1. Search Result
Search Result
Results for "

messenger

" in MedChemExpress (MCE) Product Catalog:

56

Inhibitors & Agonists

4

Screening Libraries

7

Biochemical Assay Reagents

2

Peptides

19

Natural
Products

4

Isotope-Labeled Compounds

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-151507

    Liposome Others
    306Oi10 is a branched-chain ionizable lipidoid that can be used for constructing lipid nanoparticles (LNPs) for the delivery of messenger RNA .
    306Oi10
  • HY-147217A

    ISIS 505358 sodium

    HBV Infection
    Bepirovirsen sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-B1511
    Cyclic AMP
    5+ Cited Publications

    Cyclic adenosine monophosphate; Adenosine cyclic 3', 5'-monophosphate; cAMP

    Endogenous Metabolite Neurological Disease Metabolic Disease Cancer
    Cyclic AMP (Cyclic adenosine monophosphate), adenosine triphosphate derivative, is an intracellular signaling molecule responsible for directing cellular responses to extracellular signals. Cyclic AMP is an important second messenger in many biological processes .
    Cyclic AMP
  • HY-B1511A
    Cyclic AMP sodium
    5+ Cited Publications

    Cyclic adenosine monophosphate sodium; Adenosine cyclic 3', 5'-monophosphate sodium; cAMP sodium; Cyclic AMP sodium

    Biochemical Assay Reagents Neurological Disease Metabolic Disease Cancer
    Cyclic AMP (Cyclic adenosine monophosphate) sodium, adenosine triphosphate derivative, is an intracellular signaling molecule responsible for directing cellular responses to extracellular signals. Cyclic AMP sodium is an important second messenger in many biological processes .
    Cyclic AMP sodium
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-12512
    cGAMP
    Maximum Cited Publications
    7 Publications Verification

    Cyclic GMP-AMP; 3',3'-cGAMP

    STING Inflammation/Immunology
    cGAMP (Cyclic GMP-AMPP) functions as an endogenous second messenger in metazoans and triggers interferon production in response to cytosolic DNA. cGAMP activates stimulator of interferon genes (STING), which activates a signaling cascade leading to the production of type I interferons and other immune mediators .
    cGAMP
  • HY-110385
    cGAMP disodium
    Maximum Cited Publications
    7 Publications Verification

    Cyclic GMP-AMP disodium; 3',3'-cGAMP disodium

    STING Endogenous Metabolite Inflammation/Immunology
    cGAMP (Cyclic GMP-AMPP) disodium functions as an endogenous second messenger in metazoans and triggers interferon production in response to cytosolic DNA. cGAMP diammonium activates stimulator of interferon genes (STING), which activates a signaling cascade leading to the production of type I interferons and other immune mediators .
    cGAMP disodium
  • HY-110385A
    cGAMP diammonium
    Maximum Cited Publications
    7 Publications Verification

    Cyclic GMP-AMP diammonium; 3',3'-cGAMP diammonium

    STING Endogenous Metabolite Inflammation/Immunology
    cGAMP (Cyclic GMP-AMPP) diammonium functions as an endogenous second messenger in metazoans and triggers interferon production in response to cytosolic DNA. cGAMP diammonium activates stimulator of interferon genes (STING), which activates a signaling cascade leading to the production of type I interferons and other immune mediators .
    cGAMP diammonium
  • HY-N7395

    cADPR

    Calcium Channel TRP Channel Endogenous Metabolite Infection Cardiovascular Disease Neurological Disease Inflammation/Immunology Endocrinology
    Cyclic ADP-ribose (cADPR) is a potent second messenger for calcium mobilization that is synthesized from NAD + by an ADP-ribosyl cyclase. Cyclic ADP-ribose increases cytosolic calcium mainly by Ryanodine receptor-mediated release from endoplasmic reticulum and also by extracellular influx through the opening of TRPM2 channels .
    Cyclic ADP-​ribose
  • HY-N7395A

    cADPR ammonium

    Calcium Channel TRP Channel Endogenous Metabolite Infection Cardiovascular Disease Neurological Disease Inflammation/Immunology Endocrinology
    Cyclic ADP-ribose ammonium (cADPR ammonium) is a potent second messenger for calcium mobilization that is synthesized from NAD + by an ADP-ribosyl cyclase. Cyclic ADP-ribose ammonium increases cytosolic calcium mainly by Ryanodine receptor-mediated release from endoplasmic reticulum and also by extracellular influx through the opening of TRPM2 channels .
    Cyclic ADP-​ribose ammonium
  • HY-W010410

    Others Neurological Disease Metabolic Disease
    Oct-1-en-3-ol, a fatty acid fragrant, is a self-stimulating oxylipin messenger. Oct-1-en-3-ol serves as a signaling molecule in plant cellular responses, plant-herbivore interactions, and plant-plant interactions. Oct-1-en-3-ol causes dopamine neuron degeneration through disruption of dopamine handling .
    Oct-1-en-3-ol
  • HY-108496
    Sphingosine-1-phosphate
    5 Publications Verification

    S1P

    Endogenous Metabolite LPL Receptor Endocrinology
    Sphingosine-1-phosphate (S1P) is an agonist of S1P1-5 receptors and a ligand of GPR3, GPR6 and GPR12. Sphingosine-1-phosphate is an intracellular second messenger and mobilizes Ca 2+ as an extracellular ligand for G protein-coupled receptors . Sphingosine-1-phosphate is an important lipid mediator generated from Sphingomyelin (HY-113498) or other membrane phospholipids .
    Sphingosine-1-phosphate
  • HY-128468

    Liposome PKC Parasite Others
    1,2-Dimyristoyl-sn-glycerol is a saturated diacylglycerol and a weak second messenger for the activation of PKC .
    1,2-Dimyristoyl-sn-glycerol
  • HY-128465

    Others Others
    1,2-Dilauroyl-sn-glycerol is a saturated diacylglycerol and may play a role in second messenger signal transduction .
    1,2-Dilauroyl-sn-glycerol
  • HY-103317

    Others Inflammation/Immunology
    NAADP, a nucleotide, is a Ca 2+-mobilizing second messenger. NAADP is essential for initiation of Ca 2+ signaling .
    NAADP
  • HY-112980

    DNA/RNA Synthesis Inflammation/Immunology
    Nusinersen is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
    Nusinersen
  • HY-112980A

    DNA/RNA Synthesis Inflammation/Immunology
    Nusinersen sodium is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
    Nusinersen sodium
  • HY-132587A

    ALN-AT3SC sodium; SAR439774 sodium

    Factor Xa Others
    Fitusiran sodium, an small interfering RNA, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran sodium increases thrombin generation and has the potential for the research of the hemophilia .
    Fitusiran sodium
  • HY-125854

    Liposome Metabolic Disease
    Phosphatidylcholines, egg is an important part of eukaryotic membranes. Phosphatidylcholines, egg is also a major source of the second messenger Diacylglycerol, Phosphatidic acid, Lysophosphatidic acid, and Arachidonic acid, which can be further metabolized to other signaling molecules .
    Phosphatidylcholines, egg
  • HY-132587

    ALN-AT3SC; SAR439774

    Small Interfering RNA (siRNA) Factor Xa Others
    Fitusiran (ALN-AT3SC), an small interfering RNA, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .
    Fitusiran
  • HY-150224

    Small Interfering RNA (siRNA) Factor Xa Others
    GalNAc unconjugated/naked Fitusiran (sodium), an small interfering RNA without GalNAc conjugation, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .
    GalNAc unconjugated/naked Fitusiran sodium
  • HY-N0086
    N6-Methyladenosine
    5 Publications Verification

    6-Methyladenosine; N-Methyladenosine

    Influenza Virus Endogenous Metabolite Infection
    N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
    N6-Methyladenosine
  • HY-153238

    Parasite Infection
    AN15368 is an orally active small-molecule precursor that can be activated by parasite carboxypeptidase to produce a compound that targets the messenger RNA processing pathway in T. cruzi. cruzi. AN15368 has the potential to prevent and research Chagas disease potential .
    AN15368
  • HY-132609

    Small Interfering RNA (siRNA) Transthyretin (TTR) Neurological Disease
    Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis .
    Patisiran sodium
  • HY-103642

    Inositol 1,4,5-trisphosphate hexapotassium salt; Ins(1,4,5)-P3 hexapotassium salt

