2. Search Result
Search Result
Results for "

m5C

" in MedChemExpress (MCE) Product Catalog:

22

Inhibitors & Agonists

1

Natural
Products

22

Oligonucleotides

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-112980
    Nusinersen
    4 Publications Verification

    		 DNA/RNA Synthesis Neurological Disease
    Nusinersen is an antisense oligonucleotide active molecule. Nusinersen modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen improves spinal muscular atrophy .
    Nusinersen
  • HY-108764
    Mipomersen sodium
    2 Publications Verification

    ISIS 301012

    		 Apolipoprotein HCV Metabolic Disease
    Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
    Mipomersen sodium
  • HY-132580
    Tofersen
    2 Publications Verification

    BIIB067; ISIS-SOD1Rx; ISIS 333611

    		 SOD Neurological Disease
    Tofersen (BIIB067) is an antisense oligonucleotide and SOD1 mRNA inhibitor with an IC50 of 320 pM. Tofersen mediates RNase H-dependent degradation of SOD1 mRNA to reduce SOD1 protein levels in cerebrospinal fluid and serum. Tofersen downregulates cerebrospinal fluid neurofilament light chain, neurofilament heavy chain, amyloid-beta 1-40, amyloid-beta 1-42, neuropeptide Y, ubiquitin C-terminal hydrolase L1, neuropentraxins 1, 2, R, corticotropin-releasing hormone, IL-15, and serum neurofilament light chain, neurofilament heavy chain. Tofersen can be used for the research of superoxide dismutase 1-associated amyotrophic lateral sclerosis [5] .
    Tofersen
  • HY-132608
    Inotersen sodium

    ISIS-420915 sodium

    		 Transthyretin (TTR) Neurological Disease
    Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
    Inotersen sodium
  • HY-147217
    Bepirovirsen

    ISIS 505358

    		 HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-148089
    Eplontersen
    1 Publications Verification

    		 Transthyretin (TTR) Neurological Disease
    Eplontersen is a triantennary N-acetyl galactosamine (GalNAc3-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases .
    Eplontersen
  • HY-145722
    Apatorsen sodium
    1 Publications Verification

    OGX-427 sodium

    		 HSP Cancer
    Apatorsen (OGX-427) sodium is a 2'-methoxyethyl-modified antisense oligonucleotide and also a Hsp27 inhibitor. Apatorsen sodium reduces Hsp27 mRNA and protein levels, impairs stress-induced cytoprotective functions, induces cell apoptosis, inhibits tumor growth and prevents metastasis. Apatorsen sodium is applicable to research related to non-small cell lung cancer, castration-resistant prostate cancer, breast cancer, ovarian cancer and bladder cancer .
    Apatorsen sodium
  • HY-147410
    Ulefnersen
    1 Publications Verification

    ION-363

    		 DNA/RNA Synthesis Neurological Disease
    Ulefnersen (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
    Ulefnersen
  • HY-145729
    Danvatirsen

    AZD9150

    		 STAT Apoptosis Cancer
    Danvatirsen (AZD9150) is an antisense oligonucleotide targeting STAT3. Danvatirsen reduces the viability and promotes apoptosis of leukemia cell lines. Danvatirsen inhibits the expression of endogenous STAT3 and its downstream target genes, and reduces the proliferation and tumorigenicity of neuroblastoma and lymphoma cells. Danvatirsen inhibited tumor growth in mouse models of neuroblastoma, lymphoma, and non-small cell lung cancer. Danvatirsen achieves STAT3 mRNA and protein depletion in a mouse model of epidermoid carcinoma. Danvatirsen can be used in research related to lymphoma, myelodysplastic syndrome, acute myeloid leukemia, neuroblastoma and non-small cell lung cancer .
    Danvatirsen
  • HY-145727
    Volanesorsen

    ISIS 304801

    		 Apolipoprotein Endocrinology
    Volanesorsen (ISIS 304801) is an antisense oligonucleotide inhibitor of apolipoprotein CIII (apo-CIII) mRNA that reduces triglyceride levels and improves insulin resistance. Volanesorsen is being studied in the treatment of hypertriglyceridemia, familial chylosiderosis syndrome, and type 2 diabetes [5].
    Volanesorsen
  • HY-145725A
    Baliforsen

    ISIS 598769; IONIS 598769; BIIB 065; ISIS-DMPK-2.5Rx

    		 Ser/Thr Kinase Neurological Disease
    Baliforsen (ISIS 5987690) is an antisense oligonucleotide (ASO) that inhibits DMPK mRNA. Baliforsen binds within exon 9 of the human DMPK transcript to promote RNase H1-mediated degradation Baliforsen can be used for the research of myotonic dystrophy type 1 .
    Baliforsen
  • HY-132579
    Tominersen

    RG6042; IONIS-HTTRx

    		 Huntingtin Neurological Disease
    Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD) .
    Tominersen
  • HY-145722A
    Apatorsen
    1 Publications Verification

    OGX-427

    		 HSP Cancer
    Apatorsen is a 2'-methoxyethyl-modified antisense oligonucleotide and also a Hsp27 inhibitor. Apatorsen reduces Hsp27 mRNA and protein levels, impairs stress-induced cytoprotective functions, induces cell apoptosis, inhibits tumor growth and prevents metastasis. Apatorsen is applicable to research related to non-small cell lung cancer, castration-resistant prostate cancer, breast cancer, ovarian cancer and bladder cancer .
    Apatorsen
  • HY-147412
    Ultevursen

    QR-421a

    		 Nucleoside Antimetabolite/Analog DNA/RNA Synthesis Neurological Disease
    Ultevursen (QR-421a) is a splice-modulating antisense oligonucleotide targeting exon 13 of the USH2A gene, which restores the functional expression of Usherin protein by inducing exon skipping. Ultevursen binds to USH2A pre-mRNA and modulates the splicing process to specifically skip exon 13 carrying the pathogenic mutation c.2299delG, generating an in-frame transcript and a truncated yet functionally normal protein. Ultevursen exhibits concentration-dependent exon skipping activity in human cells and retinal organoid models, and restores Usherin expression and retinal function in zebrafish and gene-edited mouse models. Ultevursen can be used for related research on type 2 Usher syndrome and non-syndromic retinitis pigmentosa .
    Ultevursen
  • HY-175594
    DNMT2-IN-2

    		DNA Methyltransferase Cancer
    DNMT2-IN-2 is a selective DNA methyltransferase 2 (DNMT2) inhibitor with a KD value of 3.04 μM. DNMT2-IN-2 targets to a cryptic allosteric binding site of DNMT2. DNMT2-IN-2 reduces m5C levels in MOLM-13 tRNA and synergizes with Doxorubicin (HY-15142A) to impair cell viability. DNMT2-IN-2 can be used for cancer research, such as cervical cancer and leukemia .
    DNMT2-IN-2
  • HY-145721
    Mongersen

    GED-0301

    		 TGF-beta/Smad Inflammation/Immunology
    Mongersen (GED-0301) is a specific and orally active SMAD7 antisense oligonucleotide. Mongersen restores TGF-β1 activity leading to inhibition of inflammatory signals. Mongersen can attenuate Crohn's disease-like experimental colitis in mice .
    Mongersen
  • HY-151123
    Pelacarsen

    AKCEA-APO(a)-LRx; ISIS 681257; TQJ230

    		 Apolipoprotein DNA/RNA Synthesis Metabolic Disease
    Pelacarsen (ISIS 681257) is a GalNAc3-conjugated 2′-MOE-modified antisense oligonucleotide. Pelacarsen reduces apo (a) .
    Pelacarsen
  • HY-132598
    Miravirsen

    SPC-3649

    		 MicroRNA HCV Infection Inflammation/Immunology
    Miravirsen (SPC-3649) is a potent miR-122 inhibitor and inhibits the biogenesis of miR-122. Miravirsen is a 15-nucleotide locked nucleic acid-modified phosphorothioate antisense oligonucleotide. Miravirsen inhibits HCV replication. Miravirsen can be used in research of HCV infection .
    Miravirsen
  • HY-132601
    Cobomarsen

    MRG-106

    		 MicroRNA Cancer
    Cobomarsen (MRG-106) is an oligonucleotide inhibitor of miR-155. Cobomarsen inhibits multiple gene pathways associated with cell survival (including JAK/STAT, MAPK/ERK and PI3K/AKT). Cobomarsen can be used for the research of B-cell lymphoma .
    Cobomarsen
  • HY-147406
    Tonlamarsen

    ION-904

    		 Endogenous Metabolite Cardiovascular Disease
    Tonlamarsen is a angiotensinogen synthesis reducer, with antihypertensive activity .
    Tonlamarsen
  • HY-147267
    Evazarsen

    ISIS-757456

    		 Angiotensin Receptor Cardiovascular Disease Endocrinology
    Evazarsen is an angiotensinogen synthesis inhibitor and possesses antihypertensive properties .
    Evazarsen
  • HY-147252
    Bezeparsen

    		PCSK9 Metabolic Disease
    Bezeparsen is a PCSK9 synthesis inhibitor .
    Bezeparsen

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

  

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

  

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: