocorticoid Receptor SARS-CoV Autophagy Complement System Mitophagy Bacterial Antibiotic Cancer Infection Endocrinology Inflammation/Immunology
    Dexamethasone-d5 is the deuterium labeled Dexamethasone. Dexamethasone (Hexadecadrol) is a glucocorticoid receptor agonist. Dexamethasone also significantly decreases CD11b, CD18, and CD62L expression on neutrophils, and CD11b and CD18 expression on monocytes. Dexamethasone is highly effective in the control of COVID-19 infection. Dexamethasone inhibits production of exosomes containing inflammatory microRNA-155 in lipopolysaccharide-induced macrophage inflammatory responses[1][2].
  • HY-N2840S
    Allitol-13C

    Allodulcitol-13C

    		 Isotope-Labeled Compounds Cancer Metabolic Disease
    Allitol- 13C is the 13C labeled Allitol. Allitol is a rare natural polyol that can be used as a sweetener. Allitol is an important intermediate for the preparation of the agents which against diabetes, cancer, and viral infections, including AIDS[1]
  • HY-19727A
    FOY 251

    		Ser/Thr Protease SARS-CoV Metabolic Disease
    FOY 251, an anti-proteolytic active metabolite Camostate (HY-13512), acts as a proteinase inhibitor. FOY 251 inhibits SARS-CoV-2 infection in cells assay.
  • HY-A0061
    Trifluridine

    Trifluorothymidine; 5-Trifluorothymidine; TFT

    		 Thymidylate Synthase HSV Nucleoside Antimetabolite/Analog Orthopoxvirus Cancer
    Trifluridine (Trifluorothymidine; 5-Trifluorothymidine; TFT) is an irreversible thymidylate synthase inhibitor, and thereby suppresses DNA synthesis. Trifluridine is an antiviral agent for herpes simplex virus (HSV) infection. Trifluorothymidine also has anti-orthopoxvirus activity.
  • HY-A0281S3
    4-Phenylbutyric acid-d2

    4-PBA-d2; Benzenebutyric acid-d2

    		 HDAC Virus Protease
    4-Phenylbutyric acid-d2 is the deuterium labeled 4-Phenylbutyric acid[1]. 4-Phenylbutyric acid (4-PBA) is an inhibitor of HDAC and endoplasmic reticulum (ER) stress, used in cancer and infection research.
  • HY-10585
    Valproic acid

    VPA; 2-Propylpentanoic Acid

    		 HDAC Autophagy Mitophagy HIV Notch Apoptosis Endogenous Metabolite Cancer Infection Metabolic Disease Neurological Disease
    Valproic acid (VPA) is an orally active HDAC inhibitor, with IC50 in the range of 0.5 and 2 mM, also inhibits HDAC1 (IC50, 400 μM), and induces proteasomal degradation of HDAC2. Valproic acid activates Notch1 signaling and inhibits proliferation in small cell lung cancer (SCLC) cells. Valproic acid is used in the treatment of epilepsy, bipolar disorder, metabolic disease, HIV infection and prevention of migraine headaches.
  • HY-10585A
    Valproic acid sodium

    Sodium Valproate sodium

    		 HDAC Autophagy Mitophagy HIV Notch Apoptosis Endogenous Metabolite Cancer Infection Metabolic Disease Neurological Disease
    Valproic acid (Sodium Valproate) sodium is an orally active HDAC inhibitor, with IC50 in the range of 0.5 and 2 mM, also inhibits HDAC1 (IC50, 400 μM), and induces proteasomal degradation of HDAC2. Valproic acid sodium activates Notch1 signaling and inhibits proliferation in small cell lung cancer (SCLC) cells. Valproic acid sodium is used in the treatment of epilepsy, bipolar disorder, metabolic disease, HIV infection and prevention of migraine headaches.
  • HY-P3437
    Dabcyl-KTSAVLQSGFRKM-Glu(Edans)-NH2

    		Virus Protease Others
    Dabcyl-KTSAVLQSGFRKM-Glu(Edans)-NH2 is a fluorogenic peptide, as the substrate to measure the enzymatic activities of protease forms. Dabcyl-KTSAVLQSGFRKM-Glu(Edans)-NH2 can be used for researching 2019-nCoV (COVID-19) infection.
  • HY-103470
    K114

    		Fluorescent Dye Others
    K114, a fluorescent Congo Red analogue, binds tightly to amyloid fibrils with an EC50 of 20-30 nM. K114 is an efficient detector of semen-derived enhancer of virus infection (SEVI). Storage: protect from light.
  • HY-136266
    HCV-IN-29

    		HCV Cancer
    HCV-IN-29 is a hepatitis C virus (HCV) inhibitor exacted from patent US8329159B2, compound 1e.
  • HY-116146
    CYM50179

    		LPL Receptor Inflammation/Immunology
    CYM50179 (compound 22n) is a potent and selective S1P4-R (Sphingosine-1-phosphate4 receptor) agonist with an EC50 of 46 nM.
  • HY-123305S
    5-Hydroxymebendazole-d3

    		Isotope-Labeled Compounds Parasite Others
    5-Hydroxymebendazole-d3 is a deuterium labeled 5-Hydroxymebendazole. 5-Hydroxymebendazole is the one metabolite of Benzimidazoles[1].
  • HY-10585B
    Valproic acid (sodium)(2:1)

    VPA (sodium)(2:1); 2-Propylpentanoic Acid (sodium)(2:1)

    		 HDAC Autophagy Mitophagy HIV Notch Apoptosis Endogenous Metabolite Cancer Infection Metabolic Disease Neurological Disease
    Valproic acid (VPA) sodium (2:1) is an orally active HDAC inhibitor, with IC50 in the range of 0.5 and 2 mM, also inhibits HDAC1 (IC50, 400 μM), and induces proteasomal degradation of HDAC2. Valproic acid sodium (2:1) activates Notch1 signaling and inhibits proliferation in small cell lung cancer (SCLC) cells. Valproic acid sodium (2:1) is used in the treatment of epilepsy, bipolar disorder, metabolic disease, HIV infection and prevention of migraine headaches.
  • HY-105231
    Bryostatin 1

    		PKC HIV Bacterial Cancer Infection Inflammation/Immunology Neurological Disease
    Bryostatin 1 is a natural macrolide isolated from the bryozoan Bugula neritina and is a potent and central nervous system (CNS)-permeable PKC modulator. Bryostatin 1 binds to the isolated C1 domain of Munc13-1 and the full-length Munc13-1 protein with Kis of 8.07 nM and 0.45 nM, respectively. Bryostatin 1 has anti-cancer, anti-inflammatory, neuroprotective, anti-HIV-1 infection properties.
  • HY-105099
    Rifalazil

    KRM-1648; ABI-1648

    		 DNA/RNA Synthesis Bacterial Infection Inflammation/Immunology
    Rifalazil (KRM-1648; ABI-1648), a rifamycin derivative, inhibits the bacterial DNA-dependent RNA polymerase and kills bacterial cells by blocking off the β-subunit in RNA polymerase. Rifalazil (KRM-1648; ABI-1648) is an antibiotic, exhibits high potency against mycobacteria, gram-positive bacteria, Helicobacter pylori, C. pneumoniae and C. trachomatis with MIC values from 0.00025 to 0.0025 μg/ml. Rifalazil (KRM-1648; ABI-1648) has the potential for the treatment of Chlamydia infection, Clostridium difficile associated diarrhea (CDAD), and tuberculosis (TB).
  • HY-A0281S2
    4-Phenylbutyric acid-d5

    4-PBA-d5; Benzenebutyric acid-d5

    		 HDAC Virus Protease
    4-Phenylbutyric acid-d5 is the deuterium labeled 4-Phenylbutyric acid[1]. 4-Phenylbutyric acid (4-PBA) is an inhibitor of HDAC and endoplasmic reticulum (ER) stress, used in cancer and infection research[2][3][4].
  • HY-131263
    Hydroxychloroquine Impurity F

    		Drug Metabolite Others
    Hydroxychloroquine Impurity F is the impurity of Hydroxychloroquine. Hydroxychloroquine is a synthetic antimalarial agent which can also inhibit Toll-like receptor 7/9 (TLR7/9) signaling. Hydroxychloroquine is efficiently inhibits SARS-CoV-2 infection in vitro.
  • HY-131262
    Hydroxychloroquine Impurity E

    4-[(7-Chloro-4-quinolinyl)amino]-1-pentanol

    		 SARS-CoV Toll-like Receptor (TLR) Others
    Hydroxychloroquine Impurity E is the impurity of Hydroxychloroquine. Hydroxychloroquine is a synthetic antimalarial agent which can also inhibit Toll-like receptor 7/9 (TLR7/9) signaling. Hydroxychloroquine is efficiently inhibits SARS-CoV-2 infection in vitro.
  • HY-150741
    ODN 2216

    		Toll-like Receptor (TLR) IFNAR Interleukin Related Cancer Infection Inflammation/Immunology
    ODN 2216 is a human-specific TLR9 (toll-like receptor 9) ligand or agonist. ODN 2216 induces high amounts of IFN-α and IFN-β. ODN 2216 induces IFN-α by pDC (plasmacytoid DC) and IL-12 (p40) production by DC (dendritic cells). ODN 2216 stimulates IFN-γ production in peripheral blood mononuclear cells (PBMC), which is indirect and mediated by IFN-α/β. ODN 2216 can activate NK cells and promote IFN-γ production of TCR-triggered CD4 + T cells.
  • HY-Y1718S1
    Tridecanoic acid-d25

    N-Tridecanoic acid-d25

    		 Endogenous Metabolite Bacterial Cancer
    Tridecanoic acid-d25 is the deuterium labeled Tridecanoic acid. Tridecanoic acid (N-Tridecanoic acid), a 13-carbon medium-chain saturated fatty acid, can serve as an antipersister and antibiofilm agent that may be applied to research bacterial infections. Tridecanoic acid inhibits Escherichia coli persistence and biofilm formation[1].
  • HY-Y1718S
    Tridecanoic acid-d2

    N-Tridecanoic acid-d2

    		 Endogenous Metabolite Bacterial
    Tridecanoic acid-d2 is the deuterium labeled Tridecanoic acid. Tridecanoic acid (N-Tridecanoic acid), a 13-carbon medium-chain saturated fatty acid, can serve as an antipersister and antibiofilm agent that may be applied to research bacterial infections. Tridecanoic acid inhibits Escherichia coli persistence and biofilm formation[1].
  • HY-B0372A
    Bromhexine hydrochloride

    		SARS-CoV Autophagy HIV Metabolic Disease
    Bromhexine hydrochloride is a potent and specific TMPRSS2 protease inhibitor with an IC50 of 0.75 μM. Bromhexine hydrochloride can prevent and manage SARS-CoV-2 infection. Bromhexine hydrochloride is an autophagy agonist. Bromhexine hydrochloride is a mucolytic cough suppressant and has the potential for a range of respiratory conditions.
  • HY-Y1718S2
    Tridecanoic acid-d9

    N-Tridecanoic acid-d9

    		 Endogenous Metabolite Bacterial
    Tridecanoic acid-d9 is the deuterium labeled Tridecanoic acid. Tridecanoic acid (N-Tridecanoic acid), a 13-carbon medium-chain saturated fatty acid, can serve as an antipersister and antibiofilm agent that may be applied to research bacterial infections. Tridecanoic acid inhibits Escherichia coli persistence and biofilm formation[1].
  • HY-147089
    PRRSV/CD163-IN-1

    		Bacterial Endogenous Metabolite Infection Inflammation/Immunology
    PRRSV/CD163-IN-1 is a PRRSV/CD163 inhibitor. PRRSV/CD163-IN-1 can inhibit the interaction between the PRRSV glycoprotein (GP2a or GP4) and the CD163-SRCR5 domain. PRRSV/CD163-IN-1 can be used for the research of porcine reproductive and respiratory syndrome (PRRS) .
  • HY-W031727S1
    Hydroxychloroquine-d5

    		Autophagy SARS-CoV Toll-like Receptor (TLR) Parasite
    Hydroxychloroquine-d5 is the deuterium labeled Hydroxychloroquine[1]. Hydroxychloroquine is a synthetic antimalarial agent which can also inhibit Toll-like receptor 7/9 (TLR7/9) signaling. Hydroxychloroquine is efficiently inhibits SARS-CoV-2 infection in vitro[2][3][4].
  • HY-143563
    NLRP3 antagonist 1

    		NOD-like Receptor (NLR) Cancer
    NLRP3 antagonist 1 is a potent antagonist of NLRP3. NLRP3 is mainly expressed in macrophages and neutrophils and is involved in the body's intrinsic immunity against pathogenic infections and stress injury. NLRP3 antagonist 1 has the potential for the research of cancer disease (extracted from patent WO2021114691A1, compound 3).
  • HY-15034
    Indomethacin sodium

    Indometacin sodium

    		 COX Antibiotic Influenza Virus Bacterial Cancer Inflammation/Immunology
    Indomethacin (Indometacin) sodium is a potent, orally active COX1/2 inhibitor with IC50 values of 18 nM and 26 nM for COX-1 and COX-2, respectively. Indomethacin sodium has anticancer activity and anti-infective activity. Indomethacin sodium can be used for cancer, inflammation and viral infection research..
  • HY-14397
    Indomethacin

    Indometacin

    		 COX Antibiotic Influenza Virus Bacterial Cancer Inflammation/Immunology
    Indomethacin (Indometacin) is a potent, orally active COX1/2 inhibitor with IC50 values of 18 nM and 26 nM for COX-1 and COX-2, respectively. Indomethacin has anticancer activity and anti-infective activity. Indomethacin can be used for cancer, inflammation and viral infection research.
  • HY-14397A
    Indomethacin sodium hydrate

    Indometacin sodium hydrate

    		 COX Bacterial Influenza Virus Antibiotic Cancer Inflammation/Immunology
    Indomethacin (Indometacin) sodium hydrateis a potent, orally active COX1/2 inhibitor with IC50 values of 18 nM and 26 nM for COX-1 and COX-2, respectively. Indomethacin sodium hydrateis has anticancer activity and anti-infective activity. Indomethacin sodium hydrateis can be used for cancer, inflammation and viral infection research.
  • HY-A0061S
    Trifluridine-13C,15N2

    Trifluorothymidine-13C,15N2; 5-Tri