    Others Metabolic Disease
    D-myo-Inositol 1,4,5-trisphosphate hexapotassium salt is the hexapotassium salt of D-myo-Inositol 1,4,5-trisphosphate (1,4,5-IP3), which is a second messenger that stimulates the discharge of calcium from the endoplasmic reticulum.
    D-myo-Inositol 1,4,5-trisphosphate hexapotassium salt
  • HY-114457

    L-alpha-Phosphatidylinositol-4,5-bisphosphate

    PI3K Others
    Phosphatidylinositol 4,5-bisphosphate (L-alpha-Phosphatidylinositol-4,5-bisphosphate), a phospholipid component of cell membranes, is a substrate for phospholipase C (PLC) and phosphoinositide 3-kinase (PI3K) and as a primary messenger .
    Phosphatidylinositol 4,5-bisphosphate
  • HY-103642A

    Inositol 1,4,5-trisphosphate trisodium; Ins(1,4,5)-P3 trisodium

    Others Metabolic Disease
    D-myo-Inositol-1,4,5-triphosphate sodium salt is the hexapotassium salt of D-myo-Inositol 1,4,5-trisphosphate (1,4,5-IP3), which is a second messenger that stimulates the discharge of calcium from the endoplasmic reticulum.
    D-myo-Inositol-1,4,5-triphosphate trisodium
  • HY-143700

    Liposome Neurological Disease
    18:0 DAP can be used to formulate lipid nanoparticles (LNPs), which mRNA is encapsulated in their core .
    18:0 DAP
  • HY-113469B

    Others Cancer
    Cyclic GMP TBAOH is a tetra-n-butylammonium hydroxide (TBAOH) form of Cyclic GMP (HY-12512). Cyclic GMP is an endogenous second messenger that regulates a variety of cellular processes including apoptosis, vasodilation, and neurotransmission through the activation of signaling pathways such as Protein Kinase G in cells .
    Cyclic GMP (TBAOH)
  • HY-153609

    Transthyretin (TTR) Small Interfering RNA (siRNA) Neurological Disease
    AS-Patisiran sodium is an antisense strand of Patisiran. Patisiran is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran can be used for the research of hereditary TTR amyloidosis .
    AS-Patisiran sodium
  • HY-117115

    Biochemical Assay Reagents Others
    1,2-Dihexanoyl-sn-glycerol is an analog of protein kinase C (PKC) that activates the second messenger diacylglycerol (DAG). Although the biological activity of 1,2-dicaproyl-sn-glycerol has not been well characterized, it is expected to behave similarly to 1,2-dioctanoyl-sn-glycerol.
    1,2-Dihexanoyl-sn-glycerol
  • HY-132610

    ALN-AS1

    Small Interfering RNA (siRNA) Neurological Disease
    Givosiran (ALN-AS1) is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid and porphobilinogen levels. Givosiran can be used for the research of acute intermittent porphyria .
    Givosiran
  • HY-W010970
    5'-Guanylic acid disodium salt
    1 Publications Verification

    5'-GMP disodium salt; 5'-guanosine monophosphate disodium salt

    Endogenous Metabolite Others
    5'-Guanylic acid disodium salt (5'-GMP disodium salt) is composed of guanine, ribose, and phosphate moieties and it is a nucleotide monomer in messenger RNA. Guanosine derivatives are involved in intracellular signal transduction and have been identified in repetitive genomic sequences in telomeres, in ribosomal DNA, immunoglobulin heavy‐chain switch regions, and in the control regions of proto-oncogenes .
    5'-Guanylic acid disodium salt
  • HY-101175

    3-Bromo-7-nitroindazole is a more potent and selective inhibitor of neuronal nitric oxide synthase (nNOS) than eNOS or inducible nitric oxide synthase (iNOS). 3-Bromo-7-nitroindazole affects the intercellular messenger nitric oxide (NO) synthesis throughout the body and brain .
    3-Bromo-7-nitroindazole
  • HY-114208A

    Histone Methyltransferase Cancer
    BI-9321 trihydrochloride is a potent, selective and cellular active nuclear receptor-binding SET domain 3 (NSD3)-PWWP1 domain antagonist with a Kd value of 166 nM. BI-9321 trihydrochloride is inactive against NSD2-PWWP1 and NSD3-PWWP2. BI-9321 trihydrochloride specifically disrupts histone interactions of the NSD3-PWWP1 domain with an IC50 of 1.2 μM in U2OS cells .
    BI-9321 trihydrochloride
  • HY-114208

    Histone Methyltransferase Cancer
    BI-9321 is a potent, selective and cellular active nuclear receptor-binding SET domain 3 (NSD3)-PWWP1 domain antagonist with a Kd value of 166 nM. BI-9321 is inactive against NSD2-PWWP1 and NSD3-PWWP2. BI-9321 specifically disrupts histone interactions of the NSD3-PWWP1 domain with an IC50 of 1.2 μM in U2OS cells .
    BI-9321
  • HY-P0063
    Copper tripeptide
    1 Publications Verification

    GHK-Cu

    Copper tripeptide (GHK-Cu) is a tripeptide. During wound healing, copper tripeptide may be freed from existing extracellular proteins via proteolysis and serves as a chemoattractant for inflammatory and endothelial cells. Copper tripeptide has been shown to increase messenger RNA production for collagen, elastin, proteoglycans, and glycosaminoglycans in fibroblasts. Copper tripeptide is a natural modulator of multiple cllular pathways in skin regeneration .
    Copper tripeptide
  • HY-P2867

    3′-Exonuclease

    Phosphodiesterase (PDE) Neurological Disease
    Phosphodiesterase II (EC 3.1.16.1), namely phosphodiesterase 2, is mainly involved in the hydrolysis of the important second messengers cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate (cGMP), and is often used in biochemical research. Phosphodiesterase II is expressed in a variety of tissues, such as the adrenal medulla, brain, heart, platelets, macrophages and endothelial cells, and is involved in the regulation of many different intracellular processes .
    Phosphodiesterase II, Bovine Spleen
  • HY-P2878

    PDE

    Phosphodiesterase (PDE) Neurological Disease
    Phosphodiesterase (PDE) is an enzyme that can catalyze the hydrolysis of the 3' ring phosphate bond of cyclic nucleotides, and is often used in biochemical research. Phosphodiesterase acts as an important regulator of signal transduction mediated by the second messenger molecules cAMP and cGMP. According to their specificity to cyclic nucleotides, they can also be divided into different types, such as PDE1-PDE11, which also have certain potential in various diseases .
    Phosphodiesterase
  • HY-107780

    c-di-GMP; cyclic diguanylate; 5GP-5GP

    STING Endogenous Metabolite Cancer
    Cyclic-di-GMP is a STING agonist and a bacterial second messenger that coordinates different aspects of bacterial growth and behavior, including motility, virulence, biofilm formation, and cell cycle progression. Cyclic-di-GMP has anti-cancer cell proliferation activity and also induces elevated CD4 receptor expression and cell cycle arrest. Cyclic-di-GMP can be used in cancer research .
    Cyclic-di-GMP
  • HY-12895
    SKI V
    1 Publications Verification

    SKI V is a noncompetitive and potent non-lipid sphingosine kinase (SPHK; SK) inhibitor with an IC50 of 2 μM for GST-hSK. SKI V potently inhibits PI3K with an IC50 of 6 μM for hPI3k. SKI V decreases formation of the mitogenic second messenger sphingosine-1-phosphate (S1P). SKI V induces apoptosis and has antitumor activity .
    SKI V
  • HY-107780A

    c-di-GMP sodium; cyclic diguanylate sodium; 5GP-5GP sodium

    STING Endogenous Metabolite Cancer
    Cyclic-di-GMP sodium is a STING agonist and a bacterial second messenger that coordinates different aspects of bacterial growth and behavior, including motility, virulence, biofilm formation, and cell cycle progression. Cyclic-di-GMP sodium has anti-cancer cell proliferation activity and also induces elevated CD4 receptor expression and cell cycle arrest. Cyclic-di-GMP sodium can be used in cancer research .
    Cyclic-di-GMP sodium
  • HY-P3624

    Guanylate Cyclase Cardiovascular Disease
    Cenderitide is a potent agonist of particulate guanylyl cyclase receptor (pGC). Cenderitide is a natriuretic peptide (NP) composed of C-type natriuretic peptide (CNP) fused to the C-terminus of Dendroaspis natriuretic peptide (DNP). Cenderitide activates both pGC-A and pGC-B, activates the second messenger cGMP, suppresses aldosterone, and preserves GFR without reducing blood pressure. Cenderitide can be used for heart failure research .
    Cenderitide
  • HY-107780B
    Cyclic-di-GMP diammonium
    2 Publications Verification

    c-di-GMP diammonium; cyclic diguanylate diammonium; 5GP-5GP diammonium

    STING Endogenous Metabolite Cancer
    Cyclic-di-GMP diammonium is a STING agonist and a bacterial second messenger that coordinates different aspects of bacterial growth and behavior, including motility, virulence, biofilm formation, and cell cycle progression. Cyclic-di-GMP diammonium has anti-cancer cell proliferation activity and also induces elevated CD4 receptor expression and cell cycle arrest. Cyclic-di-GMP diammonium can be used in cancer research .
    Cyclic-di-GMP diammonium
  • HY-110382
    Cyclic-di-GMP disodium
    2 Publications Verification

    c-di-GMP disodium; cyclic diguanylate disodium; 5GP-5GP disodium

    STING Endogenous Metabolite Cancer
    Cyclic-di-GMP disodium is a STING agonist and a bacterial second messenger that coordinates different aspects of bacterial growth and behavior, including motility, virulence, biofilm formation, and cell cycle progression. Cyclic-di-GMP disodium has anti-cancer cell proliferation activity and also induces elevated CD4 receptor expression and cell cycle arrest. Cyclic-di-GMP disodium can be used in cancer research .
    Cyclic-di-GMP disodium
  • HY-N0086S

    6-Methyladenosine-d3; N-Methyladenosine-d3

    Isotope-Labeled Compounds Infection
    N6-Methyladenosine-d3 (6-Methyladenosine-d3; N-Methyladenosine-d3) is a deuterium labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
    N6-Methyladenosine-d3
  • HY-123468

    Cyclic GMP-AMP Synthase PKA ERK Cardiovascular Disease Metabolic Disease
    HA-1004 is a selective inhibitor of PKA, which can inhibit lipolysis and induce vascular relaxation. HA-1004 is also a dual inhibitor of cyclic GMP-dependent protein kinase and cyclic AMP-dependent protein, and is involved in smooth muscle, second messenger, cyclic AMP and cyclic GMP regulation mechanisms. HA-1004 can be used as a vasodilator to inhibit the contraction of rabbit aortic strips, or to antagonize ERK and tyrosine hydroxylase (TH) phosphorylation in morphine abstinence rat models .
    HA-1004
  • HY-N0086S2

    6-Methyladenosine-13C4; N-Methyladenosine-13C4

    Isotope-Labeled Compounds Influenza Virus Endogenous Metabolite Infection
    N6-Methyladenosine- 13C4 (6-Methyladenosine- 13C4; N-Methyladenosine- 13C4) is 13C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities.
    N6-Methyladenosine-13C4
  • HY-N0086S3

    6-Methyladenosine-13C3; N-Methyladenosine-13C3

    Isotope-Labeled Compounds Influenza Virus Endogenous Metabolite Infection
    N6-Methyladenosine- 13C3 (6-Methyladenosine- 13C3) is 13C-labeled N6-Methyladenosine (HY-N0086). N6-Methyladenosine is the most prevalent internal (non-cap) modification present in the messenger RNA (mRNA) of all higher eukaryotes. N6-Methyladenosine can modifies viral RNAs and has antiviral activities .
    N6-Methyladenosine-13C3
  • HY-12326A
    c-di-AMP disodium
    2 Publications Verification

    Cyclic diadenylate disodium; Cyclic-di-AMP disodium

    STING Bacterial Endogenous Metabolite Inflammation/Immunology
    c-di-AMP (Cyclic diadenylate) sodium is a STING agonist, which binds to the transmembrane protein STING thereby activating the TBK3-IRF3 signaling pathway, subsequently triggering the production of type I IFN and TNF. c-di-AMP sodium is also a bacterial second messenger, which regulates cell growth, survival, and virulence, primarily within Gram-positive bacteria, and also regulates host immune response. c-di-AMP sodium acts as a potent mucosal adjuvant stimulating both humoral and cellular responses .
    c-di-AMP disodium

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: