Search Result
Results for "
oligonucleotide
" in MedChemExpress (MCE) Product Catalog:
9773
Inhibitors & Agonists
19
Biochemical Assay Reagents
5
Isotope-Labeled Compounds
Cat. No. |
Product Name |
Target |
Research Areas |
Chemical Structure |
-
- HY-W048496
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
2'-O-(2-Methoxyethyl)-cytidine is a synthetic oligonucleotide derived from uridine. 2'-O-(2-Methoxyethyl)-cytidine has good hybridization properties and high stability, and can be used in the research of oligonucleotide chemotherapeutic agents .
|
-
-
- HY-W016041
-
-
-
- HY-160229
-
R-1075 sodium
|
Toll-like Receptor (TLR)
|
Infection
|
ssRNA40 (sodium) is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. ssRNA40 is a uridine-rich ssRNA derived from the HIV-1 long terminal repeat on activation of NK cells via TLR7/8 [1][2].
|
-
-
- HY-137576
-
-
-
- HY-D1410
-
DMTr-4'-F-5-Methyluridine-CED phosphoramidite
|
Fluorescent Dye
|
Others
|
DMTr-4'-F-5-Me-U-CED phosphoramidite (DMTr-4'-F-5-Methyluridine-CED phosphoramidite), a dye reagent for oligonucleotide labeling, acts as efficient as the incorporation of native deoxyribonucleoside phosphoramidites. DMTr-4'-F-5-Me-U-CED phosphoramidite is a building block .
|
-
-
- HY-D1409
-
DMTr-4'-F-uridine-CED-TBDMS phosphoramidite
|
DNA Stain
|
Cardiovascular Disease
|
DMTr-4'-F-U-CED-TBDMS phosphoramidite (DMTr-4'-F-uridine-CED-TBDMS phosphoramidite), a dye reagent for oligonucleotide labeling, can be used for the research of applications in RNA therapeutics, RNA aptamers, and ribozymes for elucidating RNA structure. DMTr-4'-F-U-CED-TBDMS phosphoramidite represents a probe with wide utility for elucidation of RNA structure .
|
-
-
- HY-D1408
-
DMTr-4'-Methyluridine-CED-TBDMS phosphoramidite
|
DNA Stain
|
Cardiovascular Disease
|
DMTr-4'-Me-U-CED-TBDMS phosphoramidite (DMTr-4'-Methyluridine-CED-TBDMS phosphoramidite), a dye reagent for oligonucleotide labeling, can be used for the research of applications in RNA therapeutics, RNA aptamers, and ribozymes for elucidating RNA structure. DMTr-4'-Me-U-CED-TBDMS phosphoramidite represents a probe with wide utility for elucidation of RNA structure .
|
-
-
- HY-W048483
-
|
DNA/RNA Synthesis
|
Others
|
Bz-rC Phosphoramidite is a phosphinamide monomer that can be used in the preparation of oligonucleotides .
|
-
-
- HY-D1089
-
|
Fluorescent Dye
|
Others
|
6-JOE, SE is an amine-reactive fluorescent probe and is suitable for postsynthetic labeling of amino-modified oligonucleotides .
|
-
-
- HY-160224
-
|
STING
IFNAR
|
Inflammation/Immunology
|
dsVACV-70mer sodium is a 70 bp double-stranded oligonucleotide containing viral DNA motifs derived from vaccinia virus DNA. dsVACV-70mer sodium has potently induces IFN-β via a STING-dependent manner .
|
-
-
- HY-20140
-
-
-
- HY-15939
-
|
Fluorescent Dye
|
Metabolic Disease
|
6-FAM SE (6-carboxyfluorescein succinimidyl ester) is a fluorescent labeling reagent. 6-FAM SE is used for oligonucleotide labeling and DNA sequencing .
|
-
-
- HY-W102322
-
-
-
- HY-157221
-
-
-
- HY-138586
-
-
-
- HY-138580
-
-
-
- HY-21648
-
|
DNA/RNA Synthesis
Drug Intermediate
|
Others
|
2'-OMe-Ac-C Phosphoramidite is a modified phosphoramidite and can be used for the oligonucleotide synthesis. 2'-OMe-Ac-C Phosphoramidite contributes to improving the stability and activity of oligonucleotides .
|
-
-
- HY-138578
-
-
-
- HY-D2244
-
-
-
- HY-160223
-
|
STING
|
Infection
Inflammation/Immunology
|
ssVACV-70mer sodium is a 70 bp single-stranded oligonucleotide containing viral DNA motifs that derive from the vaccinia virus DNA. Unlike its double-stranded counterpart dsVACV 70mer, ssVACV 70mer is not IFN-inducer .
|
-
-
- HY-W048482
-
DMT-2'O-TBDMS-rU phosphoramidite
|
DNA/RNA Synthesis
|
Others
|
rU Phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
-
- HY-160230
-
|
Toll-like Receptor (TLR)
|
Infection
|
ssRNA41 sodium is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. It derives from ssRNA40 by replacement of all U nucleotides with adenosine. ssRNA41 sodium is unable to induce the production of type IFNs, and therefore can be used as a negative control for ssRNA40 .
|
-
-
- HY-W010702
-
N2-Isobutyryl-5′-O-(4,4′-dimethoxytrityl)-2′-deoxyguanosine
|
DNA/RNA Synthesis
|
Others
|
5'-O-DMT-N2-ibu-dG (N2-Isobutyryl-5′-O-(4,4′-dimethoxytrityl)-2′-deoxyguanosine) is a deoxynucleoside which can be used in the preparation of oligonucleotides .
|
-
-
- HY-21601
-
-
-
- HY-W392808
-
|
DNA/RNA Synthesis
|
Others
|
Spacer phosphoramidite C3 is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
-
- HY-132272
-
-
-
- HY-154445
-
|
DNA/RNA Synthesis
|
Others
|
DMTr-TNA-U-amidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
-
- HY-49210
-
|
DNA/RNA Synthesis
|
Others
|
DMT-locG(ib) Phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
-
- HY-49000
-
|
DNA/RNA Synthesis
|
Others
|
DMT-locMeC(bz) phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
-
- HY-W570887
-
-
-
- HY-W009354
-
|
DNA/RNA Synthesis
|
Others
|
Di-tert-butyl diisopropylphosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
-
- HY-49214
-
|
DNA/RNA Synthesis
|
Others
|
5-Formylindole-CE phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
-
- HY-154210
-
|
DNA/RNA Synthesis
|
Others
|
DMTr-FNA-C(Bz)Phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
-
- HY-W098689
-
2'-Deoxy-N2-dimethylaminomethylene-guanosine
|
Nucleoside Antimetabolite/Analog
|
Others
|
Dmf-dg (2'-Deoxy-N2-dimethylaminomethylene-guanosine) is a deoxyguanosine (dG) nucleoside protected by the dimethylaminomethylamidine (DMF) base and can be used for oligonucleotide synthesis .
|
-
-
- HY-138579
-
DMT-2'-O-Methyl-rG(ib) Phosphoramidite
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
2'-OMe-G(ibu) Phosphoramidite (DMT-2'-O-Methyl-rG(ib) Phosphoramidite) is a modified phosphoramidite monomer that can be used for the oligonucleotide synthesis .
|
-
-
- HY-21703
-
|
DNA/RNA Synthesis
|
Others
|
3'-TBDMS-Bz-rA Phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
-
- HY-W105447
-
|
DNA/RNA Synthesis
|
Others
|
3'-TBDMS-ibu-rG Phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
-
- HY-154034
-
|
DNA/RNA Synthesis
|
Others
|
5'-DMTr-T-Methyl phosphonamidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
-
- HY-154036
-
|
DNA/RNA Synthesis
|
Others
|
5’-DMTr-dC (Ac)-Methylphosphonamidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
-
- HY-W141393
-
|
DNA/RNA Synthesis
|
Others
|
2'-OMe-dmf-G-CE-Phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
-
- HY-153251
-
|
DNA/RNA Synthesis
|
Others
|
DMT-2'-O-Methylguanosine phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
-
- HY-154444
-
|
DNA/RNA Synthesis
|
Others
|
DMTr-TNA-5MeU-amidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
-
- HY-154062
-
|
DNA/RNA Synthesis
|
Others
|
5'-DMTr-dA(Bz)-Methyl phosphonamidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
-
- HY-153253
-
|
DNA/RNA Synthesis
|
Others
|
DMT-2'-O-Methyladenosine phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
-
- HY-154016
-
|
DNA/RNA Synthesis
|
Others
|
5'-DMTr-dG(iBu)-Methyl phosphonamidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
-
- HY-W101391
-
2'-O-Me-U Phosphoramidite
|
DNA/RNA Synthesis
|
Others
|
DMT-2'O-Methyl-rU Phosphoramidite (2'-O-Me-U Phosphoramidite) is a 2'-O-Me derivative, and can be used for oligonucleotide synthesis .
|
-
-
- HY-D0723
-
5(6)-Carboxytetramethylrhodamine N-succinimidyl ester
|
Fluorescent Dye
|
Cancer
|
5(6)-TAMRA SE is a fluorescent dye that emits red fluorescence. 5(6)-TAMRA SE binds to oligonucleotides and is used in DNA sequencing. 5(6)-TAMRA SE can be used in cancer research (Ex/Em = 565/580 nm) .
|
-
-
- HY-154368
-
|
DNA/RNA Synthesis
|
Others
|
DMTr-MOE-Inosine-3-CED-phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
-
- HY-W570892
-
|
DNA/RNA Synthesis
|
Others
|
DMTr-LNA-U-3-CED-phosphora is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
-
- HY-W039425
-
|
DNA/RNA Synthesis
|
Others
|
N-Trityl-morpholino-T-5'-O-phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-154706
-
|
DNA/RNA Synthesis
|
Others
|
N-DMTr-Morpholino-T-5'-O-phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-154705
-
|
DNA/RNA Synthesis
|
Others
|
N-DMTr-Morpholino-U-5'-O-phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-W425099
-
|
DNA/RNA Synthesis
|
Others
|
2'-Deoxyguanosine-(N-iBu)-3'-methyl-phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-154031
-
|
DNA/RNA Synthesis
|
Others
|
3'-F-3'-dA(Bz)-2'-Phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-104016
-
|
DNA/RNA Synthesis
|
Others
|
2'-O-MOE-5MeU-3'-phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-D1086
-
6-ROX, SE
|
DNA Stain
|
Others
|
6-Carboxy-X-rhodamine, succinimidyl ester (6-ROX, SE) is a fluorescent dye for oligonucleotide labeling and automated DNA sequencing .
|
-
- HY-154708
-
|
DNA/RNA Synthesis
|
Others
|
N-DMTr-N6-Benzoyl-morpholino-A-5'-O-phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-W039428
-
|
DNA/RNA Synthesis
|
Others
|
N-Trityl-N6-benzoyl-morpholino-A-5'-O-phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-W336559
-
|
DNA/RNA Synthesis
|
Others
|
5-Me-DMT-2'-O-Me-C(Bz)-CE-Phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-W039427
-
|
DNA/RNA Synthesis
|
Others
|
N-Trityl-N2-isobutyryl-morpholino-G-5'-O-phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-154707
-
|
DNA/RNA Synthesis
|
Others
|
N-DMTr-N4-Benzoyl-morpholino-cytosine-5'-O-phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-154709
-
|
DNA/RNA Synthesis
|
Others
|
N-DMTr-N2-Isobutyryl-morpholino-G-5'-O-phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-W039426
-
|
DNA/RNA Synthesis
|
Others
|
N-Trityl-N4-benzoyl-morpholino-C-5'-O-phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-154486
-
|
DNA/RNA Synthesis
|
Others
|
5’-O-DMTr-2’-OMe-5MeU-P-methyl phosphonamidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-W115309
-
5'-DMT-2'-F-ibu-dG
|
Nucleoside Antimetabolite/Analog
|
Others
|
DMT-2'-F-iBu-G (5'-DMT-2'-F-ibu-dG) is a modified oligonucleotide. 2'-deoxy-2'-fluoro-modified oligonucleotides shows high nuclease resistant and retained exceptional binding affinity to the RNA targets .
|
-
- HY-48873
-
|
DNA/RNA Synthesis
|
Others
|
5'-O-DMT-5-Ethynyl-2'-deoxyuridine 3'-CE phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-46369
-
|
DNA/RNA Synthesis
|
Others
|
1-p-Chlorobenzyl-1,2,3-triazole-5′-O-DMT-dU Phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-W048488
-
|
DNA/RNA Synthesis
|
Others
|
2'-O-MOE-5-Me-rU is an active compound. 2'-O-MOE-5-Me-rU can be used for oligonucleotide synthesis .
|
-
- HY-W087199
-
|
DNA/RNA Synthesis
|
Others
|
N6-Benzoyl-2'-deoxy-5'-O-DMT-a-adenosine 3'-CE phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-132600A
-
Temavirsen sodium
|
MicroRNA
HCV
|
Infection
|
RG-101 sodium is a hepatocyte targeted N-acetylgalactosamine conjugated oligonucleotide that antagonises miR-122. miR-122 is an important host factor for hepatitis C virus (HCV) replication .
|
-
- HY-132600
-
Temavirsen
|
MicroRNA
HCV
|
Infection
|
RG-101 is a hepatocyte targeted N-acetylgalactosamine conjugated oligonucleotide that antagonises miR-122. miR-122 is an important host factor for hepatitis C virus (HCV) replication .
|
-
- HY-W048497
-
|
DNA/RNA Synthesis
|
Others
|
2'-O-MOE-5-Me-rC is an active compound. 2'-O-MOE-5-Me-rC can be used for oligonucleotide synthesis .
|
-
- HY-104017
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
DMT-2'-O-MOE-rA(Bz) phosphoramidite is an adenine nucleoside analog. DMT-2'-O-MOE-rA(Bz) phosphoramidite can be used in research on oligonucleotide synthesis .
|
-
- HY-157091
-
-
- HY-154608
-
|
DNA/RNA Synthesis
|
Others
|
3’-Deoxy-5’-O-(4,4’-dimethoxytrityl)-3’-fluoro uridine-2’-CED-phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-154615
-
|
DNA/RNA Synthesis
|
Others
|
N4-Benzoyl-5’-O-DMTr-2’-O-(N3-trifluoroacetyl) aminopropyl cytidine 3’-CED phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-W048482S4
-
DMT-2'O-TBDMS-rU phosphoramidite-15N
|
Isotope-Labeled Compounds
DNA/RNA Synthesis
|
Others
|
rU Phosphoramidite- 15N (DMT-2'O-TBDMS-rU phosphoramidite- 15N) is 15N labeled rU Phosphoramidite (HY-W048482). rU Phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-132593A
-
WVE-120101 sodium
|
Huntingtin
|
Neurological Disease
|
Rovanersen sodium is an antisense oligonucleotide that specifically targets mutated mRNA copies of the huntington (HTT) gene without affecting healthy mRNA of HTT gene, thereby preventing the production of faulty Huntingtin protein. Rovanersen sodium can be used for huntington’s disease research .
|
-
- HY-P3392
-
ION373
|
FAP
|
Neurological Disease
|
Zilganersen (ION373) is a glial fibrillary acidic protein (GFAP) inhibitor, an antisense oligonucleotide. Zilganersen can be used in Alexander disease (AxD) research .
|
-
- HY-W048482S3
-
DMT-2'O-TBDMS-rU phosphoramidite-15N2
|
Isotope-Labeled Compounds
DNA/RNA Synthesis
|
Others
|
rU Phosphoramidite- 15N2 (DMT-2'O-TBDMS-rU phosphoramidite- 15N2) is 15N labeled rU Phosphoramidite (HY-W048482). rU Phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-132593
-
WVE-120101
|
Huntingtin
|
Neurological Disease
|
Rovanersen (WVE-120101) is an antisense oligonucleotide that specifically targets mutated mRNA copies of the huntington (HTT) gene without affecting healthy mRNA of HTT gene, thereby preventing the production of faulty Huntingtin protein. Rovanersen can be used for huntington’s disease research .
|
-
- HY-W048482S2
-
DMT-2'O-TBDMS-rU phosphoramidite-13C9
|
Isotope-Labeled Compounds
DNA/RNA Synthesis
|
Others
|
rU Phosphoramidite- 13C9 (DMT-2'O-TBDMS-rU phosphoramidite- 13C9) is 13C-labeled rU Phosphoramidite (HY-W048482). rU Phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-135414
-
|
Fluorescent Dye
|
Others
|
Cyanine5 NHS ester chloride is a red emitting fluorescent dye for labeling of amino-groups in peptides, proteins, and oligonucleotides .
|
-
- HY-108753
-
AVI 4658
|
Arp2/3 Complex
|
Metabolic Disease
|
Eteplirsen (AVI 4658) is a synthetic antisense oligonucleotide. Eteplirsen can be used for Duchenne muscular dystrophy research .
|
-
- HY-151651
-
Spacer Phosphoramidite 18
|
Fluorescent Dye
|
Others
|
Hexaethylene glycol phosphoramidite (Spacer Phosphoramidite 18) is an amidite reagent for oligonucleotide synthesis. Hexaethylene glycol phosphoramidite can be used as a linker in synthesis of nucleotide chain and qPCR probes .
|
-
- HY-136151
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
UNC10217938A is a 3-deazapteridine analog with strong oligonucleotide enhancing effects. UNC10217938A enhances oligonucleotides effects by modulating their intracellular trafficking and release from endosomes. UNC10217938A also enhances the effects of antisense and siRNA oligonucleotides .
|
-
- HY-132582C
-
BIIB080 sodium; ISIS 814907 sodium
|
Tau Protein
|
Neurological Disease
|
IONIS-MAPTRx sodium is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx sodium has the potential for the research of Alzheimer Disease .
|
-
- HY-160222
-
|
HSV
STING
|
Infection
Inflammation/Immunology
|
HSV-60mer sodium is a 60 bp double-stranded oligonucleotide containing viral DNA motifs that derive from the herpes simplex virus 1 (HSV-1) genome . Transfected HSV-60 has been shown to potently induce IFN-β in a Toll-like receptor (TLR)-, DNA-dependent activator of IRFs (DAI)-, and RNA polymerase III (Pol III)-independent, but STING-, TBK1- and IFN regulatory factor 3 (IRF3)-dependent manner.
|
-
- HY-W048482S1
-
DMT-2'O-TBDMS-rU phosphoramidite-13C9,15N2
|
Isotope-Labeled Compounds
DNA/RNA Synthesis
|
Others
|
rU Phosphoramidite- 13C9, 15N2 (DMT-2'O-TBDMS-rU phosphoramidite- 13C9, 15N2) is 13C and 15N-labeled rU Phosphoramidite (HY-W048482). rU Phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-132582
-
BIIB080; ISIS 814907
|
Tau Protein
|
Neurological Disease
|
IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease .
|
-
- HY-D0842A
-
Albumin bovine serum (Low Endotoxin,Fatty acid free); BSA (Low Endotoxin,Fatty acid free)
|
Biochemical Assay Reagents
Nucleoside Antimetabolite/Analog
|
Inflammation/Immunology
|
Bovine Serum Albumin (Low Endotoxin,Fatty acid free) (BSA) is a 583 amino acid globular protein and oligonucleotide binding protein composed of three homologous full α domains. Bovine Serum Albumin (Low Endotoxin,Fatty acid free) (BSA) blocks the overall binding of oligonucleotides to cells. Bovine Serum Albumin (Low Endotoxin,Fatty acid free) (BSA) regulates the development of hamster embryos and induces arthritis .
|
-
- HY-160231
-
|
Toll-like Receptor (TLR)
|
Inflammation/Immunology
|
ssRNA42 (sodium) is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. ssRNA42 (sodium) derives from ssRNA40 by replacement of all G nucleotides with adenosine. ssRNA42 activated human PBMCs to secrete IFN-α, TNF-a, IL- 12p40, and IL-6, but ssRNA42 failed to stimulated murine pDCs and PBMCs.
|
-
- HY-W048482S
-
DMT-2'O-TBDMS-rU phosphoramidite-13C2,d1
|
Isotope-Labeled Compounds
DNA/RNA Synthesis
|
Others
|
rU Phosphoramidite- 13C2,d1 (DMT-2'O-TBDMS-rU phosphoramidite- 13C2,d1) is deuterium and 13C-labeled rU Phosphoramidite (HY-W048482). rU Phosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-159692
-
IONIS-1063734
|
TGF-beta/Smad
|
Inflammation/Immunology
Cancer
|
AZD8701 (IONIS-1063734) is an antisense oligonucleotide targeting FOXP3 in regulatory T cells (Tregs). AZD8701 can relieve immunosuppression in cancer .
|
-
- HY-159692A
-
IONIS-1063734 sodium
|
TGF-beta/Smad
|
Inflammation/Immunology
Cancer
|
AZD8701 (IONIS-1063734) sodium is an antisense oligonucleotide targeting FOXP3 in regulatory T cells (Tregs). AZD8701 sodium can relieve immunosuppression in cancer .
|
-
- HY-150215
-
-
- HY-150215A
-
-
- HY-D0819A
-
Cy5 NHS Ester triethylamine salt; Sulfo-Cyanine5 Succinimidyl Ester triethylamine salt
|
Fluorescent Dye
|
Others
|
Cy5-SE (Cy5 NHS Ester) triethylamine salt is a reactive dye for the labeling of amino-groups in peptides, proteins, and oligonucleotides. Cy5-SE triethylamine salt is ideal for very cost-efficient labeling of soluble proteins, as well as all kinds of peptides and oligonucleotides Ex=649 nm; Em=670 nm) .
|
-
- HY-145980
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
m7GpppUpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppUpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures .
|
-
- HY-145982
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
m7GpppCmpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppCmpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures .
|
-
- HY-145979
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
m7GpppUmpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppUmpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures .
|
-
- HY-145981
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
m7GpppCpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppCpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures .
|
-
- HY-135414A
-
|
Fluorescent Dye
|
Others
|
Cyanine5 NHS ester bromide is a active compound, can be used to label amino groups in peptides, proteins, and oligonucleotides. Cyanine5 NHS ester bromide is a cyanine dye, fluorescence-labeling neurotensin (8-13) via arginine residues .
|
-
- HY-148647
-
ISIS 301012 free base
|
Apolipoprotein
HCV
|
Infection
|
Mipomersen (ISIS 301012 free base) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
|
-
- HY-104014
-
|
DNA/RNA Synthesis
Nucleoside Antimetabolite/Analog
|
Others
|
DMT-2'O-MOE-rG(ib) Phosphoramidite belongs to cyanoethyl-protected nucleoside phosphoramidites. DMT-2'O-MOE-rG(ib) Phosphoramidite is a derivative of nucleotide and guanosine. DMT-2'O-MOE-rG(ib) Phosphoramidite can be used for the stereochemical synthesis of phosphorothioate oligonucleotides .
|
-
- HY-D2459
-
|
Fluorescent Dye
|
Cancer
|
Alexa Fluor 430 NHS ester is a compound that couples green fluorescent dye Alexa Fluor 430 to a protein or antibody. Alexa Fluor 430 is used for the generation of stable signals in imaging and flow cytometry. NHS ester can be used to label proteins, amine-modified oligonucleotides and other primary amines (R-NH2) containing amine molecules .
|
-
- HY-D0819
-
CY5-SE
Maximum Cited Publications
16 Publications Verification
Cy5 NHS Ester; Sulfo-Cyanine5 Succinimidyl Ester
|
Fluorescent Dye
|
Others
|
Cy5-SE (Cy5 NHS Ester) is a reactive dye for the labeling of amino-groups in peptides, proteins, and oligonucleotides. This dye requires small amount of organic co-solvent (such as DMF or DMSO) to be used in labeling reaction. This reagent is ideal for very cost-efficient labeling of soluble proteins, as well as all kinds of peptides and oligonucleotides. This reagent also works well in organic solvents for small molecule labeling.
Excitation (nm):649, Emission (nm): 670.
|
-
- HY-145976
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
m7GpppGpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppGpG prevents premature degradation by 5′-exonucleases and recruits proteins required for pre-mRNA splicing, mRNA transport and initiation of protein biosynthesis .
|
-
- HY-D148410F
-
Cy5-STK-001 negative control
|
Fluorescent Dye
|
Neurological Disease
|
Cy5-Zorevunensen negative control (Cy5-STK-001 negative control) is an antisense oligonucleotide labeled with the fluorescent molecule Cy5, which can be used as a negative control for Zorevunersen (HY-148410) .
|
-
- HY-132581A
-
BIIB078 sodium; IONIS-C9Rx sodium
|
Others
Ras
|
Neurological Disease
|
Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
|
-
- HY-151751
-
|
Fluorescent Dye
|
Others
|
BDP TMR alkyne is an alkyne-containing click chemistry reagent that can click chemistry with azides. BDP TMR alkyne has the fluorophore BDP and can be used for oligonucleotide labeling and amino acid sequencing .
|
-
- HY-159695A
-
-
- HY-159695
-
-
- HY-132581
-
BIIB078; IONIS-C9Rx
|
Ras
Others
|
Neurological Disease
|
Tadnersen (BIIB078), an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
|
-
- HY-151123A
-
AKCEA-APO(a)-LRx sodium; ISIS 681257 sodium; TQJ230 sodium
|
Apolipoprotein
|
Cardiovascular Disease
|
Pelacarsen sodium is a liver-specific antisense oligonucleotide against apolipoprotein(a) that reduces lipoprotein(a) up to 80% with good tolerability .
|
-
- HY-132579A
-
RG6042 sodium; IONIS-HTTRx sodium
|
Huntingtin
|
Neurological Disease
|
Tominersen sodium is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen sodium can be used for the research of Huntington’s disease (HD) .
|
-
- HY-P2878A
-
PDE, Rattlesnake venom
|
Phosphodiesterase (PDE)
|
Metabolic Disease
|
Phosphodiesterase l, Rattlesnake venom (PDE, Rattlesnake venom) is a non-selective phosphodiester bond hydrolase targeting phosphodiester bonds in oligonucleotides, catalyzing their hydrolysis into mononucleotides. Phosphodiesterase l, Rattlesnake venom cleaves phosphodiester linkages in DNA fragments digested by DNase I. Phosphodiesterase l, Rattlesnake venom is promising for research of nucleic acid structure and metabolism .
|
-
- HY-139099
-
Gp3G
|
Nucleoside Antimetabolite/Analog
DNA/RNA Synthesis
|
Cancer
|
Diguanosine 5′-triphosphate (Gp3G) is a dinucleoside triphosphates. Diguanosine 5′-triphosphate also is a virus-specific oligonucleotide. Diguanosine 5′-triphosphate is needed for the synthesis of RNA during the transcription process .
|
-
- HY-132579
-
RG6042; IONIS-HTTRx
|
Huntingtin
|
Neurological Disease
|
Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD) .
|
-
- HY-145721A
-
GED-0301 sodium
|
TGF-beta/Smad
|
Inflammation/Immunology
|
Mongersen sodium is a specific and orally active SMAD7 antisense oligonucleotide. Mongersen sodium restores TGF-β1 activity leading to inhibition of inflammatory signals. Mongersen sodium can attenuate Crohn's disease-like experimental colitis in mice .
|
-
- HY-151123
-
AKCEA-APO(a)-LRx; ISIS 681257; TQJ230
|
Apolipoprotein
|
Cardiovascular Disease
|
Pelacarsen (AKCEA-APO(a)-LRx) is a liver-specific antisense oligonucleotide against apolipoprotein(a) that reduces lipoprotein(a) up to 80% with good tolerability .
|
-
- HY-139099A
-
Gp3G lithium
|
DNA/RNA Synthesis
Nucleoside Antimetabolite/Analog
|
Cancer
|
Diguanosine 5′-triphosphate (Gp3G) lithium is a dinucleoside triphosphates. Diguanosine 5′-triphosphate lithium also is a virus-specific oligonucleotide. Diguanosine 5′-triphosphate lithium is needed for the synthesis of RNA during the transcription process .
|
-
- HY-21997
-
|
DNA/RNA Synthesis
Drug Intermediate
|
Others
|
DMT-2'fluoro-da(bz) amidite is a key intermediate for synthesizing antisense oligonucleotides with high nuclease resistance, high RNA binding affinity, and maintained base-pair specificity .
|
-
- HY-145721
-
GED-0301
|
TGF-beta/Smad
|
Inflammation/Immunology
|
Mongersen (GED-0301) is a specific and orally active SMAD7 antisense oligonucleotide. Mongersen restores TGF-β1 activity leading to inhibition of inflammatory signals. Mongersen can attenuate Crohn's disease-like experimental colitis in mice .
|
-
- HY-148687
-
|
PCSK9
|
Cardiovascular Disease
|
SPC5001 is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
|
-
- HY-112958
-
ISIS-2922 free base
|
CMV
|
Infection
|
Fomivirsen (ISIS-2922 free base) is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen is an antiviral agent that is used CMV research, incluiding in AIDs. Fomivirsen binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation .
|
-
- HY-148687A
-
|
PCSK9
|
Cardiovascular Disease
|
SPC5001 sodium is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 sodium can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
|
-
- HY-109528
-
ISIS-2922
|
CMV
|
Infection
|
Fomivirsen (ISIS-2922) sodium is an antisense 21 mer phosphorothioate oligonucleotide. Fomivirsen sodium is an antiviral agent that is used cytomegalovirus retinitis (CMV) research, incluiding in AIDs. Fomivirsen sodium binds to and degrades the mRNAs encoding CMV immediate-early 2 protein, thus inhibiting virus proliferation .
|
-
- HY-132608
-
ISIS-420915 sodium
|
Transthyretin (TTR)
|
Neurological Disease
|
Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
|
-
- HY-132601A
-
MRG-106 sodium
|
MicroRNA
|
Cancer
|
Cobomarsen sodium is an oligonucleotide inhibitor of miR-155. Cobomarsen sodium inhibits multiple gene pathways associated with cell survival (including JAK/STAT, MAPK/ERK and PI3K/AKT). Cobomarsen sodium can be used for the research of B-cell lymphoma .
|
-
- HY-W460666
-
|
Drug Intermediate
|
Cancer
|
5'-O-DMT-N2-Ibu-2'-OMe-G is a crucial intermediate for the synthesis of antisense oligonucleotides. 5'-O-DMT-N2-Ibu-2'-OMe-G is involved in constructing antisense oligonucleotides with specific sequences, which can bind complementarily to the targeted mRNA. 5'-O-DMT-N2-Ibu-2'-OMe-G blocks the translation process of mRNA, thereby inhibiting the expression of specific proteins and playing a role in regulating gene expression. 5'-O-DMT-N2-Ibu-2'-OMe-G is promising for research of genetic diseases and tumors .
|
-
- HY-151680
-
|
DNA Stain
|
Others
|
TAMRA alkyne, 6-isomer is a linker of TAMRA which is a xanthene dye with orange emission that is commonly used for oligonucleotide labeling and amino acid sequencing. The addition of the alkyne groups allows for it to be reacted with an azide for copper-catalyzed Click Chemistry .
|
-
- HY-D1070
-
|
DNA Stain
|
Others
|
DBCO-PEG4-TAMRA is a PEG-based TAMRA dye and contains a DBCO group, which enables Click Chemistry. The TAMRA dye is a dye widely used in oligonucleotide labeling and automated DNA sequencing applications. DBCO-PEG4-TAMRA is a click chemistry reagent, it contains a DBCO group that can undergo strain-promoted alkyne-azide cycloaddition (SPAAC) with molecules containing Azide groups.
|
-
- HY-132601
-
MRG-106
|
MicroRNA
|
Cancer
|
Cobomarsen (MRG-106) is an oligonucleotide inhibitor of miR-155. Cobomarsen inhibits multiple gene pathways associated with cell survival (including JAK/STAT, MAPK/ERK and PI3K/AKT). Cobomarsen can be used for the research of B-cell lymphoma .
|
-
- HY-D1411
-
DMTr-4'-CF3-5-Methyluridine-CED phosphoramidite
|
DNA Stain
|
Others
|
DMTr-4'-CF3-5-Me-U-CED phosphoramidite (DMTr-4'-CF3-5-Methyluridine-CED phosphoramidite), the modified oligodeoxynucleotide (ODN), is a dye reagent for oligonucleotide labeling, can be used for the research of applications in RNA research .
|
-
- HY-148100A
-
NOX-E36 sodium
|
CCR
|
Cancer
|
Emapticap pegol sodium is a inhibitor of pro-inflammatory chemokine C-C motif-ligand 2 (CCL2). Emapticap pegol sodium is a 40-nucleotide oligonucleotide aptamer, displays different Spiegelmers (L-RNA aptamer) isform in human (NOX-E36) and mouse (mNOX-E36) .
|
-
- HY-148100
-
NOX-E36
|
CCR
|
Inflammation/Immunology
Cancer
|
Emapticap pegol is a inhibitor of pro-inflammatory chemokine C-C motif-ligand 2 (CCL2). Emapticap pegol is a 40-nucleotide oligonucleotide aptamer, displays different Spiegelmers (L-RNA aptamer) isform in human (NOX-E36) and mouse (mNOX-E36) .
|
-
- HY-W039442
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
2′-Deoxy-2′-fluoroadenosine can be used for the synthesis of 2′-Deoxy-2′-fluoro-modified oligonucleotides hybridized with RNA. 2′-Deoxy-2′-fluoroadenosine can be cleaved efficiently by E. coli purine nucleoside phosphorylase (PNP) to the toxic agent 2-fluoroadenine (FAde). 2′-Deoxy-2′-fluoroadenosine shows excellent in vivo activity against tumors expressing E. coli PNP .
|
-
- HY-159696
-
|
GCGR
|
Metabolic Disease
|
ISIS 449884 is a 2'-O-methoxyethyl antisense oligonucleotide that targets GCGR. ISIS 449884 has an ability to reduce hepatic glucose output and lower the blood glucose level. ISIS 449884 can be used for the study of type 2 diabetes mellitus (T2DM) .
|
-
- HY-159696A
-
|
GCGR
|
Metabolic Disease
|
ISIS 449884 sodium is a 2'-O-methoxyethyl antisense oligonucleotide that targets GCGR. ISIS 449884 sodium has an ability to reduce hepatic glucose output and lower the blood glucose level. ISIS 449884 sodium can be used for the study of type 2 diabetes mellitus (T2DM) .
|
-
- HY-132580A
-
BIIB067 sodium; ISIS-SOD1Rx sodium
|
DNA/RNA Synthesis
|
Neurological Disease
|
Tofersen sodium is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen sodium can be used for the research of amyotrophic lateral sclerosis (ALS) .
|
-
- HY-132580
-
BIIB067; ISIS-SOD1Rx
|
DNA/RNA Synthesis
|
Neurological Disease
|
Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS) .
|
-
- HY-148410C
-
STK-001 negative control
|
Sodium Channel
|
Neurological Disease
|
Zorevunensen (STK-001) negative control is the negative control form of Zorevunensen (HY-148410). Zorevunensen is an antisense oligonucleotide that is intended to increase the level of productive SCN1A mRNA and consequently increase the expression of the sodium channel Nav1.1 protein. Zorevunersen is used for the study of Dravet syndrome .
|
-
- HY-D1692
-
|
Fluorescent Dye
|
Others
|
BODIPY 650/665 NHS ester is bright, far-red fluorescent dye that can be used to label the primary amines (R-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules . Ex / Em = 646 / 660 nm
|
-
- HY-171499
-
EL625
|
MDM-2/p53
|
Cancer
|
Cenersen (EL625) is an oligonucleotide targeting TP53. Cenersen can eliminate the activity of TP53 gain-of-function mutants and increase the sensitivity of lymphoma cells to cytotoxic chemotherapy in vitro. Cenersen can be used for the study of chronic lymphocytic leukemia (CLL) .
|
-
- HY-147081
-
AGRO-100
|
Histone Methyltransferase
Bcl-2 Family
|
Cancer
|
AS 1411 (AGRO-100) is an oligonucleotide aptamer targeting nucleoproteins. AS 1411 inhibits tumor cell proliferation by affecting the activity of nucleoprotein-containing complexes and can be used as a carrier to precisely deliver nanoparticles, oligonucleotides and small molecules to cancer cells. AS 1411 reduces PRMT5 expression to inhibit tumor growth in DU145 prostate cancer cells. AS 1411 works by blocking the binding of nucleoproteins to bcl-2 mRNA in MCF-7 breast cancer cells. AS 1411-coupled Jin nanospheres can inhibit breast cancer cell proliferation in vitro and in mouse models, has the ability to cross the blood-brain barrier with low tissue toxicity .
|
-
- HY-D1607
-
|
Fluorescent Dye
|
Others
|
BODIPY FL SSE is a potent fluorescent dye. BODIPY FL SSE is used to label the primary amines (R-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules. BODIPY FL SSE can reactive with primary amines on biomolecules to emit green fluorescence. (λex=502 nm, λem=511 nm) .
|
-
- HY-W570885
-
|
DNA/RNA Synthesis
|
Others
|
2'-O-MOE-rC is a 2'-O-MOE modified nucleoside. 2'-O-MOE-rC can be used for synthesis of DNA .
|
-
- HY-W570888
-
LNA-C(Bz)
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
2'-O,4'-C-Methylenecytidine (LNA-C(Bz)) is a bicyclic nucleoside analogue with fixed N-type conformation. 2'-O,4'-C-Methylenecytidine can be used to synthesize oligonucleotides. 2'-O,4'-C-Methylenecytidine forms duplexes with complementary DNA and RNA strands .
|
-
- HY-110211
-
|
Fluorescent Dye
|
Others
|
BODIPY TMR-X SE is a potent fluorescent dye. BODIPY TMR-X SE can be used to label the primary amines (R-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules. BODIPY TR-X binds to protein or antibody and has bright, orange fluorescent light. (λex=544 nm, λem=570 nm) .
|
-
- HY-150736A
-
|
Toll-like Receptor (TLR)
|
Infection
|
ODN 20844 sodium, a guanine-modified inhibitory oligonucleotide (INH-ODN), is a TLR7 and TLR9 (Toll-like receptor) inhibitor, and its parent is INH-ODN 2088. ODN 20844 sodium disrupts TLR7- and TLR9-mediated immune cell immune responses. ODN 20844 sequence: 5'-TCCTGGCGc7GGGAAGT-3' .
|
-
- HY-110212
-
BODIPY TR-X NHS Ester
|
Fluorescent Dye
|
Others
|
BODIPY TR-X (BODIPY TR-X NHS Ester) is a potent fluorescent dye. BODIPY TR-X can be used to label the primary amines (R-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules. BODIPY TR-X binds to protein or antibody and has bright, red fluorescent light. (λex=545 nm, λem=560 nm) .
|
-
- HY-150736
-
|
Toll-like Receptor (TLR)
|
Infection
Inflammation/Immunology
|
ODN 20844, a guanine-modified inhibitory oligonucleotide (INH-ODN), is a TLR7 and TLR9 (Toll-like receptor) inhibitor, and its parent is INH-ODN 2088. ODN 20844 disrupts TLR7- and TLR9-mediated immune cell immune responses. ODN 20844 sequence: 5'-TCCTGGCGc7GGGAAGT-3' .
|
-
- HY-D0150
-
|
Fluorescent Dye
|
Others
|
Thiazole Orange is an asymmetric anthocyanin dye that can be coupled with oligonucleotides (ONs) to prepare fluorescent hybridization probes. Thiazole Orange has been widely used in biomolecular detection and staining of DNA/ RNA in gels and can be used for reticulocyte analysis. Thiazole orange generates a significant fluorescence enhancement and high quantum yield when it binds with nucleic acids, especially RNA. Thiazole orange can permeate living cell membranes. Thiazole orange can use UV light for detection, but can also be detected with blue light. The excitation and emission of Thiazole orange are λex = 510 nm (488 nm and 470 nm also show strong excitation) and λem = 527 nm, respectively .
|
-
- HY-D1596
-
Cy3.5 NHS ester chloride; Cy 3.5 chloride
|
Fluorescent Dye
|
Others
|
Cyanine 3.5 (Cy3.5 NHS ester) chloride is an analog of Cy3.5 fluorophore. Cyanine 3.5 chloride is a reactive, red fluorescent dye. Cyanine 3.5 chloride is used for labeling of amino-groups in peptides, proteins, and oligonucleotides. (λex=591 nm, λem=604 nm) .
|
-
- HY-66021
-
6-FAM
1 Publications Verification
6-Carboxyfluorescein
|
Fluorescent Dye
|
Others
|
6-FAM (6-Carboxyfluorescein) is an isomer of carboxyfluorescein and is mainly used for sequencing and labeling of nucleic acids.
|
-
- HY-D0053
-
6-Carboxy-X-rhodamine
|
Fluorescent Dye
|
Others
|
6-ROX is a selective fluorescent probe and potential inhibitor of COX-2. 6-ROX binds to the active site of COX-2 and inhibits its conversion of arachidonic acid into prostaglandins. 6-ROX is often used in the field of optical imaging related to tumors and inflammation, and helps detect diseased tissues with high expression of COX-2 .
|
-
- HY-D0049
-
6-TAMRA-NHS ester; 6-Carboxytetramethylrhodamine N-succinimidyl ester
|
DNA Stain
|
Others
|
6-TAMRA-SE (6-TAMRA-NHS ester) is a fluorescent dye carrying the amine reactive group. 6-TAMRA-SE is one of the traditional fluorophores used for automated DNA sequencing .
|
-
- HY-D0913
-
1M7
|
Fluorescent Dye
|
Others
|
1-Methyl-7-nitroisatoic anhydride (1M7) is a reagent that detects local nucleotide flexibility, for probing 2'-hydroxyl reactivity, can be used for RNA structure analysis .
|
-
- HY-D0784
-
5-ROX
1 Publications Verification
5-Carboxy-X-rhodamine
|
Fluorescent Dye
|
Others
|
5-ROX (5-Carboxy-X-rhodamine), a rhodamine dye, exhibits strong fluorescence property in aqueous buffer with the λexit of 580 nm (ε=3.6×10 4 M -1 cm -1), and λemit of 604 nm (=0.94) .
|
-
- HY-D0043
-
5(6)-Carboxy-X-rhodamine
|
DNA Stain
|
Others
|
5(6)-ROX (5(6)-Carboxy-X-rhodamine) is a nucleic acid fluorescent label which can be used as a reference dye for real-time polymerase chain reaction (Em/Ex = 605/585 nm) .
|
-
- HY-D2502
-
|
Fluorescent Dye
|
Others
|
Cy7 hydrazide is a Cy7 (HY-D0825) dye derivative with hydrazine functionality. The hydrazide group of Cy7 hydrazide can form hydrazinone coupling with molecules containing aldehydes or ketones to form covalent bonds .
|
-
- HY-139290A
-
RG4326 sodium
|
MicroRNA
|
Cancer
|
RGLS4326 sodium is a first-in-class, short oligonucleotide inhibitor of microRNA-17 (miR-17). RGLS4326 sodium can be used for the research of autosomal dominant polycystic kidney disease (ADPKD). RGLS4326 sodium inhibits miR-17 function in HeLa cells with an EC50 value of 28.3 nM .
|
-
- HY-150746
-
|
Toll-like Receptor (TLR)
|
Inflammation/Immunology
|
ODN 24991, a guanine-modified inhibitory oligonucleotide (INH-ODN), is a TLR3, TLR7 and TLR9 (Toll-like receptor) inhibitor, and its parent is INH-ODN 2088. ODN 24991 disrupts TLR3-, TLR7- and TLR9-mediated immune cell immune responses. ODN 24991 sequence: 5'-C-C-T-G-G-C-c7rGm-G-G-G-3' .
|
-
- HY-150746A
-
|
Toll-like Receptor (TLR)
|
Inflammation/Immunology
|
ODN 24991 sodium, a guanine-modified inhibitory oligonucleotide (INH-ODN), is a TLR3, TLR7 and TLR9 (Toll-like receptor) inhibitor, and its parent is INH-ODN 2088. ODN 24991 sodium disrupts TLR3-, TLR7- and TLR9-mediated immune cell immune responses. ODN 24991 sequence: 5'-C-C-T-G-G-C-c7rGm-G-G-G-3' .
|
-
- HY-139290
-
RG4326
|
MicroRNA
|
Metabolic Disease
Cancer
|
RGLS4326 (RG4326) is a first-in-class, short oligonucleotide inhibitor of microRNA-17 (miR-17). RGLS4326 can be used for the research of autosomal dominant polycystic kidney disease (ADPKD). RGLS4326 inhibits miR-17 function in HeLa cells with an EC50 value of 28.3 nM .
|
-
- HY-150751
-
ODN A151
|
Toll-like Receptor (TLR)
AIM2
|
Inflammation/Immunology
|
ODN TTAGGG (A151), inhibitory oligonucleotide (ODN), is a TLR9, AIM2 and cGAS antagonist. ODN TTAGGG is immunosuppressive and inhibits AIM2 inflammasome activation, as well as cGAS activation, by competing with DNA. ODN TTAGGG can be used in the study of lupus erythematosus and other related autoimmune diseases. ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3' .
|
-
- HY-150751C
-
ODN A151 sodium
|
AIM2
Toll-like Receptor (TLR)
|
Inflammation/Immunology
|
ODN TTAGGG sodium, inhibitory oligonucleotide (ODN), is a TLR9, AIM2 and cGAS antagonist. ODN TTAGGG sodium is immunosuppressive and inhibits AIM2 inflammasome activation, as well as cGAS activation, by competing with DNA. ODN TTAGGG sodium can be used in the study of lupus erythematosus and other related autoimmune diseases. ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3' .
|
-
- HY-148411
-
LJP 394 free base
|
DNA/RNA Synthesis
|
Inflammation/Immunology
|
Abetimus (LJP 394 free base) is an immunosuppressant consisting of four double-stranded DNA (dsDNA) oligonucleotides. Abetimus is capable of crosslinking anti-dsDNA antibodies on the surface of B cells, and decreases anti-dsDNA antibodies levels. Abetimus has the potential for research of systemic lupus erythematosus .
|
-
- HY-132586
-
NS-065/NCNP-01
|
Nucleoside Antimetabolite/Analog
Dystrophin
|
Metabolic Disease
|
Viltolarsen (NS-065/NCNP-01) is a phosphorodiamidate morpholino antisense oligonucleotide. Viltolarsen binds to exon 53 of the dystrophin mRNA precursor and restores the amino acid open-reading frame by skipping exon 53, resulting in the production of a shortened dystrophin protein that contains essential functional portions. Viltolarsen has the potential for Duchenne muscular dystrophy (DMD) research .
|
-
- HY-147410
-
ION-363
|
DNA/RNA Synthesis
Others
|
Neurological Disease
|
Ulefnersen (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
|
-
- HY-147410A
-
ION-363 sodium
|
Others
DNA/RNA Synthesis
|
Neurological Disease
|
Ulefnersen sodium (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen sodium can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen sodium can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
|
-
- HY-153882
-
-
- HY-132586A
-
NS-065/NCNP-01 sodium
|
Nucleoside Antimetabolite/Analog
Dystrophin
|
Metabolic Disease
|
Viltolarsen (NS-065/NCNP-01) sodium is a phosphorodiamidate morpholino antisense oligonucleotide. Viltolarsen sodium binds to exon 53 of the dystrophin mRNA precursor and restores the amino acid open-reading frame by skipping exon 53, resulting in the production of a shortened dystrophin protein that contains essential functional portions. Viltolarsen sodium has the potential for Duchenne muscular dystrophy (DMD) research .
|
-
- HY-139999
-
|
E3 Ligase Ligand-Linker Conjugates
|
Cancer
|
LCL-PEG3-N3 is a decoy oligonucleotide ligand for E3 ligase which can be used for developing chimeric molecules LCL-ER(dec), degrading the estrogen receptor . LCL-PEG3-N3 is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.
|
-
- HY-139999A
-
|
E3 Ligase Ligand-Linker Conjugates
|
Cancer
|
LCL-PEG3-N3 (hydrochloride) is a decoy oligonucleotide ligand for E3 ligase which can be used for developing chimeric molecules LCL-ER(dec), degrading the estrogen receptor . LCL-PEG3-N3 (hydrochloride) is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.
|
-
- HY-P3392A
-
ION373 sodium
|
FAP
|
Neurological Disease
|
Zilganersen sodium is a glial fibrillary acidic protein (GFAP) inhibitor. Zilganersen sodium can be used in Alexander disease (AxD) research .
|
-
- HY-D1098
-
|
Fluorescent Dye
|
Others
|
SYBR Green II is a fluorescent nucleic acid dye that mainly binds single-stranded nucleotides. SYBR Green II is sensitive to oligonucleotides or larger nucleic acid polymers in a variety of cells and gels. SYBR Green II can be used to study cell structure, membrane integrity or function, and cell cycle distribution. Wavelength 484/515 nm .
|
-
- HY-D1098A
-
|
Fluorescent Dye
|
Others
|
SYBR Green II (Ionic form) is a fluorescent nucleic acid dye that mainly binds single-stranded nucleotides. SYBR Green II is sensitive to oligonucleotides or larger nucleic acid polymers in a variety of cells and gels. SYBR Green II can be used to study cell structure, membrane integrity or function, and cell cycle distribution. Wavelength 484/515 nm .
|
-
- HY-145977
-
|
DNA/RNA Synthesis
|
Others
|
m7GpppGmpG is a trinucleotide 5′ cap analog with the capping efficiencies for the obtained RNAs of 86% .
|
-
- HY-148089
-
|
Transthyretin (TTR)
|
Neurological Disease
|
Eplontersen is a triantennary N-acetyl galactosamine (GalNAc3-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases .
|
-
- HY-128799A
-
-
- HY-128799
-
-
- HY-128799R
-
|
Toll-like Receptor (TLR)
Reactive Oxygen Species (ROS)
|
Inflammation/Immunology
|
CL097 (Standard) is the analytical standard of CL097. This product is intended for research and analytical applications. CL097, a potent TLR7 and TLR8 agonist, induces pro-inflammatory cytokines in macrophages . CL097 induces NADPH oxidase priming, resulting in an increase of the fMLF-stimulated ROS production .
|
-
- HY-W591449
-
|
Liposome
|
Cancer
|
DOPE-PEG-Azide, MW 2000 is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-153725
-
|
Liposome
|
Cancer
|
17:1 Lyso PC is a liposome to simulate biological phospholipid membrane. Liposomes are the main component of vesicles with concentric phospholipid bilayer membranes, which can be used to construct drug delivery systems for anti-cancer and anti-infection fields. Highly polar water-soluble payloads can be trapped in the internal aqueous space of liposomes, while lipophilic payloads can partition into and become part of the lipid bilayer. Especially for delivering antisense oligonucleotides, it can overcome problems such as inefficient cellular uptake and rapid loss in the body .
|
-
- HY-157261
-
|
Others
|
Others
|
UNC2383 is an oligonucleotide enhancing compound that can enhance effects of antisense oligonucleotides (ASOs), and splice switching oligonucleotides (SSOs) .
|
-
- HY-112858
-
|
Biochemical Assay Reagents
|
Others
|
dSPACER is a compound for the phosphoramidite synthesis of oligonucleotides and the creation of the abasic step in the oligonucleotide sequence.Abasic phosphoramidites are used in DNA and oligonucleotide synthesis.
|
-
- HY-148089A
-
|
Transthyretin (TTR)
|
Neurological Disease
|
Eplontersen sodium the sodium salt form of Eplontersen (HY-148089). Eplontersen sodium is a triantennary N-acetyl galactosamine (GalNAc3-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases .
|
-
- HY-D0093
-
EthD-1
|
DNA Stain
|
Others
|
Ethidium homodimer (EthD-1) is a high-affinity fluorescent nucleic acid dye commonly used to stain mammals, bacteria, yeast, and fungi. Ethidium homodimer binds to DNA or RNA, enhancing fluorescence more than 30 times. The Ethidium homodimer has a strong positive charge, so it cannot cross cell membranes and stain living cells; But the Ethidium homodimer can cross the disordered region of the dead cell membrane to reach the nucleus and embed the DNA double strand to produce red fluorescence. Therefore, Ethidium homodimer is a relatively sensitive nucleic acid stain that can accurately detect nucleic acids in solution or in decomposing cells. Ethidium homodimer binds DNA, Ex/Em=528/617 nm .
|
-
- HY-159697A
-
|
GHR
|
Others
|
ISIS 532401 sodium is an oligonucleotide that can target GHr .
|
-
- HY-159697
-
|
GHR
|
Others
|
ISIS 532401 is an oligonucleotide that can target GHr .
|
-
- HY-138584
-
-
- HY-112974
-
GSK-2998728; ISIS-420915
|
Transthyretin (TTR)
|
Others
|
Inotersen is an antisense oligonucleotide that inhibits hepatic production of transthyretin (TTR).
|
-
- HY-160291
-
|
Others
|
Others
|
Trivalent GalNAc-DBCO can be used for oligonucleotide coupling .
|
-
- HY-W726201
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
2'-Deoxy-5'-O-DMT-5-fluorouridine 3'-CE phosphoramidite is a nucleoside phosphoramidite analogue employed in oligonucleotide synthesis. This compound contributes to crafting therapeutic oligonucleotides for drugs targeting cancers.
|
-
- HY-138583
-
-
- HY-W570893
-
|
DNA/RNA Synthesis
|
Others
|
DMT-LNA-G phosphoramidite is a phosphoramidite that can be used in the synthesis of oligonucleotides.
|
-
- HY-171535
-
-
- HY-171522
-
-
- HY-171533
-
-
- HY-171532
-
-
- HY-171521
-
-
- HY-171534
-
-
- HY-171523
-
-
- HY-P0030
-
-
- HY-171526
-
-
- HY-138585
-
-
- HY-W726091
-
-
- HY-148947
-
|
Fluorescent Dye
|
Others
|
Cy5 Phosphoramidite is a fluorescent dye that can be used in the synthesis of oligonucleotides .
|
-
- HY-171525
-
-
- HY-114240
-
|
DNA/RNA Synthesis
|
Others
|
5'-Cholesteryl-TEG phosphoramidite is a phosphoramidite that can be used in the synthesis of oligonucleotides.
|
-
- HY-171527
-
-
- HY-171529
-
-
- HY-171514
-
-
- HY-153481
-
ISIS-107248
|
Integrin
|
Others
|
ATL 1102 is a novel second-generation antisense oligonucleotide to CD49d mRNA
|
-
- HY-171528
-
-
- HY-171513
-
-
- HY-171515
-
-
- HY-171524
-
-
- HY-171519
-
-
- HY-171530
-
-
- HY-153481A
-
ISIS-107248 sodium
|
Integrin
|
Others
|
ATL 1102 sodium is a novel second-generation antisense oligonucleotide to CD49d mRNA
|
-
- HY-W570886
-
-
- HY-139988
-
|
DNA/RNA Synthesis
|
Others
|
2-O-DMT-Sulfonyldiethanol phosphoramidite is a phosphoramidite that can be used in the synthesis of oligonucleotides.
|
-
- HY-154585
-
-
- HY-171516
-
-
- HY-171531
-
-
- HY-D1756
-
|
Fluorescent Dye
|
Others
|
ROX NHS ester, 6-isomer is a highly fluorescent, and photostable rhodamine dye for various applications. ROX labeled oligonucleotide probes are often used in qPCR, and qPCR instruments have ROX channel. This is reactive dye for the labeling of amino-groups in peptides, proteins, and amino-oligonucleotides. Pure single isomer.
|
-
- HY-171520
-
-
- HY-147081A
-
AGRO-100 sodium
|
DNA/RNA Synthesis
|
Cancer
|
AS1411 sodium is a quadruplex-forming oligonucleotide aptamer that targets nucleolin. It has anti-tumor activity.
|
-
- HY-132273
-
-
- HY-W608384
-
-
- HY-153488
-
|
Ras
|
Cancer
|
ISIS-2503 is a 20-mer antisense oligonucleotide that inhibits Ha-Ras expression
|
-
- HY-171517
-
-
- HY-D1892
-
|
Fluorescent Dye
|
Others
|
6-Hexachloro-fluorescein phosphoramidite is a fluorescent probe that can be used for oligonucleotide labeling .
|
-
- HY-W036167
-
|
DNA/RNA Synthesis
|
Others
|
DMT-2'-F-dA Phosphoramidite is a phosphoramidite that can be used in the synthesis of oligonucleotides.
|
-
- HY-153488A
-
|
Ras
|
Cancer
|
ISIS-2503 sodium is a 20-mer antisense oligonucleotide that inhibits Ha-Ras expression
|
-
- HY-D2495
-
|
Fluorescent Dye
|
Others
|
Cy7 SE (nosulfo) is a fluorescent dye for the labeling of amino-groups in peptides, proteins, and oligonucleotides.
|
-
- HY-153249
-
|
DNA/RNA Synthesis
|
Others
|
DMT-2'-F-Cytidine Phosphoramidite is a phosphoramidite that can be used in the synthesis of oligonucleotides.
|
-
- HY-149906C
-
GEM91 sodium
|
HIV
|
Infection
|
Trecovirsen sodium is a 25-mer antisense phosphorothioate oligonucleotide targeted at the gag site of the HIV gene.
|
-
- HY-24126
-
|
Drug Intermediate
|
Others
|
Bis(2-cyanoethyl) diisopropylphosphoramidite is a phosphorite monomer that can be used in the synthesis of oligonucleotides.
|
-
- HY-148413
-
ISIS 3521 sodium
|
PKC
|
Cancer
|
Aprinocarsen (ISIS 3521) sodium, a specific antisense oligonucleotide inhibitor of protein kinase C-alpha (PKC-α). Aprinocarsen sodium is a 20-mer oligonucleotide, it regulates cell differentiation and proliferation. Aprinocarsen sodium inhibits the growth of human tumor cell lines in nude mice. Aprinocarsen sodium shows the value as a chemotherapeutic compound of human cancers .
|
-
- HY-153490A
-
CGP 69846A sodium; ISIS 9271 sodium
|
Raf
|
Cancer
|
ISIS 5132 sodium is a 20-base phosphorothioate oligonucleotide that specifically down-regulates c-raf expression.
|
-
- HY-W579407
-
|
DNA/RNA Synthesis
|
Others
|
DMT-2'-OMe-dA(bz) phosphoramidite is a phosphoramidite that can be used in the synthesis of oligonucleotides.
|
-
- HY-153490
-
CGP 69846A; ISIS 9271
|
Raf
|
Cancer
|
ISIS 5132 is a 20-base phosphorothioate oligonucleotide that specifically down-regulates c-raf expression.
|
-
- HY-W881216
-
-
- HY-W579408
-
|
DNA/RNA Synthesis
|
Others
|
DMT-2'-F-dA(bz) phosphoramidite is a phosphoramidite that can be used in the synthesis of oligonucleotides.
|
-
- HY-W1008618
-
-
- HY-149906
-
GEM91
|
HIV
|
Infection
|
Trecovirsen (GEM91) is a 25-mer antisense phosphorothioate oligonucleotide targeted at the gag site of the HIV gene.
|
-
- HY-W048491
-
|
DNA/RNA Synthesis
|
Others
|
2′-O-(2-Methoxyethyl)adenosine is a compound can be used in the synthesis of oligonucleotides .
|
-
- HY-D1901
-
|
Fluorescent Dye
|
Others
|
FAM-dT phosphoramidite (Compound 21) is a fully protected labelled nucleoside phosphoramidite that can be incorporated into oligonucleotides .
|
-
- HY-21713
-
|
DNA/RNA Synthesis
|
Others
|
DMT-2'O-Methyl-rC(tac) Phosphoramidite is a phosphoramidite that can be used in the synthesis of oligonucleotides.
|
-
- HY-135414B
-
|
Fluorescent Dye
|
Others
|
Cyanine5 NHS ester iodide is a red emitting fluorescent dye for labeling of amino-groups in peptides, proteins, and oligonucleotides .
|
-
- HY-D2245
-
|
Fluorescent Dye
|
Others
|
Cy5.5 phosphoramidite, a cyanine derivative, is a fluorescent labeling reagent for preparing fluorescence-labeled oligonucleotides .
|
-
- HY-D1893
-
|
Fluorescent Dye
|
Others
|
HEX azide, 6-isomer, a derivate of fluorescent dye hexachlorofluorescein (HEX), can be used for labeling oligonucleotides .
|
-
- HY-W784549
-
-
- HY-D1221
-
|
Fluorescent Dye
|
Others
|
6-Fluorescein phosphoramidite is a potent fluorescent dye. 6-Fluorescein phosphoramidite can be used to label oligonucleotides .
|
-
- HY-143230A
-
OGX-011 sodium
|
Apoptosis
|
Cancer
|
Custirsen sodium is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.
|
-
- HY-145725A
-
ISIS 598769; IONIS 598769; BIIB 065; ISIS-DMPK-2.5Rx
|
Ser/Thr Kinase
|
Others
|
Baliforsen is an antisense oligonucleotide (16 nucleotides) designed to target myotonic dystrophy protein kinase (DMPK) mRNA and research myotonic dystrophy.
|
-
- HY-D1897
-
5′-Tetrachlorofluorescein phosphoramidite
|
Fluorescent Dye
|
Others
|
6-TET phosphoramidite (5′-Tetrachlorofluorescein phosphoramidite) is a fluorescent dye that can be used for labeling an oligonucleotide with fluorescein .
|
-
- HY-143230
-
OGX-011
|
Apoptosis
|
Cancer
|
Custirsen is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.
|
-
- HY-W579410
-
|
DNA/RNA Synthesis
|
Others
|
DMT-2'-F-6-chloro-dA phosphoramidite is a phosphoramidite that can be used in the synthesis of oligonucleotides.
|
-
- HY-153479A
-
-
- HY-145727A
-
ISIS 304801 sodium
|
Apolipoprotein
|
Endocrinology
|
Volanesorsen sodium is an antisense oligonucleotide thay targes Apolipoprotein C-III (APOC3)
mRNA. Volanesorsen sodium is used for the study of familial chylomicronemia syndrome.
|
-
- HY-153479
-
-
- HY-148503
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) is a nucleoside phosphoramidite monomer used to synthesize locked nucleic acid (LNA) analog oligonucleotides. It can be used as a building block of antisense oligonucleotides (ASOs) to target complementary RNA sequences. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) locks the furanose ring into an N-type conformation through 2',4'-constrained ethyl (cEt) modification, enhancing hybridization affinity and mismatch discrimination with RNA, while significantly improving the resistance of oligonucleotides to exonuclease digestion. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) mediates RNase H-dependent mRNA degradation or inhibits translation by forming a stable hybrid with RNA, thereby achieving gene expression regulation. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) is mainly used in the development of antisense drugs, gene function research and oligonucleotide synthesis related to disease treatment .
|
-
- HY-D1661
-
|
Fluorescent Dye
|
Others
|
BDP 564/570 NHS ester is a lypophilic orange fluorescein dye, can be used for the labeling of amine containing biomolecules, including amine-modified oligonucleotides.
|
-
- HY-W048490
-
|
DNA/RNA Synthesis
|
Others
|
7-Deaza-2'-deoxy-7-iodoadenosine is a modified oligonucleotide containing 7-Deazaadenine .
|
-
- HY-149906A
-
FITC-GEM91 sodium
|
HIV
|
Infection
|
FITC-Trecovirsen (sodium) is a FITC labeled Trecovirsen. Trecovirsen is a 25-mer antisense phosphorothioate oligonucleotide targeted at the gag site of the HIV gene .
|
-
- HY-D1328
-
|
Fluorescent Dye
|
|
BDP TMR maleimideis one of a class of boron diindolyl methylene (BDI) dyes suitable for TAMRA channels. Commonly used for oligonucleotide labeling and amino acid sequencing.
|
-
- HY-173248
-
|
Biochemical Assay Reagents
|
Others
|
GalNAc-NAG-15 phosphoramidite is a phosphoramidite derivative containing N-acetylgalactosamine (GalNAc) part linked to NAG, which can be used for the synthesis of oligonucleotides.
|
-
- HY-145726
-
|
TNF Receptor
|
Inflammation/Immunology
|
ISIS 104838 is an antisense oligonucleotide agent that reduces the production of tumor necrosis factor (TNF-alpha), a substance that contributes to joint pain and swelling in rheumatoid arthritis.
|
-
- HY-D1329
-
|
Fluorescent Dye
|
|
BDP TMR azideis one of a class of boron diindolyl methylene (BDI) dyes suitable for TAMRA channels. Commonly used for oligonucleotide labeling and amino acid sequencing.
|
-
- HY-W007856
-
5-MeOSA
|
Endogenous Metabolite
|
Others
|
5-Methoxysalicylic acid (5-MeOSA) is a natural compound, used as a useful matrix in the MALDI MS analysis of oligonucleotides when combined with spermine .
|
-
- HY-173246
-
|
Biochemical Assay Reagents
|
Others
|
GalNAc-NAG-25 phosphoramidite is a phosphoramidite derivative containing N-acetylgalactosamine (GalNAc) part linked to NAG, which can be used for the synthesis of oligonucleotides.
|
-
- HY-D145729F
-
|
Fluorescent Dye
STAT
|
Cancer
|
FAM-Danvatirsen is a FAM-labeled Danvatirsen (HY-145729). Danvatirsen is an antisense oligonucleotide targeting STAT3 that can be used in the study of cancer .
|
-
- HY-145726A
-
|
TNF Receptor
|
Inflammation/Immunology
Cancer
|
ISIS 104838 sodium is an antisense oligonucleotide agent that reduces the production of tumor necrosis factor (TNF-alpha), a substance that contributes to joint pain and swelling in rheumatoid arthritis.
|
-
- HY-145722A
-
OGX-427
|
HSP
|
Cancer
|
Apatorsen is an antisense oligonucleotide designed to bind to Hsp27 mRNA, resulting in the inhibition of the production of Hsp27 protein.
|
-
- HY-172398
-
|
Fluorescent Dye
|
Others
|
FAM phosphoramidite, 5-isomer is a standard fluorescein (FAM) phosphoramidite for 5'-terminal oligonucleotide labeling, high isomeric purity single isomer.
|
-
- HY-W1008621
-
|
Biochemical Assay Reagents
|
Others
|
GalNAc-THA C6 phosphoramidite is a phosphoramidite derivative containing N-acetylgalactosamine (GalNAc) part linked to Trishexylamino (THA), which can be used for the synthesis of oligonucleotides.
|
-
- HY-W585407
-
|
Fluorescent Dye
|
Others
|
BDP TMR carboxylic acid is a BDP TMR labeled carboxylic acid. BDP TMR carboxylic acid has the fluorophore BDP and can be used for oligonucleotide labeling and amino acid sequencing .
|
-
- HY-153497
-
IONIS ANGPT-L3Rx; ISIS 703802
|
ANGPTL
|
Metabolic Disease
|
Vupanorsen is an N-acetyl galactosamine-conjugated antisense oligonucleotide that inhibits Angiopoietin-like 3 (ANGPTL3) protein synthesis. Vupanorsen lowers triglycerides and atherogenic lipoproteins.
|
-
- HY-139785
-
AST-008
|
Toll-like Receptor (TLR)
|
Others
Cancer
|
Cavrotolimod is an immunostimulatory spherical nucleic acid (SNA) modified with type B CpG oligonucleotides designed to agonize TLR9 and elicit immune responses useful in oncology applications.
|
-
- HY-D2746
-
|
Fluorescent Dye
|
Others
|
Cy5.5 bis-NHS ester is a reactive cyanine dye containing NHS ester which can be used to label amine groups in peptides, proteins, and oligonucleotides.
|
-
- HY-145624
-
|
Acyltransferase
|
Metabolic Disease
|
Obeversen is an antisense oligonucleotide that inhibits the synthesis of diacylglycerol acyltransferase 2 (DGAT-2). Obeversen can be used in the research of nonalcoholic fatty liver disease .
|
-
- HY-139785A
-
AST-008 sodium
|
Toll-like Receptor (TLR)
|
Others
|
Cavrotolimod sodium is an immunostimulatory spherical nucleic acid (SNA) modified with type B CpG oligonucleotides designed to agonize TLR9 and elicit immune responses useful in oncology applications.
|
-
- HY-145722
-
OGX-427 sodium
|
HSP
|
Cancer
|
Apatorsen (sodium) is an antisense oligonucleotide designed to bind to Hsp27 mRNA, resulting in the inhibition of the production of Hsp27 protein.
|
-
- HY-D1371
-
|
Fluorescent Dye
|
|
BDP TR amine hydrochlorideis one of a class of boron diindolyl methylene (BDI) dyes suitable for TAMRA channels. Commonly used for oligonucleotide labeling and amino acid sequencing.
|
-
- HY-153497A
-
IONIS ANGPT-L3Rx sodium; ISIS 703802 sodium
|
ANGPTL
|
Metabolic Disease
|
Vupanorsen (sodium) is an N-acetyl galactosamine-conjugated antisense oligonucleotide that inhibits Angiopoietin-like 3 (ANGPTL3) protein synthesis. Vupanorsen (sodium) lowers triglycerides and atherogenic lipoproteins.
|
-
- HY-145728A
-
ISIS-2302 sodium
|
Integrin
|
Inflammation/Immunology
|
Alicaforsen sodium is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
|
-
- HY-161766
-
|
TRP Channel
|
Cancer
|
L687 is a potent activator of TRPC3/C6/C7 that can induce cellular uptake of oligonucleotides .
|
-
- HY-145728
-
ISIS-2302
|
Integrin
|
Inflammation/Immunology
|
Alicaforsen is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
|
-
- HY-139787A
-
ISIS-721744; IONIS-PKK-LRX
|
Kallikrein
|
Others
|
Donidalorsen (sodium) is an antisense oligonucleotide designed to reduce the production of prekallikrein (PKK). PKK plays an important role in the activation of inflammatory mediators associated with acute attacks of Hereditary angioedema (HAE).
|
-
- HY-112754A
-
1,2-Dioleoyl-3-trimethylammonium-propane chloride
|
Liposome
|
Cancer
|
DOTAP chloride is a useful and effective cationic lipid for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) with out the use of helper lipid .
|
-
- HY-W744780
-
|
Biochemical Assay Reagents
|
Others
|
Docosahexaenoic Acid N-Succinimide is the succinimide analog of Docosahexaenoic Acid. The NHS ester can be used to label the primary amines (-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules.
|
-
- HY-D1899
-
|
Fluorescent Dye
|
Others
|
VIC phosphoramidite, 6-isomer is a VIC derivative that can be used for conjugating VIC to other molecules. VIC can be used for labeling oligonucleotides at the 5’-end .
|
-
- HY-160884
-
|
DNA/RNA Synthesis
|
Others
|
DMT-2'-OMe-D-Ribitol phosphoramidite (compound 9) is an abasic phosphoramidite monomer that can be used to introduce the abasic group Y34 into oligonucleotides .
|
-
- HY-158826
-
RO 707179
|
HIF/HIF Prolyl-Hydroxylase
|
Cancer
|
EZN-2968 is an antisense oligonucleotide that specifically binds and inhibits the expression of HIF-1α mRNA. EZN-2968, inhibits tumor cell growth.
|
-
- HY-158826A
-
|
HIF/HIF Prolyl-Hydroxylase
|
Cancer
|
EZN-2968 sodium is an antisense oligonucleotide that specifically binds and inhibits the expression of HIF-1α mRNA. EZN-2968 sodium, inhibits tumor cell growth.
|
-
- HY-D1900
-
|
Fluorescent Dye
|
Others
|
VIC azide, 6-isomer is a VIC derivative that can be used for conjugating VIC to other molecules. VIC can be used for labeling oligonucleotides at the 5’-end .
|
-
- HY-154665
-
|
DNA/RNA Synthesis
|
Others
|
N4-Benzoyl-N-DMTr- morpholino-5-methylcytosine-5’-O-phosphoramidite is a phosphoramidite that can be used in the synthesis of oligonucleotides.
|
-
- HY-12854
-
GRN163L
|
Telomerase
|
Cancer
|
Imetelstat is an 13‐mer oligonucleotide that binds with high affinity to the template region of the RNA component of human telomerase and acts as a competitive inhibitor of human telomerase enzymatic activity .
|
-
- HY-164581
-
|
DNA/RNA Synthesis
|
Others
|
DMTr-2'-O-C22-rG-3'-CE-Phosphoramidite (Compound 106) is a phosphoramidite, that can be used for synthesis of oligonucleotide .
|
-
- HY-171498
-
|
Apoptosis
|
Cancer
|
gDIS3-13 is an antisense oligonucleotide targeting the DIS3 gene. gDIS3-13 can reduce cell growth and increase apoptosis in multiple myeloma (MM) .
|
-
- HY-164582
-
|
DNA/RNA Synthesis
|
Others
|
DMTr-2'-O-C22-rC-3'-CE-Phosphoramidite (Compound 114) is a phosphoramidite, that can be used for synthesis of oligonucleotide .
|
-
- HY-164583
-
|
DNA/RNA Synthesis
|
Others
|
DMTr-2'-O-C22-rA-3'-CE-Phosphoramidite (Compound 103) is a phosphoramidite, that can be used for synthesis of oligonucleotide .
|
-
- HY-164623
-
|
Biochemical Assay Reagents
|
Others
|
CUTAG CPG (pore size 1000 Å, 25-35 μmol/g) is a CUTAG-conjugated controlled pore glass (CPG), that can be used for solid phase oligonucleotides synthesis .
|
-
- HY-145724
-
Kyndrisa; GSK2402968A; PRO051
|
DNA/RNA Synthesis
Dystrophin
|
Others
|
Drisapersen, a antisense oligonucleotide, induces exon 51 skipping during dystrophin pre-mRNA splicing and allows synthesis of partially functional dystrophin in Duchenne muscular dystrophy (DMD) patients with amenable mutations.
|
-
- HY-148410A
-
STK-001 sodium
|
Sodium Channel
|
Others
|
Zorevunersen sodium is an antisense oligonucleotide that is intended to increase the level of productive SCN1A mRNA and consequently increase the expression of the sodium channel Nav1.1 protein. Zorevunersen sodium is used for the study of Dravet syndrome.
|
-
- HY-147321
-
|
Tau Protein
HBV
|
Infection
Neurological Disease
|
3'-DMTr-dG(iBu) is a nucleoside for the synthesis of nucleic acid, such as antiviral agents used in the research of viral infection (HBV, HDV), and oligonucleotides against Alzheimer’s disease and other tauopathies .
|
-
- HY-153489A
-
ISIS-CRPRx sodium
|
C-type Lectin-like Receptors (CTLRs)
|
Cardiovascular Disease
|
ISIS 329993 sodium is an antisense oligonucleotide targeting to C-reactive protein (CRP). ISIS-CRPRx sodium has been tested in a rodent model of rheumatoid arthritis (RA) and was shown to improve the clinical signs of arthritis
|
-
- HY-W190937
-
|
Biochemical Assay Reagents
|
Others
|
PC Azido-PEG3-NHS carbonate ester is a photocleavable linker. It can be used to label the primary amines (-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules.
|
-
- HY-D2096
-
|
Fluorescent Dye
|
Others
|
Alexa fluor 647 NHS ester can be used to label Alexa fluor 647 to the primary amines (R-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules .
|
-
- HY-46317
-
|
DNA/RNA Synthesis
|
Others
|
DMT-5Me-dC(Bz)-CE Phosphoramidite is used in the preparation of locked nucleic acids (LNAs) for optimization of fluorescent oligonucleotide probes with improved spectral properties and target binding .
|
-
- HY-D2096A
-
|
Fluorescent Dye
|
Others
|
Alexa fluor 647 NHS ester TEA can be used to label Alexa fluor 647 to the primary amines (R-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules .
|
-
- HY-132581E
-
Scrambled BIIB078; Scrambled IONIS-C9Rx
|
Ras
|
Neurological Disease
|
Scrambled Tadnersen is the Negative Control of Tadnersen sodium (HY-132581A). Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
|
-
- HY-153489
-
ISIS-CRPRx
|
C-type Lectin-like Receptors (CTLRs)
|
Cardiovascular Disease
|
ISIS 329993 (ISIS-CRPRx) is an antisense oligonucleotide targeting to C-reactive protein (CRP). ISIS-CRPRx has been tested in a rodent model of rheumatoid arthritis (RA) and was shown to improve the clinical signs of arthritis
|
-
- HY-D0053A
-
6-Carboxy-X-rhodamine hydrochloride
|
Fluorescent Dye
|
Others
|
6-ROX (6-Carboxy-X-rhodamine) hydrochloride, a fluorescent marker of oligonucleotides, acts as a receptor coupled to 5-FAM and as a donor in FRET imaging. Excitation wavelength: 568 nm. Emission wavelength: 568 nm.
|
-
- HY-147012
-
|
Drug Intermediate
|
Others
|
GalNAc-L96, a triantennary N-acetylgalactosamine (GalNAc), is a ligand of asialoglycoprotein receptor (ASGPR). GalNAc-L96 can be used to synthesize GalNAc-siRNA and can be used for oligonucleotide delivery .
|
-
- HY-167655
-
|
Androgen Receptor
|
Others
|
KF-19418 is an anti-androgen antisense oligonucleotide (ASO) and a hair follicle stimulator. KF-19418 directly stimulated hair follicle in vitro and has hair growth promoting activities in vivo .
|
-
- HY-157549
-
AYX1
|
Nucleoside Antimetabolite/Analog
|
Neurological Disease
|
Brivoligide (AYX1) is a double-stranded, unprotected, 23 base-pair oligonucleotide. Brivoligide can reduce acute post-surgical pain. Brivoligide mimics the DNA sequence normally bound by EGR1 on chromosomes .
|
-
- HY-157549A
-
AYX1 sodium
|
Nucleoside Antimetabolite/Analog
|
Neurological Disease
|
Brivoligide (AYX1) sodium is a double-stranded, unprotected, 23 base-pair oligonucleotide. Brivoligide sodium can reduce acute post-surgical pain. Brivoligide sodium mimics the DNA sequence normally bound by EGR1 on chromosomes .
|
-
- HY-158825
-
CIVI007 sodium
|
PCSK9
|
Metabolic Disease
|
Cepadacursen sodium is a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. Cepadacursen sodium can be used for hypercholesterolemia treatment and the prevention of atherosclerotic cardiovascular disease (ASCVD).
|
-
- HY-108764
-
ISIS 301012
|
Apolipoprotein
HCV
|
Metabolic Disease
|
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
|
-
- HY-W010854
-
dADP disodium
|
DNA/RNA Synthesis
|
Others
|
2'-Deoxyadenosine 5'-di-phos-phate disodium (dADP disodium) is an inhibitor of bacterial poly(A) polymerase. It can be used to synthesize deoxyadenosine oligonucleotides with Escherichia coli polynucleotide phosphorylase and other enzymes .
|
-
- HY-132582A
-
|
Tau Protein
|
Cancer
|
Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
|
-
- HY-148410
-
STK-001
|
Sodium Channel
|
Others
|
Zorevunersen (STK-001) is an antisense oligonucleotide that is intended to increase the level of productive SCN1A mRNA and consequently increase the expression of the sodium channel Nav1.1 protein. Zorevunersen is used for the study of Dravet syndrome.
|
-
- HY-W048495
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
2'-O-(2-Methoxyethyl)-uridine is a synthetic oligonucleotide conversed from uridine. 2'-O-(2-Methoxyethyl)-uridine has the potential for chemotherapeutic agents development .
|
-
- HY-W800819
-
|
Biochemical Assay Reagents
|
Others
|
Arachidic Acid N-Hydroxysuccinimide Ester is a lipid comprised of a saturated fatty acid with a 20-carbon chain with a terminal NHS ester. The NHS ester can be used to label the primary amines (-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules.
|
-
- HY-148370A
-
RG6299 sodium
|
Complement System
|
Others
|
IONIS-FB-LRx sodium is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx sodium effectively reduces circulating levels of CFB, and can be used for geographic atrophy (GA) research .
|
-
- HY-153491
-
ISIS 678354; IONIS-APOCIII-LRx; AKCEA-APOCIII-LRx
|
Apolipoprotein
|
Cardiovascular Disease
|
Olezarsen is an N-acetyl-galactosamine-conjugated antisense oligonucleotide targeted to hepatic APOC3 mRNA to inhibit apolipoprotein C-III (apoC-III) production, in lowering triglyceride levels in patients at high risk for or with established cardiovascular disease.
|
-
- HY-23408
-
|
PROTAC Linkers
|
Cancer
|
Tos-PEG3 is a PEG-based PROTAC linker can be used in the synthesis of PROTACs. Tos-PEG3 (structure 1) can be used for the synthesis of 3'-aminooxy oligonucleotides solid supports .
|
-
- HY-153491A
-
ISIS 678354 sodium; IONIS-APOCIII-LRx sodium; AKCEA-APOCIII-LRx sodium
|
Apolipoprotein
|
Cardiovascular Disease
|
Olezarsen sodium is an N-acetyl-galactosamine-conjugated antisense oligonucleotide targeted to hepatic APOC3 mRNA to inhibit apolipoprotein C-III (apoC-III) production, in lowering triglyceride levels in patients at high risk for or with established cardiovascular disease.
|
-
- HY-153494A
-
PNT100 sodium
|
Bcl-2 Family
|
Cancer
|
PNT100 sodium is a 24-base, chemically unmodified DNA oligonucleotide sequence that is complementary to the regulatory region upstream of the BCL-2 gene. Exposure of tumor cells to PNT100 results in suppression of proliferation and cell death.
|
-
- HY-153494
-
PNT100
|
Bcl-2 Family
|
Cancer
|
PNT100 is a 24-base, chemically unmodified DNA oligonucleotide sequence that is complementary to the regulatory region upstream of the BCL-2 gene. Exposure of tumor cells to PNT100 results in suppression of proliferation and cell death.
|
-
- HY-172284
-
|
Fluorescent Dye
|
Others
|
6-TAMRA cadaverine has achieved prominence as a dye for oligonucleotide labeling and automated DNA sequencing applications. The amino group (NH2) is reactive with carboxylic acids, activated NHS esters, carbonyls (ketone, aldehyde), etc.
|
-
- HY-173247
-
|
Biochemical Assay Reagents
|
Others
|
GalNAc-NAG37 phosphoramidite, a N-acetylgalactosamine (GalNAc) derivative, is a ligand of asialoglycoprotein receptor (ASGPR). GalNAc-NAG37 phosphoramidite can be used to synthesize GalNAc-siRNA and can be used for oligonucleotide delivery .
|
-
- HY-158821A
-
|
TGF-beta/Smad
|
Others
|
ISTH0036 sodium, an antisense oligonucleotide selectively targeting transforming growth factor beta 2 (TGF-β2), can be use in the study of primary open angle glaucoma (POAG) , and wet age-related macular degeneration.
|
-
- HY-155500
-
|
Biochemical Assay Reagents
|
Others
|
Digoxigenin NHS ester is an activated ester which readily reacts with amino groups under mild conditions, attaching the digoxigenin (HY-B1025) moiety to proteins or amino-. Digoxigenin NHS ester can be used to label proteins and oligonucleotides .
|
-
- HY-148828
-
|
iGluR
|
Neurological Disease
|
LSP-GR3 is a novel chemically-modified RNA oligonucleotides, called splice modulating oligomers (SMOs), which potently and specifically modulate GluR alternative splicing to GluR3-flip expression throughout the CNS.
|
-
- HY-148828A
-
|
iGluR
|
Neurological Disease
|
LSP-GR3 sodium is a novel chemically-modified RNA oligonucleotides, called splice modulating oligomers (SMOs), which potently and specifically modulate GluR alternative splicing to GluR3-flip expression throughout the CNS.
|
-
- HY-153836
-
|
Factor Xa
|
Others
|
Anivamersen is an RNA aptamer to reverse the anticoagulant effect of the parenteral factor IXa inhibitor pegnivacogin. REG1 is a novel anticoagulation system consisting of pegnivacogin, an RNA aptamer inhibitor of coagulation factor IXa, and anivamersen, a complementary sequence reversal oligonucleotide.
|
-
- HY-112980A
-
|
DNA/RNA Synthesis
|
Neurological Disease
|
Nusinersen sodium is an antisense oligonucleotide active molecule. Nusinersen sodium modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen sodium improves spinal muscular atrophy .
|
-
- HY-153836A
-
|
Factor Xa
|
Others
|
Anivamersen sodium is an RNA aptamer to reverse the anticoagulant effect of the parenteral factor IXa inhibitor pegnivacogin. REG1 is a novel anticoagulation system consisting of pegnivacogin, an RNA aptamer inhibitor of coagulation factor IXa, and anivamersen, a complementary sequence reversal oligonucleotide.
|
-
- HY-112980
-
|
DNA/RNA Synthesis
|
Neurological Disease
|
Nusinersen is an antisense oligonucleotide active molecule. Nusinersen modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen improves spinal muscular atrophy .
|
-
- HY-145728B
-
(R/S)-ISIS-2302
|
Integrin
|
Inflammation/Immunology
|
(R/S)-Alicaforsen is the racemate of Alicaforsen composed of R and S configurations. Alicaforsen is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
|
-
- HY-158821
-
|
TGF-beta/Smad
|
Others
|
ISTH0036, an antisense oligonucleotide selectively targeting transforming growth factor beta 2 (TGF-β2), can be use in the study of primary open angle glaucoma (POAG), and wet age-related macular degeneration.
|
-
- HY-160226
-
|
STING
|
Inflammation/Immunology
|
ISD (interferon stimulatory DNA) Control sodium is a non-immunostimulatory single-stranded oligonucleotide with the same sequence as ISD (HY-160225), its double-stranded counterpart . ISD Control can be used as a negative control for the CDS agonist ISD.
|
-
- HY-150237
-
|
DNA/RNA Synthesis
Dystrophin
|
Others
|
FITC-labeled Drisapersen (sodium) is Drisapersen labeled with FITC. Drisapersen, a antisense oligonucleotide, induces exon 51 skipping during dystrophin pre-mRNA splicing and allows synthesis of partially functional dystrophin in Duchenne muscular dystrophy (DMD) patients with amenable mutations.
|
-
- HY-145729
-
AZD9150
|
STAT
Apoptosis
|
Cancer
|
Danvatirsen is an antisense oligonucleotide targeting STAT3 with potential antitumor activity. Danvatirsen binds to STAT3 mRNA, thereby inhibiting translation of the transcript. Suppression of STAT3 expression induces tumor cell apoptosis and decreases tumor cell growth.
|
-
- HY-154211
-
|
DNA/RNA Synthesis
|
Others
|
5’-O-DMTr-dU-methyl phosphonamidite; 5’-O-DMTr-2’-deoxyuridine-3’-O-(P-methyl-N,N-diisopropylamino)phosphonamidite is a phosphoramidite that can be used in the synthesis of oligonucleotides.
|
-
- HY-145729A
-
AZD9150 sodium
|
Apoptosis
STAT
|
Cancer
|
Danvatirsen sodium is an antisense oligonucleotide targeting STAT3 with potential antitumor activity. Danvatirsen sodium binds to STAT3 mRNA, thereby inhibiting translation of the transcript. Suppression of STAT3 expression induces tumor cell apoptosis and decreases tumor cell growth.
|
-
- HY-W190907
-
|
Biochemical Assay Reagents
|
Others
|
Trifluoroacetamidoethyl-SS-propionic NHS ester is a cleavable linker containing an NHS ester. The NHS ester can be used to label the primary amines (-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules. The disulfide bond can be cleaved under reduction conditions.
|
-
- HY-147217
-
ISIS 505358
|
HBV
|
Infection
|
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
|
-
- HY-150751A
-
|
Toll-like Receptor (TLR)
|
Inflammation/Immunology
|
Biotin-labeled ODN TTAGGG (sodium), a inhibitory oligonucleotide (ODN), is a TLR9, AIM2 and cGAS antagonist. Biotin-labeled ODN TTAGGG (sodium) can be used to evaluate CpG ODN cellular uptake and localization using a biotin detection system and light microscopy.
|
-
- HY-148370
-
RG6299
|
Complement System
|
Others
|
IONIS-FB-LRx is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx effectively reduces circulating levels of CFB. IONIS-FB-LRx can be used for geographic atrophy (GA) research .
|
-
- HY-132274
-
|
Biochemical Assay Reagents
|
Others
|
DMS(O)MT aminolink C6 for oligonucleotide synthesis. DMS(O)MT is a special protective group similar to traditional MMT, but designed as an improved alternative to it. DMS(O)MT aminolink is fully compatible with standard coupling, deblock, and purification protocols.
|
-
- HY-160040A
-
|
Toll-like Receptor (TLR)
|
Inflammation/Immunology
|
Cobitolimod sodium is a DNA oligonucleotide agonist of TLR-9 with anti-inflammatory activity. Cobitolimod sodium inhibits Th17 cells and induces anti-inflammatory FoxP3 and IL-10 expression, inhibiting the IL-17 signaling pathway .
|
-
- HY-160040
-
|
Toll-like Receptor (TLR)
|
Inflammation/Immunology
|
Cobitolimod is a DNA oligonucleotide agonist of TLR-9 with anti-inflammatory activity. Cobitolimod suppresses Th17 cells and induces anti-inflammatory FoxP3 and IL-10 expression, inhibiting the IL-17 signaling pathway .
|
-
- HY-15942
-
5-TAMRA
2 Publications Verification
|
Fluorescent Dye
|
Others
|
5-TAMRA can produce bright, pH-insensitive orange-red fluorescence (excitation and emission extremes of 546/579) and has good photostability. 5-TAMRA is mainly used as a fluorescent marker for the synthesis and study of specific oligonucleotide probes .
|
-
- HY-W040289
-
|
ADC Linker
|
Cancer
|
Mal-amido-PEG2-NHS ester is a nonclaevable ADC linker containing a maleimide group and an NHS ester. The NHS ester can be used to label the primary amines (-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules .
|
-
- HY-D2267
-
|
Fluorescent Dye
|
Others
|
JF646-Hoechst is a fluorescent red DNA probe that is an ideal substitute for large oligonucleotide-coupled antibodies used in PAINT experiments, especially for bacterial studies. JF646-Hoechst excitation/emission maximum =655/670 nm .
|
-
- HY-W749072
-
|
Fluorescent Dye
|
Others
|
BP Fluor 568 NHS ester is an amine-reactive, orange fluorescent dye routinely used to label proteins or antibodies through the primary amines (Lys), amine-modified oligonucleotides, and other amine-containing biomolecules (Ex/Em: 578 nm/602 nm) .
|
-
- HY-172508
-
|
Fluorescent Dye
|
Others
|
Perylene dU phosphoramidite is a bright and extremely photostable fluorescent polycyclic aromatic hydrocarbon (PAH) label with a quantum yield approaching quantitative. Due to the low lifetime of fluorescence, this probe does not form excimers.With this phosphoramidite, perylene can be introduced into DNA by automated oligonucleotide synthesis.
|
-
- HY-132598A
-
SPC-3649 sodium
|
MicroRNA
|
Infection
|
Miravirsen sodium is a potent miR-122 inhibitor and inhibits the biogenesis of miR-122. Miravirsen sodium is a 15-nucleotide locked nucleic acid-modified phosphorothioate antisense oligonucleotide. Miravirsen sodium inhibits HCV replication, and can be used in research of HCV infection .
|
-
- HY-148230
-
|
Interleukin Related
HIF/HIF Prolyl-Hydroxylase
Autophagy
|
Others
|
TFEB Decoy ODN sodium is a synthetic oligonucleotide with a hairpin ring structure, which were designed to inhibit Transcription factor EB (TFEB). TFEB decoy ODN inhibited fibrosis and autophagy in a UUO mouse model. The TFEB decoy ODNs also showed anti-inflammatory effects.
|
-
- HY-145727
-
ISIS 304801
|
Apolipoprotein
|
Endocrinology
|
Volanesorsen (ISIS 304801) is an antisense oligonucleotide inhibitor of apolipoprotein CIII (apo-CIII) mRNA that reduces triglyceride levels and improves insulin resistance. Volanesorsen is being studied in the treatment of hypertriglyceridemia, familial chylosiderosis syndrome, and type 2 diabetes .
|
-
- HY-W190842
-
|
Biochemical Assay Reagents
|
Others
|
m-PEG2-NHS ester is a PEG linker containing an NHS ester. The NHS ester can be used to label the primary amines (-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules. The hydrophilic PEG spacer increases solubility in aqueous media.
|
-
- HY-W013059R
-
DA-CE phosphoramidite (Standard)
|
Reference Standards
DNA/RNA Synthesis
|
Others
|
DMT-dA(bz) Phosphoramidite (Standard) is the analytical standard of DMT-dA(bz) Phosphoramidite. This product is intended for research and analytical applications. DMT-dA(bz) Phosphoramidite is a phosphoramide monomer for the synthesis of oligonucleotides (ONs) through formation of DNA dimers and trimers via mechanochemistry .
|
-
- HY-W998643
-
|
Fluorescent Dye
|
Others
|
6,8-Difluoro-7-hydroxy-4-methylcoumarin NHS Ester is a molecule with an excitation at 365 nm and emission at 460 nm. The NHS ester can be applied to label the primary amines (-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules.
|
-
- HY-172692
-
|
Liposome
|
Cancer
|
DSPE-PEG1000-TH is a PEG compound which composed of DSPE and a pH-responsive cell penetrating peptide (TH). TH is activated in an acidic environment (such as the tumor microenvironment) and can selectively carry small molecules, oligonucleotides, proteins, etc. into tumor cells .
|
-
- HY-158829
-
|
EGFR
|
Cancer
|
SSOe26 sodium is a 15mer antisense oligonucleotide targeting?HER4. SSOe26 sodium induces exon 26 skipping, leading to the generation of a novel mRNA transcript that excludes exon 26 (CYT2 isoform). SSOe26 sodium decreases tumour growth in mouse xenografts.
|
-
- HY-172694
-
|
Liposome
|
Cancer
|
DSPE-PEG5000-TH is a PEG compound which composed of DSPE and a pH-responsive cell penetrating peptide (TH). TH is activated in an acidic environment (such as the tumor microenvironment) and can selectively carry small molecules, oligonucleotides, proteins, etc. into tumor cells .
|
-
- HY-172693
-
|
Liposome
|
Cancer
|
DSPE-PEG2000-TH is a PEG compound which composed of DSPE and a pH-responsive cell penetrating peptide (TH). TH is activated in an acidic environment (such as the tumor microenvironment) and can selectively carry small molecules, oligonucleotides, proteins, etc. into tumor cells .
|
-
- HY-D1085
-
|
Fluorescent Dye
|
Others
|
AMCA-X-SE is a coumarin derivative that generates fixed blue fluorescence and an NHS-activated ester that forms stable amide bonds with primary amine groups. It is used as a reactive dye for labeling amino groups of peptides, proteins, and oligonucleotides. Maximum excitation/emission wavelength: 354/442 nm .
|
-
- HY-W800446
-
Lna-g amidite
|
Biochemical Assay Reagents
|
Others
|
LNA-Guanosine 3'-CE phosphoramidite (Lna-g amidite) is an essential building block to Locked Nucleic Acid (LNA) oligonucleotide synthesis, which includes a ribonucleoside linked by a methylene unit between the 2’-oxygen and 4’-carbon atoms, paralleling DNA polymer assembly.
|
-
- HY-137721
-
|
Endonuclease
|
Infection
|
Cyclic tri-AMP is a component of the cyclic oligonucleotide-based anti-phage signaling system (CBASS), and acts as the second messenger in the immune response against viral infection. Cyclic tri-AMP binds to and activates DNA endonuclease NucC, results in cell death and exhibits antiviral activity .
|
-
- HY-148827A
-
HYBO-165 sodium
|
PKA
|
Cancer
|
GEM231 sodium is an 18mer antisense oligonucleotide targeting the mRNA of the PKA-I (RIα regulatory subunit of cAMP dependent protein kinase type I ). GEM231 sodium induces cell growth arrest, apoptosis, and differentiation in a variety of cancer cell lines in vitro and in tumors in vivo.
|
-
- HY-150751B
-
|
Toll-like Receptor (TLR)
|
Inflammation/Immunology
|
FITC-labeled ODN TTAGGG (sodium), a inhibitory oligonucleotide (ODN), is a TLR9, AIM2 and cGAS antagonist. FITC-labeled ODN TTAGGG (sodium) can be used to evaluate CpG ODN cellular uptake and localization by confocal laser-scanning microscopy (excitation 495 nm, emission 520 nm) or flow cytometry.
|
-
- HY-148827
-
HYBO-165
|
PKA
|
Cancer
|
GEM231 is an 18mer antisense oligonucleotide targeting the mRNA of the PKA-I (RIα regulatory subunit of cAMP dependent protein kinase type I ). GEM231 induces cell growth arrest, apoptosis, and differentiation in a variety of cancer cell lines in vitro and in tumors in vivo.
|
-
- HY-147217A
-
ISIS 505358 sodium
|
HBV
|
Infection
|
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
|
-
- HY-W250735
-
|
Biochemical Assay Reagents
|
Others
|
NHS-PEG4-biotinidase resistant biotin is a biotinylation reagent with a terminal NHS ester. The hydrophilic PEG spacer increases solubility in aqueous media. The NHS ester can be used to label the primary amines (-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules.
|
-
- HY-158827A
-
|
PCSK9
|
Metabolic Disease
|
AZD8233 sodium, a liver-targeting antisense oligonucleotide (ASO), inhibits subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 sodium increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
|
-
- HY-148505
-
|
Nucleoside Antimetabolite/Analog
|
Infection
Cardiovascular Disease
Metabolic Disease
|
5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite is a potent nucleic acid analog. 5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite blongs to modified antisense oligonucleotide. 5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite allows the formation of a specific conformation of the furanose ring of the oligonucleotide through the introduction of a cEt modification, enhancing the ability to hybridize to complementary RNA. 5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite is mainly used in the research of regulation of gene expression related to metabolic diseases, cardiovascular diseases, cancers and the development of antisense compounds .
|
-
- HY-P1566
-
|
HIV
|
Infection
|
MPG, HIV related is 27-aa peptide, derived from both the nuclear localisation sequence of SV40 large T antigen and the fusion peptide domain of HIV-1 gp41 and is a potent delivery agent for the generalised delivery of nucleic acids and of oligonucleotides into cultured cells.
|
-
- HY-126509
-
|
ADC Linker
|
Cancer
|
Mal-amido-PEG10-C2-NHS ester is a nonclaevable ADC linker containing a maleimide group and an NHS ester. The NHS ester can be used to label the primary amines (-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules .
|
-
- HY-126508
-
|
ADC Linker
|
Cancer
|
Mal-amido-PEG10-C2-NHS ester is a nonclaevable ADC linker containing a maleimide group and an NHS ester. The NHS ester can be used to label the primary amines (-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules
|
-
- HY-154618
-
|
DNA/RNA Synthesis
|
Others
|
N4-Benzoyl-5’-O-(4,4’-dimethoxytrityl)-3’-deoxy-3’-fluoro-beta-D-xylofuranosyl cytidine-2’-CED-phosphoramidite is a phosphoramidite that can be used in the synthesis of oligonucleotides.
|
-
- HY-126507
-
|
ADC Linker
|
Cancer
|
Mal-amido-PEG1-C2-NHS ester is a nonclaevable ADC linker containing a maleimide group and an NHS ester. The NHS ester can be used to label the primary amines (-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules
|
-
- HY-158827
-
|
PCSK9
|
Metabolic Disease
|
AZD8233, a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
|
-
- HY-154080
-
|
DNA/RNA Synthesis
|
Others
|
5’-O-DMTr-2’-FU-methyl phosphonamidite, 5’-O-DMTr-2’-deoxy-2’-fluorouridine-3’-O-(P-methyl-N,N-diisopropylamino) phosphonamidite is a phosphoramidite that can be used in the synthesis of oligonucleotides.
|
-
- HY-D2328
-
Alexa Fluor 680 succinimidyl ester
|
Fluorescent Dye
|
Others
|
Alexa Fluor 680 NHS ester (Alexa Fluor 680 succinimidyl ester) is a near-infrared (NIR) fluorescent dye. NHS esters can be used to label to the primary amines (R-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules (Ex/Em = 679/702 nm) .
|
-
- HY-132584A
-
SRP-4045 sodium
|
Others
Dystrophin
|
Others
|
Casimersen sodium is an antisense oligonucleotide of the phosphorodiamidate morpholino oligomer subclass. Casimersen sodium binds to exon 45 of dystrophin pre-mRNA, restores the open-reading frame (by skipping exon 45) resulting in the production of an internally truncated but functional dystrophin protein. Casimersen sodium can be used for the research of Duchenne muscular dystrophy (DMD) .
|
-
- HY-RI04602
-
|
MicroRNA
|
Others
|
MicroRNA Inhibitor Negative Control is a full-length nucleotide 2'-methoxy modified oligonucleotide, and can be used as a negative control. The sequence of MicroRNA Inhibitor Negative Control is derived from cel-mir-239b. It has minimal sequence identity with miRNAs in human, mouse, and rat.
|
-
MicroRNA Inhibitor Negative Control
MicroRNA Inhibitor Negative Control
- HY-D2737
-
BHQ-2 DMT amidite
|
Fluorescent Dye
|
Others
|
DMT-BH2 amidite (BHQ-2 DMT amidite) is a black quencher dye for the synthesis of dual-labeled oligonucleotide probes for qPCR bearing 5'-quencher. This quencher is ideal for HEX, JOE, ROX, Cyanine5, and other dyes with emissions in the orange and red parts of the spectrum.
|
-
- HY-132598
-
SPC-3649
|
MicroRNA
HCV
|
Infection
Inflammation/Immunology
|
Miravirsen (SPC-3649) is a potent miR-122 inhibitor and inhibits the biogenesis of miR-122. Miravirsen is a 15-nucleotide locked nucleic acid-modified phosphorothioate antisense oligonucleotide. Miravirsen inhibits HCV replication. Miravirsen can be used in research of HCV infection .
|
-
- HY-RI02725
-
|
MicroRNA
|
Cancer
|
mmu-miR-1900 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1900 inhibitor
mmu-miR-1900 inhibitor
- HY-RI03410
-
|
MicroRNA
|
|
mmu-miR-6403 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6403 inhibitor
mmu-miR-6403 inhibitor
- HY-RI03507
-
|
MicroRNA
|
Cancer
|
mmu-miR-684 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-684 inhibitor
mmu-miR-684 inhibitor
- HY-RI02728
-
|
MicroRNA
|
Cancer
|
mmu-miR-1903 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1903 inhibitor
mmu-miR-1903 inhibitor
- HY-RI01130
-
|
MicroRNA
|
Cancer
|
hsa-miR-4511 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4511 inhibitor
hsa-miR-4511 inhibitor
- HY-RI01890
-
|
MicroRNA
|
Cancer
|
hsa-miR-620 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-620 inhibitor
hsa-miR-620 inhibitor
- HY-RI04529
-
|
MicroRNA
|
Cancer
|
rno-miR-6318 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6318 inhibitor
rno-miR-6318 inhibitor
- HY-RI01811
-
|
MicroRNA
|
Cancer
|
hsa-miR-583 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-583 inhibitor
hsa-miR-583 inhibitor
- HY-RI01234
-
|
MicroRNA
|
Cancer
|
hsa-miR-4669 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4669 inhibitor
hsa-miR-4669 inhibitor
- HY-RI01411
-
|
MicroRNA
|
Cancer
|
hsa-miR-4780 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4780 inhibitor
hsa-miR-4780 inhibitor
- HY-RI00819
-
|
MicroRNA
|
Cancer
|
hsa-miR-3714 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3714 inhibitor
hsa-miR-3714 inhibitor
- HY-RI01432
-
|
MicroRNA
|
Cancer
|
hsa-miR-4794 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4794 inhibitor
hsa-miR-4794 inhibitor
- HY-RI01004
-
|
MicroRNA
|
Cancer
|
hsa-miR-4322 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4322 inhibitor
hsa-miR-4322 inhibitor
- HY-RI00066
-
|
MicroRNA
|
Cancer
|
hsa-miR-11401 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-11401 inhibitor
hsa-miR-11401 inhibitor
- HY-RI03415
-
|
MicroRNA
|
Cancer
|
mmu-miR-6408 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6408 inhibitor
mmu-miR-6408 inhibitor
- HY-RI00570
-
|
MicroRNA
|
Cancer
|
hsa-miR-3132 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3132 inhibitor
hsa-miR-3132 inhibitor
- HY-RI01046
-
|
MicroRNA
|
Cancer
|
hsa-miR-4442 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4442 inhibitor
hsa-miR-4442 inhibitor
- HY-RI04566
-
|
MicroRNA
|
Cancer
|
rno-miR-711 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-711 inhibitor
rno-miR-711 inhibitor
- HY-RI03422
-
|
MicroRNA
|
Cancer
|
mmu-miR-6415 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6415 inhibitor
mmu-miR-6415 inhibitor
- HY-RI02421
-
|
MicroRNA
|
Cancer
|
hsa-miR-7706 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-7706 inhibitor
hsa-miR-7706 inhibitor
- HY-RI00964
-
|
MicroRNA
|
Cancer
|
hsa-miR-4285 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4285 inhibitor
hsa-miR-4285 inhibitor
- HY-RI04370
-
|
MicroRNA
|
Cancer
|
rno-miR-346 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-346 inhibitor
rno-miR-346 inhibitor
- HY-RI01391
-
|
MicroRNA
|
Cancer
|
hsa-miR-4767 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4767 inhibitor
hsa-miR-4767 inhibitor
- HY-RI03429
-
|
MicroRNA
|
Cancer
|
mmu-miR-6420 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6420 inhibitor
mmu-miR-6420 inhibitor
- HY-RI00982
-
|
MicroRNA
|
Cancer
|
hsa-miR-4302 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4302 inhibitor
hsa-miR-4302 inhibitor
- HY-RI04404
-
|
MicroRNA
|
Cancer
|
rno-miR-3568 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3568 inhibitor
rno-miR-3568 inhibitor
- HY-RI03337
-
|
MicroRNA
|
Cancer
|
mmu-miR-6239 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6239 inhibitor
mmu-miR-6239 inhibitor
- HY-RI04389
-
|
MicroRNA
|
Cancer
|
rno-miR-3553 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3553 inhibitor
rno-miR-3553 inhibitor
- HY-RI00880
-
|
MicroRNA
|
Cancer
|
hsa-miR-3921 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3921 inhibitor
hsa-miR-3921 inhibitor
- HY-RI00940
-
|
MicroRNA
|
Cancer
|
hsa-miR-4261 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4261 inhibitor
hsa-miR-4261 inhibitor
- HY-RI01248
-
|
MicroRNA
|
Cancer
|
hsa-miR-4679 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4679 inhibitor
hsa-miR-4679 inhibitor
- HY-RI01056
-
|
MicroRNA
|
Cancer
|
hsa-miR-4450 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4450 inhibitor
hsa-miR-4450 inhibitor
- HY-RI03256
-
|
MicroRNA
|
Cancer
|
mmu-miR-5112 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5112 inhibitor
mmu-miR-5112 inhibitor
- HY-RI02727
-
|
MicroRNA
|
Cancer
|
mmu-miR-1902 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1902 inhibitor
mmu-miR-1902 inhibitor
- HY-RI00873
-
|
MicroRNA
|
Cancer
|
hsa-miR-3914 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3914 inhibitor
hsa-miR-3914 inhibitor
- HY-RI00868
-
|
MicroRNA
|
Cancer
|
hsa-miR-3911 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3911 inhibitor
hsa-miR-3911 inhibitor
- HY-RI04428
-
|
MicroRNA
|
Cancer
|
rno-miR-3588 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3588 inhibitor
rno-miR-3588 inhibitor
- HY-RI03406
-
|
MicroRNA
|
Cancer
|
mmu-miR-6399 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6399 inhibitor
mmu-miR-6399 inhibitor
- HY-RI03340
-
|
MicroRNA
|
Cancer
|
mmu-miR-6244 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6244 inhibitor
mmu-miR-6244 inhibitor
- HY-RI01210
-
|
MicroRNA
|
Cancer
|
hsa-miR-4658 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4658 inhibitor
hsa-miR-4658 inhibitor
- HY-RI00476
-
|
MicroRNA
|
Cancer
|
hsa-miR-2278 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-2278 inhibitor
hsa-miR-2278 inhibitor
- HY-RI02768
-
|
MicroRNA
|
Cancer
|
mmu-miR-1949 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1949 inhibitor
mmu-miR-1949 inhibitor
- HY-RI01064
-
|
MicroRNA
|
Cancer
|
hsa-miR-4458 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4458 inhibitor
hsa-miR-4458 inhibitor
- HY-RI04381
-
|
MicroRNA
|
Cancer
|
rno-miR-3544 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3544 inhibitor
rno-miR-3544 inhibitor
- HY-RI03249
-
|
MicroRNA
|
Cancer
|
mmu-miR-5104 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5104 inhibitor
mmu-miR-5104 inhibitor
- HY-RI01837
-
|
MicroRNA
|
Cancer
|
hsa-miR-604 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-604 inhibitor
hsa-miR-604 inhibitor
- HY-RI04152
-
|
MicroRNA
|
Cancer
|
mmu-miR-8104 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8104 inhibitor
mmu-miR-8104 inhibitor
- HY-RI01188
-
|
MicroRNA
|
Cancer
|
hsa-miR-4643 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4643 inhibitor
hsa-miR-4643 inhibitor
- HY-RI03352
-
|
MicroRNA
|
Cancer
|
mmu-miR-6346 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6346 inhibitor
mmu-miR-6346 inhibitor
- HY-RI00725
-
|
MicroRNA
|
Cancer
|
hsa-miR-3609 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3609 inhibitor
hsa-miR-3609 inhibitor
- HY-RI03420
-
|
MicroRNA
|
Cancer
|
mmu-miR-6413 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6413 inhibitor
mmu-miR-6413 inhibitor
- HY-RI02450
-
|
MicroRNA
|
Cancer
|
hsa-miR-8058 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8058 inhibitor
hsa-miR-8058 inhibitor
- HY-RI01166
-
|
MicroRNA
|
Cancer
|
hsa-miR-4538 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4538 inhibitor
hsa-miR-4538 inhibitor
- HY-RI02781
-
|
MicroRNA
|
Cancer
|
mmu-miR-1962 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1962 inhibitor
mmu-miR-1962 inhibitor
- HY-RI00233
-
|
MicroRNA
|
Cancer
|
hsa-miR-1303 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1303 inhibitor
hsa-miR-1303 inhibitor
- HY-RI01857
-
|
MicroRNA
|
Cancer
|
hsa-miR-6082 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6082 inhibitor
hsa-miR-6082 inhibitor
- HY-RI03378
-
|
MicroRNA
|
Cancer
|
mmu-miR-6372 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6372 inhibitor
mmu-miR-6372 inhibitor
- HY-RI04153
-
|
MicroRNA
|
Cancer
|
mmu-miR-8105 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8105 inhibitor
mmu-miR-8105 inhibitor
- HY-RI02463
-
|
MicroRNA
|
Cancer
|
hsa-miR-8071 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8071 inhibitor
hsa-miR-8071 inhibitor
- HY-RI01075
-
|
MicroRNA
|
Cancer
|
hsa-miR-4471 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4471 inhibitor
hsa-miR-4471 inhibitor
- HY-RI03400
-
|
MicroRNA
|
Cancer
|
mmu-miR-6393 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6393 inhibitor
mmu-miR-6393 inhibitor
- HY-RI03505
-
|
MicroRNA
|
Cancer
|
mmu-miR-682 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-682 inhibitor
mmu-miR-682 inhibitor
- HY-RI04522
-
|
MicroRNA
|
Cancer
|
rno-miR-6215 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6215 inhibitor
rno-miR-6215 inhibitor
- HY-RI01066
-
|
MicroRNA
|
Cancer
|
hsa-miR-4462 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4462 inhibitor
hsa-miR-4462 inhibitor
- HY-RI01977
-
|
MicroRNA
|
Cancer
|
hsa-miR-657 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-657 inhibitor
hsa-miR-657 inhibitor
- HY-RI02476
-
|
MicroRNA
|
Cancer
|
hsa-miR-8084 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8084 inhibitor
hsa-miR-8084 inhibitor
- HY-RI00783
-
|
MicroRNA
|
Cancer
|
hsa-miR-3674 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3674 inhibitor
hsa-miR-3674 inhibitor
- HY-RI00899
-
|
MicroRNA
|
Cancer
|
hsa-miR-3939 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3939 inhibitor
hsa-miR-3939 inhibitor
- HY-RI04525
-
|
MicroRNA
|
Cancer
|
rno-miR-6314 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6314 inhibitor
rno-miR-6314 inhibitor
- HY-RI00775
-
|
MicroRNA
|
Cancer
|
hsa-miR-3666 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3666 inhibitor
hsa-miR-3666 inhibitor
- HY-RI03346
-
|
MicroRNA
|
Cancer
|
mmu-miR-6340 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6340 inhibitor
mmu-miR-6340 inhibitor
- HY-RI04161
-
|
MicroRNA
|
Cancer
|
mmu-miR-8113 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8113 inhibitor
mmu-miR-8113 inhibitor
- HY-RI01296
-
|
MicroRNA
|
Cancer
|
hsa-miR-4710 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4710 inhibitor
hsa-miR-4710 inhibitor
- HY-RI01764
-
|
MicroRNA
|
Cancer
|
hsa-miR-5685 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5685 inhibitor
hsa-miR-5685 inhibitor
- HY-RI01746
-
|
MicroRNA
|
Cancer
|
hsa-miR-559 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-559 inhibitor
hsa-miR-559 inhibitor
- HY-RI01240
-
|
MicroRNA
|
Cancer
|
hsa-miR-4673 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4673 inhibitor
hsa-miR-4673 inhibitor
- HY-RI00915
-
|
MicroRNA
|
Cancer
|
hsa-miR-3977 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3977 inhibitor
hsa-miR-3977 inhibitor
- HY-RI00285
-
|
MicroRNA
|
Cancer
|
hsa-miR-1469 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1469 inhibitor
hsa-miR-1469 inhibitor
- HY-RI00590
-
|
MicroRNA
|
Cancer
|
hsa-miR-3146 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3146 inhibitor
hsa-miR-3146 inhibitor
- HY-RI00109
-
|
MicroRNA
|
Cancer
|
hsa-miR-12133 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12133 inhibitor
hsa-miR-12133 inhibitor
- HY-RI02552
-
|
MicroRNA
|
Cancer
|
hsa-miR-9986 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-9986 inhibitor
hsa-miR-9986 inhibitor
- HY-RI01850
-
|
MicroRNA
|
Cancer
|
hsa-miR-6076 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6076 inhibitor
hsa-miR-6076 inhibitor
- HY-RI03385
-
|
MicroRNA
|
Cancer
|
mmu-miR-6379 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6379 inhibitor
mmu-miR-6379 inhibitor
- HY-RI00744
-
|
MicroRNA
|
Cancer
|
hsa-miR-3621 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3621 inhibitor
hsa-miR-3621 inhibitor
- HY-RI00914
-
|
MicroRNA
|
Cancer
|
hsa-miR-3976 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3976 inhibitor
hsa-miR-3976 inhibitor
- HY-RI04531
-
|
MicroRNA
|
Cancer
|
rno-miR-632 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-632 inhibitor
rno-miR-632 inhibitor
- HY-RI01155
-
|
MicroRNA
|
Cancer
|
hsa-miR-4528 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4528 inhibitor
hsa-miR-4528 inhibitor
- HY-RI03361
-
|
MicroRNA
|
Cancer
|
mmu-miR-6355 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6355 inhibitor
mmu-miR-6355 inhibitor
- HY-RI01818
-
|
MicroRNA
|
Cancer
|
hsa-miR-588 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-588 inhibitor
hsa-miR-588 inhibitor
- HY-RI03350
-
|
MicroRNA
|
Cancer
|
mmu-miR-6344 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6344 inhibitor
mmu-miR-6344 inhibitor
- HY-RI03259
-
|
MicroRNA
|
Cancer
|
mmu-miR-5114 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5114 inhibitor
mmu-miR-5114 inhibitor
- HY-RI04502
-
|
MicroRNA
|
Cancer
|
rno-miR-504 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-504 inhibitor
rno-miR-504 inhibitor
- HY-RI01847
-
|
MicroRNA
|
Cancer
|
hsa-miR-6073 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6073 inhibitor
hsa-miR-6073 inhibitor
- HY-RI01344
-
|
MicroRNA
|
Cancer
|
hsa-miR-4739 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4739 inhibitor
hsa-miR-4739 inhibitor
- HY-RI01095
-
|
MicroRNA
|
Cancer
|
hsa-miR-4486 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4486 inhibitor
hsa-miR-4486 inhibitor
- HY-RI00993
-
|
MicroRNA
|
Cancer
|
hsa-miR-4313 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4313 inhibitor
hsa-miR-4313 inhibitor
- HY-RI03412
-
|
MicroRNA
|
|
mmu-miR-6405 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6405 inhibitor
mmu-miR-6405 inhibitor
- HY-RI01076
-
|
MicroRNA
|
Cancer
|
hsa-miR-4472 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4472 inhibitor
hsa-miR-4472 inhibitor
- HY-RI04147
-
|
MicroRNA
|
Cancer
|
mmu-miR-8099 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8099 inhibitor
mmu-miR-8099 inhibitor
- HY-RI01133
-
|
MicroRNA
|
Cancer
|
hsa-miR-4514 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4514 inhibitor
hsa-miR-4514 inhibitor
- HY-RI01843
-
|
MicroRNA
|
Cancer
|
hsa-miR-607 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-607 inhibitor
hsa-miR-607 inhibitor
- HY-RI01856
-
|
MicroRNA
|
Cancer
|
hsa-miR-6081 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6081 inhibitor
hsa-miR-6081 inhibitor
- HY-RI00174
-
|
MicroRNA
|
Cancer
|
hsa-miR-1265 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1265 inhibitor
hsa-miR-1265 inhibitor
- HY-RI02469
-
|
MicroRNA
|
Cancer
|
hsa-miR-8077 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8077 inhibitor
hsa-miR-8077 inhibitor
- HY-RI01840
-
|
MicroRNA
|
Cancer
|
hsa-miR-606 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-606 inhibitor
hsa-miR-606 inhibitor
- HY-RI04536
-
|
MicroRNA
|
Cancer
|
rno-miR-6324 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6324 inhibitor
rno-miR-6324 inhibitor
- HY-RI02482
-
|
MicroRNA
|
Cancer
|
hsa-miR-8485 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8485 inhibitor
hsa-miR-8485 inhibitor
- HY-RI01329
-
|
MicroRNA
|
Cancer
|
hsa-miR-4729 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4729 inhibitor
hsa-miR-4729 inhibitor
- HY-RI00659
-
|
MicroRNA
|
Cancer
|
hsa-miR-3193 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3193 inhibitor
hsa-miR-3193 inhibitor
- HY-RI01027
-
|
MicroRNA
|
Cancer
|
hsa-miR-4428 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4428 inhibitor
hsa-miR-4428 inhibitor
- HY-RI02418
-
|
MicroRNA
|
Cancer
|
hsa-miR-7703 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-7703 inhibitor
hsa-miR-7703 inhibitor
- HY-RI00104
-
|
MicroRNA
|
Cancer
|
hsa-miR-12128 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12128 inhibitor
hsa-miR-12128 inhibitor
- HY-RI00916
-
|
MicroRNA
|
Cancer
|
hsa-miR-3978 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3978 inhibitor
hsa-miR-3978 inhibitor
- HY-RI02575
-
|
MicroRNA
|
Cancer
|
mmu-miR-1190 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1190 inhibitor
mmu-miR-1190 inhibitor
- HY-RI01310
-
|
MicroRNA
|
Cancer
|
hsa-miR-4718 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4718 inhibitor
hsa-miR-4718 inhibitor
- HY-RI02858
-
|
MicroRNA
|
Cancer
|
mmu-miR-2861 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-2861 inhibitor
mmu-miR-2861 inhibitor
- HY-RI00212
-
|
MicroRNA
|
Cancer
|
hsa-miR-1290 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1290 inhibitor
hsa-miR-1290 inhibitor
- HY-RI00758
-
|
MicroRNA
|
Cancer
|
hsa-miR-3652 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3652 inhibitor
hsa-miR-3652 inhibitor
- HY-RI01222
-
|
MicroRNA
|
Cancer
|
hsa-miR-4663 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4663 inhibitor
hsa-miR-4663 inhibitor
- HY-RI01823
-
|
MicroRNA
|
Cancer
|
hsa-miR-591 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-591 inhibitor
hsa-miR-591 inhibitor
- HY-RI01165
-
|
MicroRNA
|
Cancer
|
hsa-miR-4537 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4537 inhibitor
hsa-miR-4537 inhibitor
- HY-RI01161
-
|
MicroRNA
|
Cancer
|
hsa-miR-4534 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4534 inhibitor
hsa-miR-4534 inhibitor
- HY-RI01107
-
|
MicroRNA
|
Cancer
|
hsa-miR-4498 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4498 inhibitor
hsa-miR-4498 inhibitor
- HY-RI00592
-
|
MicroRNA
|
Cancer
|
hsa-miR-3148 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3148 inhibitor
hsa-miR-3148 inhibitor
- HY-RI02828
-
|
MicroRNA
|
Cancer
|
mmu-miR-2139 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-2139 inhibitor
mmu-miR-2139 inhibitor
- HY-RI04528
-
|
MicroRNA
|
Cancer
|
rno-miR-6317 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6317 inhibitor
rno-miR-6317 inhibitor
- HY-RI01897
-
|
MicroRNA
|
Cancer
|
hsa-miR-626 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-626 inhibitor
hsa-miR-626 inhibitor
- HY-RI04149
-
|
MicroRNA
|
Cancer
|
mmu-miR-8101 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8101 inhibitor
mmu-miR-8101 inhibitor
- HY-RI01768
-
|
MicroRNA
|
Cancer
|
hsa-miR-569 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-569 inhibitor
hsa-miR-569 inhibitor
- HY-RI03374
-
|
MicroRNA
|
Cancer
|
mmu-miR-6368 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6368 inhibitor
mmu-miR-6368 inhibitor
- HY-RI02721
-
|
MicroRNA
|
Cancer
|
mmu-miR-1899 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1899 inhibitor
mmu-miR-1899 inhibitor
- HY-RI03419
-
|
MicroRNA
|
Cancer
|
mmu-miR-6412 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6412 inhibitor
mmu-miR-6412 inhibitor
- HY-RI01795
-
|
MicroRNA
|
Cancer
|
hsa-miR-5739 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5739 inhibitor
hsa-miR-5739 inhibitor
- HY-RI01533
-
|
MicroRNA
|
Cancer
|
hsa-miR-5094 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5094 inhibitor
hsa-miR-5094 inhibitor
- HY-RI04437
-
|
MicroRNA
|
Cancer
|
rno-miR-3595 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3595 inhibitor
rno-miR-3595 inhibitor
- HY-RI04225
-
|
MicroRNA
|
Cancer
|
rno-miR-1297 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-1297 inhibitor
rno-miR-1297 inhibitor
- HY-RI02516
-
|
MicroRNA
|
Cancer
|
hsa-miR-933 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-933 inhibitor
hsa-miR-933 inhibitor
- HY-RI00908
-
|
MicroRNA
|
Cancer
|
hsa-miR-3945 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3945 inhibitor
hsa-miR-3945 inhibitor
- HY-RI01145
-
|
MicroRNA
|
Cancer
|
hsa-miR-4522 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4522 inhibitor
hsa-miR-4522 inhibitor
- HY-RI03438
-
|
MicroRNA
|
Cancer
|
mmu-miR-6539 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6539 inhibitor
mmu-miR-6539 inhibitor
- HY-RI02758
-
|
MicroRNA
|
Cancer
|
mmu-miR-1942 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1942 inhibitor
mmu-miR-1942 inhibitor
- HY-RI03430
-
|
MicroRNA
|
Cancer
|
mmu-miR-6481 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6481 inhibitor
mmu-miR-6481 inhibitor
- HY-RI01208
-
|
MicroRNA
|
Cancer
|
hsa-miR-4656 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4656 inhibitor
hsa-miR-4656 inhibitor
- HY-RI00603
-
|
MicroRNA
|
Cancer
|
hsa-miR-3154 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3154 inhibitor
hsa-miR-3154 inhibitor
- HY-RI04538
-
|
MicroRNA
|
Cancer
|
rno-miR-6326 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6326 inhibitor
rno-miR-6326 inhibitor
- HY-RI04362
-
|
MicroRNA
|
Cancer
|
rno-miR-343 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-343 inhibitor
rno-miR-343 inhibitor
- HY-RI01252
-
|
MicroRNA
|
Cancer
|
hsa-miR-4682 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4682 inhibitor
hsa-miR-4682 inhibitor
- HY-RI01559
-
|
MicroRNA
|
Cancer
|
hsa-miR-5186 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5186 inhibitor
hsa-miR-5186 inhibitor
- HY-RI00559
-
|
MicroRNA
|
Cancer
|
hsa-miR-3125 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3125 inhibitor
hsa-miR-3125 inhibitor
- HY-RI00479
-
|
MicroRNA
|
Cancer
|
hsa-miR-2392 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-2392 inhibitor
hsa-miR-2392 inhibitor
- HY-RI03341
-
|
MicroRNA
|
Cancer
|
mmu-miR-6335 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6335 inhibitor
mmu-miR-6335 inhibitor
- HY-RI04329
-
|
MicroRNA
|
Cancer
|
rno-miR-2985 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-2985 inhibitor
rno-miR-2985 inhibitor
- HY-RI02779
-
|
MicroRNA
|
Cancer
|
mmu-miR-1960 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1960 inhibitor
mmu-miR-1960 inhibitor
- HY-RI01013
-
|
MicroRNA
|
Cancer
|
hsa-miR-4329 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4329 inhibitor
hsa-miR-4329 inhibitor
- HY-RI04340
-
|
MicroRNA
|
Cancer
|
rno-miR-3075 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3075 inhibitor
rno-miR-3075 inhibitor
- HY-RI02251
-
|
MicroRNA
|
Cancer
|
hsa-miR-6844 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6844 inhibitor
hsa-miR-6844 inhibitor
- HY-RI01529
-
|
MicroRNA
|
Cancer
|
hsa-miR-5092 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5092 inhibitor
hsa-miR-5092 inhibitor
- HY-RI03625
-
|
MicroRNA
|
Cancer
|
mmu-miR-695 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-695 inhibitor
mmu-miR-695 inhibitor
- HY-RI00111
-
|
MicroRNA
|
Cancer
|
hsa-miR-12136 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12136 inhibitor
hsa-miR-12136 inhibitor
- HY-RI04542
-
|
MicroRNA
|
Cancer
|
rno-miR-6330 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6330 inhibitor
rno-miR-6330 inhibitor
- HY-RI04037
-
|
MicroRNA
|
Cancer
|
mmu-miR-762 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-762 inhibitor
mmu-miR-762 inhibitor
- HY-RI04154
-
|
MicroRNA
|
Cancer
|
mmu-miR-8106 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8106 inhibitor
mmu-miR-8106 inhibitor
- HY-RI01007
-
|
MicroRNA
|
Cancer
|
hsa-miR-4324 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4324 inhibitor
hsa-miR-4324 inhibitor
- HY-RI00954
-
|
MicroRNA
|
Cancer
|
hsa-miR-4275 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4275 inhibitor
hsa-miR-4275 inhibitor
- HY-RI01152
-
|
MicroRNA
|
Cancer
|
hsa-miR-4525 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4525 inhibitor
hsa-miR-4525 inhibitor
- HY-RI00971
-
|
MicroRNA
|
Cancer
|
hsa-miR-4291 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4291 inhibitor
hsa-miR-4291 inhibitor
- HY-RI03339
-
|
MicroRNA
|
Cancer
|
mmu-miR-6241 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6241 inhibitor
mmu-miR-6241 inhibitor
- HY-RI00370
-
|
MicroRNA
|
Cancer
|
hsa-miR-1913 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1913 inhibitor
hsa-miR-1913 inhibitor
- HY-RI00933
-
|
MicroRNA
|
Cancer
|
hsa-miR-4254 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4254 inhibitor
hsa-miR-4254 inhibitor
- HY-RI03270
-
|
MicroRNA
|
Cancer
|
mmu-miR-5125 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5125 inhibitor
mmu-miR-5125 inhibitor
- HY-RI01368
-
|
MicroRNA
|
Cancer
|
hsa-miR-4754 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4754 inhibitor
hsa-miR-4754 inhibitor
- HY-RI01215
-
|
MicroRNA
|
Cancer
|
hsa-miR-466 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-466 inhibitor
hsa-miR-466 inhibitor
- HY-RI02437
-
|
MicroRNA
|
Cancer
|
hsa-miR-7973 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-7973 inhibitor
hsa-miR-7973 inhibitor
- HY-RI04543
-
|
MicroRNA
|
Cancer
|
rno-miR-6331 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6331 inhibitor
rno-miR-6331 inhibitor
- HY-RI04552
-
|
MicroRNA
|
Cancer
|
rno-miR-665 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-665 inhibitor
rno-miR-665 inhibitor
- HY-RI00630
-
|
MicroRNA
|
Cancer
|
hsa-miR-3174 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3174 inhibitor
hsa-miR-3174 inhibitor
- HY-RI03365
-
|
MicroRNA
|
Cancer
|
mmu-miR-6359 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6359 inhibitor
mmu-miR-6359 inhibitor
- HY-RI01014
-
|
MicroRNA
|
Cancer
|
hsa-miR-4330 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4330 inhibitor
hsa-miR-4330 inhibitor
- HY-RI02826
-
|
MicroRNA
|
Cancer
|
mmu-miR-2136 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-2136 inhibitor
mmu-miR-2136 inhibitor
- HY-RI03381
-
|
MicroRNA
|
Cancer
|
mmu-miR-6375 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6375 inhibitor
mmu-miR-6375 inhibitor
- HY-RI02572
-
|
MicroRNA
|
Cancer
|
mmu-miR-1187 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1187 inhibitor
mmu-miR-1187 inhibitor
- HY-RI00962
-
|
MicroRNA
|
Cancer
|
hsa-miR-4283 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4283 inhibitor
hsa-miR-4283 inhibitor
- HY-RI03388
-
|
MicroRNA
|
Cancer
|
mmu-miR-6382 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6382 inhibitor
mmu-miR-6382 inhibitor
- HY-RI01167
-
|
MicroRNA
|
Cancer
|
hsa-miR-4539 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4539 inhibitor
hsa-miR-4539 inhibitor
- HY-RI04561
-
|
MicroRNA
|
Cancer
|
rno-miR-676 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-676 inhibitor
rno-miR-676 inhibitor
- HY-RI01853
-
|
MicroRNA
|
Cancer
|
hsa-miR-6079 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6079 inhibitor
hsa-miR-6079 inhibitor
- HY-RI03417
-
|
MicroRNA
|
Cancer
|
mmu-miR-6410 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6410 inhibitor
mmu-miR-6410 inhibitor
- HY-RI01135
-
|
MicroRNA
|
Cancer
|
hsa-miR-4516 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4516 inhibitor
hsa-miR-4516 inhibitor
- HY-RI02407
-
|
MicroRNA
|
Cancer
|
hsa-miR-760 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-760 inhibitor
hsa-miR-760 inhibitor
- HY-RI01058
-
|
MicroRNA
|
Cancer
|
hsa-miR-4452 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4452 inhibitor
hsa-miR-4452 inhibitor
- HY-RI01176
-
|
MicroRNA
|
Cancer
|
hsa-miR-4634 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4634 inhibitor
hsa-miR-4634 inhibitor
- HY-RI04159
-
|
MicroRNA
|
Cancer
|
mmu-miR-8111 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8111 inhibitor
mmu-miR-8111 inhibitor
- HY-RI01098
-
|
MicroRNA
|
Cancer
|
hsa-miR-4489 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4489 inhibitor
hsa-miR-4489 inhibitor
- HY-RI03372
-
|
MicroRNA
|
Cancer
|
mmu-miR-6366 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6366 inhibitor
mmu-miR-6366 inhibitor
- HY-RI00728
-
|
MicroRNA
|
Cancer
|
hsa-miR-3612 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3612 inhibitor
hsa-miR-3612 inhibitor
- HY-RI01865
-
|
MicroRNA
|
Cancer
|
hsa-miR-6090 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6090 inhibitor
hsa-miR-6090 inhibitor
- HY-RI00802
-
|
MicroRNA
|
Cancer
|
hsa-miR-3686 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3686 inhibitor
hsa-miR-3686 inhibitor
- HY-RI00909
-
|
MicroRNA
|
Cancer
|
hsa-miR-3960 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3960 inhibitor
hsa-miR-3960 inhibitor
- HY-RI01388
-
|
MicroRNA
|
Cancer
|
hsa-miR-4765 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4765 inhibitor
hsa-miR-4765 inhibitor
- HY-RI01097
-
|
MicroRNA
|
Cancer
|
hsa-miR-4488 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4488 inhibitor
hsa-miR-4488 inhibitor
- HY-RI00938
-
|
MicroRNA
|
Cancer
|
hsa-miR-4259 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4259 inhibitor
hsa-miR-4259 inhibitor
- HY-RI03413
-
|
MicroRNA
|
Cancer
|
mmu-miR-6406 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6406 inhibitor
mmu-miR-6406 inhibitor
- HY-RI01080
-
|
MicroRNA
|
Cancer
|
hsa-miR-4475 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4475 inhibitor
hsa-miR-4475 inhibitor
- HY-RI04373
-
|
MicroRNA
|
Cancer
|
rno-miR-349 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-349 inhibitor
rno-miR-349 inhibitor
- HY-RI03379
-
|
MicroRNA
|
Cancer
|
mmu-miR-6373 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6373 inhibitor
mmu-miR-6373 inhibitor
- HY-D2328A
-
Alexa Fluor 680 succinimidyl ester diTEA
|
Fluorescent Dye
|
Others
|
Alexa Fluor 680 NHS ester (Alexa Fluor 680 succinimidyl ester) diTEA is a near-infrared (NIR) fluorescent dye. NHS esters can be used to label to the primary amines (R-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules (Ex/Em = 679/702 nm) .
|
-
- HY-RI00877
-
|
MicroRNA
|
Cancer
|
hsa-miR-3918 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3918 inhibitor
hsa-miR-3918 inhibitor
- HY-RI01910
-
|
MicroRNA
|
Cancer
|
hsa-miR-636 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-636 inhibitor
hsa-miR-636 inhibitor
- HY-RI02534
-
|
MicroRNA
|
Cancer
|
hsa-miR-9500 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-9500 inhibitor
hsa-miR-9500 inhibitor
- HY-RI00996
-
|
MicroRNA
|
Cancer
|
hsa-miR-4315 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4315 inhibitor
hsa-miR-4315 inhibitor
- HY-RI01906
-
|
MicroRNA
|
Cancer
|
hsa-miR-632 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-632 inhibitor
hsa-miR-632 inhibitor
- HY-RI00229
-
|
MicroRNA
|
Cancer
|
hsa-miR-1299 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1299 inhibitor
hsa-miR-1299 inhibitor
- HY-RI00989
-
|
MicroRNA
|
Cancer
|
hsa-miR-4309 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4309 inhibitor
hsa-miR-4309 inhibitor
- HY-RI01789
-
|
MicroRNA
|
Cancer
|
hsa-miR-5706 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5706 inhibitor
hsa-miR-5706 inhibitor
- HY-RI01088
-
|
MicroRNA
|
Cancer
|
hsa-miR-4481 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4481 inhibitor
hsa-miR-4481 inhibitor
- HY-RI03367
-
|
MicroRNA
|
Cancer
|
mmu-miR-6361 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6361 inhibitor
mmu-miR-6361 inhibitor
- HY-RI01059
-
|
MicroRNA
|
Cancer
|
hsa-miR-4453 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4453 inhibitor
hsa-miR-4453 inhibitor
- HY-RI04545
-
|
MicroRNA
|
Cancer
|
rno-miR-6333 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6333 inhibitor
rno-miR-6333 inhibitor
- HY-RI01410
-
|
MicroRNA
|
Cancer
|
hsa-miR-4779 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4779 inhibitor
hsa-miR-4779 inhibitor
- HY-RI02731
-
|
MicroRNA
|
Cancer
|
mmu-miR-1906 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1906 inhibitor
mmu-miR-1906 inhibitor
- HY-RI02474
-
|
MicroRNA
|
Cancer
|
hsa-miR-8082 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8082 inhibitor
hsa-miR-8082 inhibitor
- HY-RI01031
-
|
MicroRNA
|
Cancer
|
hsa-miR-4432 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4432 inhibitor
hsa-miR-4432 inhibitor
- HY-RI01921
-
|
MicroRNA
|
Cancer
|
hsa-miR-645 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-645 inhibitor
hsa-miR-645 inhibitor
- HY-RI04526
-
|
MicroRNA
|
Cancer
|
rno-miR-6315 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6315 inhibitor
rno-miR-6315 inhibitor
- HY-RI02546
-
|
MicroRNA
|
Cancer
|
hsa-miR-9900 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-9900 inhibitor
hsa-miR-9900 inhibitor
- HY-RI01129
-
|
MicroRNA
|
Cancer
|
hsa-miR-4510 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4510 inhibitor
hsa-miR-4510 inhibitor
- HY-RI00685
-
|
MicroRNA
|
Cancer
|
hsa-miR-326 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-326 inhibitor
hsa-miR-326 inhibitor
- HY-RI03863
-
|
MicroRNA
|
Cancer
|
mmu-miR-706 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-706 inhibitor
mmu-miR-706 inhibitor
- HY-RI01120
-
|
MicroRNA
|
Cancer
|
hsa-miR-4506 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4506 inhibitor
hsa-miR-4506 inhibitor
- HY-RI01886
-
|
MicroRNA
|
Cancer
|
hsa-miR-617 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-617 inhibitor
hsa-miR-617 inhibitor
- HY-RI02411
-
|
MicroRNA
|
Cancer
|
hsa-miR-765 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-765 inhibitor
hsa-miR-765 inhibitor
- HY-RI03418
-
|
MicroRNA
|
Cancer
|
mmu-miR-6411 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6411 inhibitor
mmu-miR-6411 inhibitor
- HY-RI02449
-
|
MicroRNA
|
Cancer
|
hsa-miR-8057 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8057 inhibitor
hsa-miR-8057 inhibitor
- HY-RI01858
-
|
MicroRNA
|
Cancer
|
hsa-miR-6083 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6083 inhibitor
hsa-miR-6083 inhibitor
- HY-RI01311
-
|
MicroRNA
|
Cancer
|
hsa-miR-4719 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4719 inhibitor
hsa-miR-4719 inhibitor
- HY-RI04371
-
|
MicroRNA
|
Cancer
|
rno-miR-347 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-347 inhibitor
rno-miR-347 inhibitor
- HY-RI00088
-
|
MicroRNA
|
Cancer
|
hsa-miR-1208 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1208 inhibitor
hsa-miR-1208 inhibitor
- HY-RI01530
-
|
MicroRNA
|
Cancer
|
hsa-miR-5093 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5093 inhibitor
hsa-miR-5093 inhibitor
- HY-RI03938
-
|
MicroRNA
|
Cancer
|
mmu-miR-711 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-711 inhibitor
mmu-miR-711 inhibitor
- HY-RI04413
-
|
MicroRNA
|
Cancer
|
rno-miR-3576 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3576 inhibitor
rno-miR-3576 inhibitor
- HY-RI01871
-
|
MicroRNA
|
Cancer
|
hsa-miR-6127 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6127 inhibitor
hsa-miR-6127 inhibitor
- HY-RI01267
-
|
MicroRNA
|
Cancer
|
hsa-miR-4692 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4692 inhibitor
hsa-miR-4692 inhibitor
- HY-RI03344
-
|
MicroRNA
|
Cancer
|
mmu-miR-6338 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6338 inhibitor
mmu-miR-6338 inhibitor
- HY-RI00197
-
|
MicroRNA
|
Cancer
|
hsa-miR-1281 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1281 inhibitor
hsa-miR-1281 inhibitor
- HY-RI01849
-
|
MicroRNA
|
Cancer
|
hsa-miR-6075 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6075 inhibitor
hsa-miR-6075 inhibitor
- HY-RI04530
-
|
MicroRNA
|
Cancer
|
rno-miR-6319 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6319 inhibitor
rno-miR-6319 inhibitor
- HY-RI02518
-
|
MicroRNA
|
Cancer
|
hsa-miR-934 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-934 inhibitor
hsa-miR-934 inhibitor
- HY-RI01424
-
|
MicroRNA
|
Cancer
|
hsa-miR-4788 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4788 inhibitor
hsa-miR-4788 inhibitor
- HY-RI04384
-
|
MicroRNA
|
Cancer
|
rno-miR-3548 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3548 inhibitor
rno-miR-3548 inhibitor
- HY-RI03336
-
|
MicroRNA
|
Cancer
|
mmu-miR-6238 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6238 inhibitor
mmu-miR-6238 inhibitor
- HY-RI00780
-
|
MicroRNA
|
Cancer
|
hsa-miR-3671 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3671 inhibitor
hsa-miR-3671 inhibitor
- HY-RI02726
-
|
MicroRNA
|
Cancer
|
mmu-miR-1901 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1901 inhibitor
mmu-miR-1901 inhibitor
- HY-RI01048
-
|
MicroRNA
|
Cancer
|
hsa-miR-4444 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4444 inhibitor
hsa-miR-4444 inhibitor
- HY-RI03373
-
|
MicroRNA
|
Cancer
|
mmu-miR-6367 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6367 inhibitor
mmu-miR-6367 inhibitor
- HY-RI04407
-
|
MicroRNA
|
Cancer
|
rno-miR-3571 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3571 inhibitor
rno-miR-3571 inhibitor
- HY-RI03338
-
|
MicroRNA
|
Cancer
|
mmu-miR-6240 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6240 inhibitor
mmu-miR-6240 inhibitor
- HY-RI03954
-
|
MicroRNA
|
Cancer
|
mmu-miR-718 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-718 inhibitor
mmu-miR-718 inhibitor
- HY-RI03403
-
|
MicroRNA
|
Cancer
|
mmu-miR-6396 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6396 inhibitor
mmu-miR-6396 inhibitor
- HY-RI01778
-
|
MicroRNA
|
Cancer
|
hsa-miR-5697 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5697 inhibitor
hsa-miR-5697 inhibitor
- HY-RI03425
-
|
MicroRNA
|
Cancer
|
mmu-miR-6417 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6417 inhibitor
mmu-miR-6417 inhibitor
- HY-RI03263
-
|
MicroRNA
|
Cancer
|
mmu-miR-5119 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5119 inhibitor
mmu-miR-5119 inhibitor
- HY-RI01187
-
|
MicroRNA
|
Cancer
|
hsa-miR-4642 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4642 inhibitor
hsa-miR-4642 inhibitor
- HY-RI00934
-
|
MicroRNA
|
Cancer
|
hsa-miR-4255 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4255 inhibitor
hsa-miR-4255 inhibitor
- HY-RI01117
-
|
MicroRNA
|
Cancer
|
hsa-miR-4503 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4503 inhibitor
hsa-miR-4503 inhibitor
- HY-RI04586
-
|
MicroRNA
|
Cancer
|
rno-miR-876 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-876 inhibitor
rno-miR-876 inhibitor
- HY-RI03133
-
|
MicroRNA
|
Cancer
|
mmu-miR-3969 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-3969 inhibitor
mmu-miR-3969 inhibitor
- HY-RI00082
-
|
MicroRNA
|
Cancer
|
hsa-miR-1202 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1202 inhibitor
hsa-miR-1202 inhibitor
- HY-RI01716
-
|
MicroRNA
|
Cancer
|
hsa-miR-553 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-553 inhibitor
hsa-miR-553 inhibitor
- HY-RI02769
-
|
MicroRNA
|
Cancer
|
mmu-miR-1950 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1950 inhibitor
mmu-miR-1950 inhibitor
- HY-RI04415
-
|
MicroRNA
|
Cancer
|
rno-miR-3578 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3578 inhibitor
rno-miR-3578 inhibitor
- HY-RI00942
-
|
MicroRNA
|
Cancer
|
hsa-miR-4263 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4263 inhibitor
hsa-miR-4263 inhibitor
- HY-RI00156
-
|
MicroRNA
|
Cancer
|
hsa-miR-1253 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1253 inhibitor
hsa-miR-1253 inhibitor
- HY-RI00616
-
|
MicroRNA
|
Cancer
|
hsa-miR-3161 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3161 inhibitor
hsa-miR-3161 inhibitor
- HY-RI01159
-
|
MicroRNA
|
Cancer
|
hsa-miR-4531 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4531 inhibitor
hsa-miR-4531 inhibitor
- HY-RI01445
-
|
MicroRNA
|
Cancer
|
hsa-miR-4801 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4801 inhibitor
hsa-miR-4801 inhibitor
- HY-RI03953
-
|
MicroRNA
|
Cancer
|
mmu-miR-717 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-717 inhibitor
mmu-miR-717 inhibitor
- HY-RI01019
-
|
MicroRNA
|
Cancer
|
hsa-miR-4421 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4421 inhibitor
hsa-miR-4421 inhibitor
- HY-RI00290
-
|
MicroRNA
|
Cancer
|
hsa-miR-1470 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1470 inhibitor
hsa-miR-1470 inhibitor
- HY-RI03437
-
|
MicroRNA
|
Cancer
|
mmu-miR-6538 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6538 inhibitor
mmu-miR-6538 inhibitor
- HY-RI04427
-
|
MicroRNA
|
Cancer
|
rno-miR-3587 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3587 inhibitor
rno-miR-3587 inhibitor
- HY-RI02827
-
|
MicroRNA
|
Cancer
|
mmu-miR-2137 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-2137 inhibitor
mmu-miR-2137 inhibitor
- HY-RI01474
-
|
MicroRNA
|
Cancer
|
hsa-miR-496 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-496 inhibitor
hsa-miR-496 inhibitor
- HY-RI00755
-
|
MicroRNA
|
Cancer
|
hsa-miR-3649 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3649 inhibitor
hsa-miR-3649 inhibitor
- HY-RI01580
-
|
MicroRNA
|
Cancer
|
hsa-miR-5194 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5194 inhibitor
hsa-miR-5194 inhibitor
- HY-RI01877
-
|
MicroRNA
|
Cancer
|
hsa-miR-6132 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6132 inhibitor
hsa-miR-6132 inhibitor
- HY-RI01000
-
|
MicroRNA
|
Cancer
|
hsa-miR-4318 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4318 inhibitor
hsa-miR-4318 inhibitor
- HY-RI04544
-
|
MicroRNA
|
Cancer
|
rno-miR-6332 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6332 inhibitor
rno-miR-6332 inhibitor
- HY-RI03257
-
|
MicroRNA
|
Cancer
|
mmu-miR-5113 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5113 inhibitor
mmu-miR-5113 inhibitor
- HY-RI00874
-
|
MicroRNA
|
Cancer
|
hsa-miR-3915 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3915 inhibitor
hsa-miR-3915 inhibitor
- HY-RI01289
-
|
MicroRNA
|
Cancer
|
hsa-miR-4706 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4706 inhibitor
hsa-miR-4706 inhibitor
- HY-RI00073
-
|
MicroRNA
|
Cancer
|
hsa-miR-1183 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1183 inhibitor
hsa-miR-1183 inhibitor
- HY-RI01262
-
|
MicroRNA
|
Cancer
|
hsa-miR-4689 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4689 inhibitor
hsa-miR-4689 inhibitor
- HY-RI02439
-
|
MicroRNA
|
Cancer
|
hsa-miR-7975 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-7975 inhibitor
hsa-miR-7975 inhibitor
- HY-RI03261
-
|
MicroRNA
|
Cancer
|
mmu-miR-5116 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5116 inhibitor
mmu-miR-5116 inhibitor
- HY-RI00555
-
|
MicroRNA
|
Cancer
|
hsa-miR-3122 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3122 inhibitor
hsa-miR-3122 inhibitor
- HY-RI02462
-
|
MicroRNA
|
Cancer
|
hsa-miR-8070 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8070 inhibitor
hsa-miR-8070 inhibitor
- HY-RI01763
-
|
MicroRNA
|
Cancer
|
hsa-miR-5684 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5684 inhibitor
hsa-miR-5684 inhibitor
- HY-RI00317
-
|
MicroRNA
|
Cancer
|
hsa-miR-1587 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1587 inhibitor
hsa-miR-1587 inhibitor
- HY-RI00939
-
|
MicroRNA
|
Cancer
|
hsa-miR-4260 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4260 inhibitor
hsa-miR-4260 inhibitor
- HY-RI01808
-
|
MicroRNA
|
Cancer
|
hsa-miR-581 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-581 inhibitor
hsa-miR-581 inhibitor
- HY-RI01791
-
|
MicroRNA
|
Cancer
|
hsa-miR-5708 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5708 inhibitor
hsa-miR-5708 inhibitor
- HY-RI01114
-
|
MicroRNA
|
Cancer
|
hsa-miR-4500 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4500 inhibitor
hsa-miR-4500 inhibitor
- HY-RI00760
-
|
MicroRNA
|
Cancer
|
hsa-miR-3655 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3655 inhibitor
hsa-miR-3655 inhibitor
- HY-RI00550
-
|
MicroRNA
|
Cancer
|
hsa-miR-3119 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3119 inhibitor
hsa-miR-3119 inhibitor
- HY-RI00291
-
|
MicroRNA
|
Cancer
|
hsa-miR-1471 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1471 inhibitor
hsa-miR-1471 inhibitor
- HY-RI02773
-
|
MicroRNA
|
Cancer
|
mmu-miR-1954 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1954 inhibitor
mmu-miR-1954 inhibitor
- HY-RI03248
-
|
MicroRNA
|
Cancer
|
mmu-miR-5103 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5103 inhibitor
mmu-miR-5103 inhibitor
- HY-RI01347
-
|
MicroRNA
|
Cancer
|
hsa-miR-4741 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4741 inhibitor
hsa-miR-4741 inhibitor
- HY-RI01790
-
|
MicroRNA
|
Cancer
|
hsa-miR-5707 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5707 inhibitor
hsa-miR-5707 inhibitor
- HY-RI04150
-
|
MicroRNA
|
Cancer
|
mmu-miR-8102 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8102 inhibitor
mmu-miR-8102 inhibitor
- HY-RI01131
-
|
MicroRNA
|
Cancer
|
hsa-miR-4512 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4512 inhibitor
hsa-miR-4512 inhibitor
- HY-RI02780
-
|
MicroRNA
|
Cancer
|
mmu-miR-1961 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1961 inhibitor
mmu-miR-1961 inhibitor
- HY-RI03414
-
|
MicroRNA
|
|
mmu-miR-6407 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6407 inhibitor
mmu-miR-6407 inhibitor
- HY-RI04541
-
|
MicroRNA
|
Cancer
|
rno-miR-6329 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6329 inhibitor
rno-miR-6329 inhibitor
- HY-RI02539
-
|
MicroRNA
|
Cancer
|
hsa-miR-9718 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-9718 inhibitor
hsa-miR-9718 inhibitor
- HY-RI00952
-
|
MicroRNA
|
Cancer
|
hsa-miR-4273 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4273 inhibitor
hsa-miR-4273 inhibitor
- HY-RI03393
-
|
MicroRNA
|
Cancer
|
mmu-miR-6387 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6387 inhibitor
mmu-miR-6387 inhibitor
- HY-RI01467
-
|
MicroRNA
|
Cancer
|
hsa-miR-492 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-492 inhibitor
hsa-miR-492 inhibitor
- HY-RI04292
-
|
MicroRNA
|
Cancer
|
rno-miR-205 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-205 inhibitor
rno-miR-205 inhibitor
- HY-RI01200
-
|
MicroRNA
|
Cancer
|
hsa-miR-4651 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4651 inhibitor
hsa-miR-4651 inhibitor
- HY-RI02771
-
|
MicroRNA
|
Cancer
|
mmu-miR-1952 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1952 inhibitor
mmu-miR-1952 inhibitor
- HY-RI03363
-
|
MicroRNA
|
Cancer
|
mmu-miR-6357 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6357 inhibitor
mmu-miR-6357 inhibitor
- HY-RI00966
-
|
MicroRNA
|
Cancer
|
hsa-miR-4287 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4287 inhibitor
hsa-miR-4287 inhibitor
- HY-RI00967
-
|
MicroRNA
|
Cancer
|
hsa-miR-4288 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4288 inhibitor
hsa-miR-4288 inhibitor
- HY-RI02467
-
|
MicroRNA
|
Cancer
|
hsa-miR-8075 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8075 inhibitor
hsa-miR-8075 inhibitor
- HY-RI03504
-
|
MicroRNA
|
Cancer
|
mmu-miR-681 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-681 inhibitor
mmu-miR-681 inhibitor
- HY-RI04294
-
|
MicroRNA
|
Cancer
|
rno-miR-207 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-207 inhibitor
rno-miR-207 inhibitor
- HY-RI03128
-
|
MicroRNA
|
Cancer
|
mmu-miR-3964 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-3964 inhibitor
mmu-miR-3964 inhibitor
- HY-RI01754
-
|
MicroRNA
|
Cancer
|
hsa-miR-563 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-563 inhibitor
hsa-miR-563 inhibitor
- HY-RI00098
-
|
MicroRNA
|
Cancer
|
hsa-miR-12122 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12122 inhibitor
hsa-miR-12122 inhibitor
- HY-RI04412
-
|
MicroRNA
|
Cancer
|
rno-miR-3575 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3575 inhibitor
rno-miR-3575 inhibitor
- HY-RI03134
-
|
MicroRNA
|
Cancer
|
mmu-miR-3970 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-3970 inhibitor
mmu-miR-3970 inhibitor
- HY-RI00074
-
|
MicroRNA
|
Cancer
|
hsa-miR-1184 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1184 inhibitor
hsa-miR-1184 inhibitor
- HY-RI03335
-
|
MicroRNA
|
Cancer
|
mmu-miR-6237 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6237 inhibitor
mmu-miR-6237 inhibitor
- HY-RI04339
-
|
MicroRNA
|
Cancer
|
rno-miR-3072 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3072 inhibitor
rno-miR-3072 inhibitor
- HY-RI01835
-
|
MicroRNA
|
Cancer
|
hsa-miR-602 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-602 inhibitor
hsa-miR-602 inhibitor
- HY-RI00162
-
|
MicroRNA
|
Cancer
|
hsa-miR-1258 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1258 inhibitor
hsa-miR-1258 inhibitor
- HY-RI01205
-
|
MicroRNA
|
Cancer
|
hsa-miR-4654 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4654 inhibitor
hsa-miR-4654 inhibitor
- HY-RI04145
-
|
MicroRNA
|
Cancer
|
mmu-miR-8097 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8097 inhibitor
mmu-miR-8097 inhibitor
- HY-RI04318
-
|
MicroRNA
|
Cancer
|
rno-miR-290 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-290 inhibitor
rno-miR-290 inhibitor
- HY-RI00636
-
|
MicroRNA
|
Cancer
|
hsa-miR-3179 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3179 inhibitor
hsa-miR-3179 inhibitor
- HY-RI01092
-
|
MicroRNA
|
Cancer
|
hsa-miR-4484 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4484 inhibitor
hsa-miR-4484 inhibitor
- HY-RI02362
-
|
MicroRNA
|
Cancer
|
hsa-miR-711 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-711 inhibitor
hsa-miR-711 inhibitor
- HY-RI04160
-
|
MicroRNA
|
Cancer
|
mmu-miR-8112 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8112 inhibitor
mmu-miR-8112 inhibitor
- HY-RI01769
-
|
MicroRNA
|
Cancer
|
hsa-miR-5690 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5690 inhibitor
hsa-miR-5690 inhibitor
- HY-RI01067
-
|
MicroRNA
|
Cancer
|
hsa-miR-4463 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4463 inhibitor
hsa-miR-4463 inhibitor
- HY-RI01626
-
|
MicroRNA
|
Cancer
|
hsa-miR-543 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-543 inhibitor
hsa-miR-543 inhibitor
- HY-RI04162
-
|
MicroRNA
|
Cancer
|
mmu-miR-8114 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8114 inhibitor
mmu-miR-8114 inhibitor
- HY-RI01123
-
|
MicroRNA
|
Cancer
|
hsa-miR-4509 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4509 inhibitor
hsa-miR-4509 inhibitor
- HY-RI02472
-
|
MicroRNA
|
Cancer
|
hsa-miR-8080 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8080 inhibitor
hsa-miR-8080 inhibitor
- HY-RI04537
-
|
MicroRNA
|
Cancer
|
rno-miR-6325 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6325 inhibitor
rno-miR-6325 inhibitor
- HY-RI01053
-
|
MicroRNA
|
Cancer
|
hsa-miR-4447 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4447 inhibitor
hsa-miR-4447 inhibitor
- HY-RI02410
-
|
MicroRNA
|
Cancer
|
hsa-miR-764 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-764 inhibitor
hsa-miR-764 inhibitor
- HY-RI03392
-
|
MicroRNA
|
Cancer
|
mmu-miR-6386 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6386 inhibitor
mmu-miR-6386 inhibitor
- HY-RI00957
-
|
MicroRNA
|
Cancer
|
hsa-miR-4278 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4278 inhibitor
hsa-miR-4278 inhibitor
- HY-RI01242
-
|
MicroRNA
|
Cancer
|
hsa-miR-4675 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4675 inhibitor
hsa-miR-4675 inhibitor
- HY-RI03129
-
|
MicroRNA
|
Cancer
|
mmu-miR-3965 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-3965 inhibitor
mmu-miR-3965 inhibitor
- HY-RI00753
-
|
MicroRNA
|
Cancer
|
hsa-miR-3646 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3646 inhibitor
hsa-miR-3646 inhibitor
- HY-RI03408
-
|
MicroRNA
|
|
mmu-miR-6401 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6401 inhibitor
mmu-miR-6401 inhibitor
- HY-RI00078
-
|
MicroRNA
|
Cancer
|
hsa-miR-1193 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1193 inhibitor
hsa-miR-1193 inhibitor
- HY-RI00897
-
|
MicroRNA
|
Cancer
|
hsa-miR-3937 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3937 inhibitor
hsa-miR-3937 inhibitor
- HY-RI04262
-
|
MicroRNA
|
Cancer
|
rno-miR-1896 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-1896 inhibitor
rno-miR-1896 inhibitor
- HY-RI04539
-
|
MicroRNA
|
Cancer
|
rno-miR-6327 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6327 inhibitor
rno-miR-6327 inhibitor
- HY-RI00878
-
|
MicroRNA
|
Cancer
|
hsa-miR-3919 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3919 inhibitor
hsa-miR-3919 inhibitor
- HY-RI01340
-
|
MicroRNA
|
Cancer
|
hsa-miR-4736 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4736 inhibitor
hsa-miR-4736 inhibitor
- HY-RI00397
-
|
MicroRNA
|
Cancer
|
hsa-miR-198 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-198 inhibitor
hsa-miR-198 inhibitor
- HY-RI02419
-
|
MicroRNA
|
Cancer
|
hsa-miR-7704 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-7704 inhibitor
hsa-miR-7704 inhibitor
- HY-RI01061
-
|
MicroRNA
|
Cancer
|
hsa-miR-4455 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4455 inhibitor
hsa-miR-4455 inhibitor
- HY-RI02438
-
|
MicroRNA
|
Cancer
|
hsa-miR-7974 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-7974 inhibitor
hsa-miR-7974 inhibitor
- HY-RI00979
-
|
MicroRNA
|
Cancer
|
hsa-miR-4299 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4299 inhibitor
hsa-miR-4299 inhibitor
- HY-RI02417
-
|
MicroRNA
|
Cancer
|
hsa-miR-7702 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-7702 inhibitor
hsa-miR-7702 inhibitor
- HY-RI02461
-
|
MicroRNA
|
Cancer
|
hsa-miR-8069 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8069 inhibitor
hsa-miR-8069 inhibitor
- HY-RI01718
-
|
MicroRNA
|
Cancer
|
hsa-miR-555 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-555 inhibitor
hsa-miR-555 inhibitor
- HY-RI04138
-
|
MicroRNA
|
Cancer
|
mmu-miR-8090 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8090 inhibitor
mmu-miR-8090 inhibitor
- HY-RI01026
-
|
MicroRNA
|
Cancer
|
hsa-miR-4427 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4427 inhibitor
hsa-miR-4427 inhibitor
- HY-RI04385
-
|
MicroRNA
|
Cancer
|
rno-miR-3549 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3549 inhibitor
rno-miR-3549 inhibitor
- HY-RI03347
-
|
MicroRNA
|
Cancer
|
mmu-miR-6341 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6341 inhibitor
mmu-miR-6341 inhibitor
- HY-RI01608
-
|
MicroRNA
|
Cancer
|
hsa-miR-521 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-521 inhibitor
hsa-miR-521 inhibitor
- HY-RI02713
-
|
MicroRNA
|
Cancer
|
mmu-miR-1893 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1893 inhibitor
mmu-miR-1893 inhibitor
- HY-RI02409
-
|
MicroRNA
|
Cancer
|
hsa-miR-762 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-762 inhibitor
hsa-miR-762 inhibitor
- HY-RI01851
-
|
MicroRNA
|
Cancer
|
hsa-miR-6077 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6077 inhibitor
hsa-miR-6077 inhibitor
- HY-RI04142
-
|
MicroRNA
|
Cancer
|
mmu-miR-8094 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8094 inhibitor
mmu-miR-8094 inhibitor
- HY-RI00632
-
|
MicroRNA
|
Cancer
|
hsa-miR-3176 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3176 inhibitor
hsa-miR-3176 inhibitor
- HY-RI03131
-
|
MicroRNA
|
Cancer
|
mmu-miR-3967 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-3967 inhibitor
mmu-miR-3967 inhibitor
- HY-RI00973
-
|
MicroRNA
|
Cancer
|
hsa-miR-4293 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4293 inhibitor
hsa-miR-4293 inhibitor
- HY-RI00641
-
|
MicroRNA
|
Cancer
|
hsa-miR-3182 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3182 inhibitor
hsa-miR-3182 inhibitor
- HY-RI03359
-
|
MicroRNA
|
Cancer
|
mmu-miR-6353 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6353 inhibitor
mmu-miR-6353 inhibitor
- HY-RI02455
-
|
MicroRNA
|
Cancer
|
hsa-miR-8063 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8063 inhibitor
hsa-miR-8063 inhibitor
- HY-RI00929
-
|
MicroRNA
|
Cancer
|
hsa-miR-4251 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4251 inhibitor
hsa-miR-4251 inhibitor
- HY-RI03038
-
|
MicroRNA
|
Cancer
|
mmu-miR-343 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-343 inhibitor
mmu-miR-343 inhibitor
- HY-RI01359
-
|
MicroRNA
|
Cancer
|
hsa-miR-4748 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4748 inhibitor
hsa-miR-4748 inhibitor
- HY-RI00768
-
|
MicroRNA
|
Cancer
|
hsa-miR-3661 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3661 inhibitor
hsa-miR-3661 inhibitor
- HY-RI04403
-
|
MicroRNA
|
Cancer
|
rno-miR-3566 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3566 inhibitor
rno-miR-3566 inhibitor
- HY-RI00572
-
|
MicroRNA
|
Cancer
|
hsa-miR-3134 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3134 inhibitor
hsa-miR-3134 inhibitor
- HY-RI04405
-
|
MicroRNA
|
Cancer
|
rno-miR-3569 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3569 inhibitor
rno-miR-3569 inhibitor
- HY-RI03384
-
|
MicroRNA
|
Cancer
|
mmu-miR-6378 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6378 inhibitor
mmu-miR-6378 inhibitor
- HY-RI01400
-
|
MicroRNA
|
Cancer
|
hsa-miR-4773 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4773 inhibitor
hsa-miR-4773 inhibitor
- HY-RI03503
-
|
MicroRNA
|
Cancer
|
mmu-miR-680 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-680 inhibitor
mmu-miR-680 inhibitor
- HY-RI02752
-
|
MicroRNA
|
Cancer
|
mmu-miR-1938 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1938 inhibitor
mmu-miR-1938 inhibitor
- HY-RI02532
-
|
MicroRNA
|
Cancer
|
hsa-miR-943 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-943 inhibitor
hsa-miR-943 inhibitor
- HY-RI00739
-
|
MicroRNA
|
Cancer
|
hsa-miR-3618 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3618 inhibitor
hsa-miR-3618 inhibitor
- HY-RI02544
-
|
MicroRNA
|
Cancer
|
hsa-miR-9898 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-9898 inhibitor
hsa-miR-9898 inhibitor
- HY-RI04089
-
|
MicroRNA
|
Cancer
|
mmu-miR-767 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-767 inhibitor
mmu-miR-767 inhibitor
- HY-RI00312
-
|
MicroRNA
|
Cancer
|
hsa-miR-1539 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1539 inhibitor
hsa-miR-1539 inhibitor
- HY-RI03267
-
|
MicroRNA
|
Cancer
|
mmu-miR-5123 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5123 inhibitor
mmu-miR-5123 inhibitor
- HY-RI00072
-
|
MicroRNA
|
Cancer
|
hsa-miR-1182 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1182 inhibitor
hsa-miR-1182 inhibitor
- HY-RI00420
-
|
MicroRNA
|
Cancer
|
hsa-miR-2054 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-2054 inhibitor
hsa-miR-2054 inhibitor
- HY-RI01132
-
|
MicroRNA
|
Cancer
|
hsa-miR-4513 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4513 inhibitor
hsa-miR-4513 inhibitor
- HY-RI01105
-
|
MicroRNA
|
Cancer
|
hsa-miR-4496 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4496 inhibitor
hsa-miR-4496 inhibitor
- HY-RI00992
-
|
MicroRNA
|
Cancer
|
hsa-miR-4312 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4312 inhibitor
hsa-miR-4312 inhibitor
- HY-RI04038
-
|
MicroRNA
|
Cancer
|
mmu-miR-763 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-763 inhibitor
mmu-miR-763 inhibitor
- HY-RI00343
-
|
MicroRNA
|
Cancer
|
hsa-miR-184 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-184 inhibitor
hsa-miR-184 inhibitor
- HY-RI04196
-
|
MicroRNA
|
Cancer
|
mmu-miR-935 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-935 inhibitor
mmu-miR-935 inhibitor
- HY-RI02547
-
|
MicroRNA
|
Cancer
|
hsa-miR-9901 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-9901 inhibitor
hsa-miR-9901 inhibitor
- HY-RI03130
-
|
MicroRNA
|
Cancer
|
mmu-miR-3966 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-3966 inhibitor
mmu-miR-3966 inhibitor
- HY-RI03387
-
|
MicroRNA
|
Cancer
|
mmu-miR-6381 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6381 inhibitor
mmu-miR-6381 inhibitor
- HY-RI01037
-
|
MicroRNA
|
Cancer
|
hsa-miR-4435 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4435 inhibitor
hsa-miR-4435 inhibitor
- HY-RI01102
-
|
MicroRNA
|
Cancer
|
hsa-miR-4493 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4493 inhibitor
hsa-miR-4493 inhibitor
- HY-RI00103
-
|
MicroRNA
|
Cancer
|
hsa-miR-12127 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12127 inhibitor
hsa-miR-12127 inhibitor
- HY-RI00666
-
|
MicroRNA
|
Cancer
|
hsa-miR-3199 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3199 inhibitor
hsa-miR-3199 inhibitor
- HY-RI00959
-
|
MicroRNA
|
Cancer
|
hsa-miR-4280 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4280 inhibitor
hsa-miR-4280 inhibitor
- HY-RI01844
-
|
MicroRNA
|
Cancer
|
hsa-miR-6070 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6070 inhibitor
hsa-miR-6070 inhibitor
- HY-RI02717
-
|
MicroRNA
|
Cancer
|
mmu-miR-1896 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1896 inhibitor
mmu-miR-1896 inhibitor
- HY-RI00876
-
|
MicroRNA
|
Cancer
|
hsa-miR-3917 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3917 inhibitor
hsa-miR-3917 inhibitor
- HY-RI00669
-
|
MicroRNA
|
Cancer
|
hsa-miR-3201 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3201 inhibitor
hsa-miR-3201 inhibitor
- HY-RI00905
-
|
MicroRNA
|
Cancer
|
hsa-miR-3943 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3943 inhibitor
hsa-miR-3943 inhibitor
- HY-RI02782
-
|
MicroRNA
|
Cancer
|
mmu-miR-1963 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1963 inhibitor
mmu-miR-1963 inhibitor
- HY-RI00092
-
|
MicroRNA
|
Cancer
|
hsa-miR-12116 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12116 inhibitor
hsa-miR-12116 inhibitor
- HY-RI01880
-
|
MicroRNA
|
Cancer
|
hsa-miR-614 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-614 inhibitor
hsa-miR-614 inhibitor
- HY-78574
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
N-Benzoylcytidine is a substrate for uracil-cytidine kinase 1 (UCK1) and UCK2. N-Benzoylcytidine can be used to synthesize 2-OH protective groups for solid-phase RNA synthesis,as well as synthetic oligonucleotides for UV induction and targeted gene silencing in zebrafish embryos .
|
-
- HY-RI01024
-
|
MicroRNA
|
Cancer
|
hsa-miR-4425 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4425 inhibitor
hsa-miR-4425 inhibitor
- HY-RI01041
-
|
MicroRNA
|
Cancer
|
hsa-miR-4437 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4437 inhibitor
hsa-miR-4437 inhibitor
- HY-RI01209
-
|
MicroRNA
|
Cancer
|
hsa-miR-4657 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4657 inhibitor
hsa-miR-4657 inhibitor
- HY-RI04563
-
|
MicroRNA
|
Cancer
|
rno-miR-679 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-679 inhibitor
rno-miR-679 inhibitor
- HY-RI03342
-
|
MicroRNA
|
Cancer
|
mmu-miR-6336 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6336 inhibitor
mmu-miR-6336 inhibitor
- HY-RI01239
-
|
MicroRNA
|
Cancer
|
hsa-miR-4672 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4672 inhibitor
hsa-miR-4672 inhibitor
- HY-RI00441
-
|
MicroRNA
|
Cancer
|
hsa-miR-2117 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-2117 inhibitor
hsa-miR-2117 inhibitor
- HY-RI03884
-
|
MicroRNA
|
Cancer
|
mmu-miR-707 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-707 inhibitor
mmu-miR-707 inhibitor
- HY-RI04143
-
|
MicroRNA
|
Cancer
|
mmu-miR-8095 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8095 inhibitor
mmu-miR-8095 inhibitor
- HY-RI00637
-
|
MicroRNA
|
Cancer
|
hsa-miR-3180 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3180 inhibitor
hsa-miR-3180 inhibitor
- HY-RI00998
-
|
MicroRNA
|
Cancer
|
hsa-miR-4316 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4316 inhibitor
hsa-miR-4316 inhibitor
- HY-RI00980
-
|
MicroRNA
|
Cancer
|
hsa-miR-4300 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4300 inhibitor
hsa-miR-4300 inhibitor
- HY-RI01923
-
|
MicroRNA
|
Cancer
|
hsa-miR-648 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-648 inhibitor
hsa-miR-648 inhibitor
- HY-RI00999
-
|
MicroRNA
|
Cancer
|
hsa-miR-4317 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4317 inhibitor
hsa-miR-4317 inhibitor
- HY-RI02790
-
|
MicroRNA
|
Cancer
|
mmu-miR-1969 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1969 inhibitor
mmu-miR-1969 inhibitor
- HY-RI03082
-
|
MicroRNA
|
Cancer
|
mmu-miR-3535 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-3535 inhibitor
mmu-miR-3535 inhibitor
- HY-RI01160
-
|
MicroRNA
|
Cancer
|
hsa-miR-4533 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4533 inhibitor
hsa-miR-4533 inhibitor
- HY-RI02579
-
|
MicroRNA
|
Cancer
|
mmu-miR-1192 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1192 inhibitor
mmu-miR-1192 inhibitor
- HY-RI03356
-
|
MicroRNA
|
Cancer
|
mmu-miR-6350 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6350 inhibitor
mmu-miR-6350 inhibitor
- HY-RI00978
-
|
MicroRNA
|
Cancer
|
hsa-miR-4298 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4298 inhibitor
hsa-miR-4298 inhibitor
- HY-RI00867
-
|
MicroRNA
|
Cancer
|
hsa-miR-3910 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3910 inhibitor
hsa-miR-3910 inhibitor
- HY-RI01869
-
|
MicroRNA
|
Cancer
|
hsa-miR-6125 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6125 inhibitor
hsa-miR-6125 inhibitor
- HY-RI01025
-
|
MicroRNA
|
Cancer
|
hsa-miR-4426 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4426 inhibitor
hsa-miR-4426 inhibitor
- HY-RI04151
-
|
MicroRNA
|
Cancer
|
mmu-miR-8103 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8103 inhibitor
mmu-miR-8103 inhibitor
- HY-RI00960
-
|
MicroRNA
|
Cancer
|
hsa-miR-4281 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4281 inhibitor
hsa-miR-4281 inhibitor
- HY-RI01241
-
|
MicroRNA
|
Cancer
|
hsa-miR-4674 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4674 inhibitor
hsa-miR-4674 inhibitor
- HY-RI03246
-
|
MicroRNA
|
Cancer
|
mmu-miR-5100 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5100 inhibitor
mmu-miR-5100 inhibitor
- HY-RI00864
-
|
MicroRNA
|
Cancer
|
hsa-miR-3907 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3907 inhibitor
hsa-miR-3907 inhibitor
- HY-RI01005
-
|
MicroRNA
|
Cancer
|
hsa-miR-4323 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4323 inhibitor
hsa-miR-4323 inhibitor
- HY-RI01912
-
|
MicroRNA
|
Cancer
|
hsa-miR-638 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-638 inhibitor
hsa-miR-638 inhibitor
- HY-RI03397
-
|
MicroRNA
|
Cancer
|
mmu-miR-6391 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6391 inhibitor
mmu-miR-6391 inhibitor
- HY-RI00990
-
|
MicroRNA
|
Cancer
|
hsa-miR-4310 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4310 inhibitor
hsa-miR-4310 inhibitor
- HY-RI03255
-
|
MicroRNA
|
Cancer
|
mmu-miR-5110 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5110 inhibitor
mmu-miR-5110 inhibitor
- HY-RI01144
-
|
MicroRNA
|
Cancer
|
hsa-miR-4521 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4521 inhibitor
hsa-miR-4521 inhibitor
- HY-RI00931
-
|
MicroRNA
|
Cancer
|
hsa-miR-4253 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4253 inhibitor
hsa-miR-4253 inhibitor
- HY-RI00069
-
|
MicroRNA
|
Cancer
|
hsa-miR-1179 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1179 inhibitor
hsa-miR-1179 inhibitor
- HY-RI01119
-
|
MicroRNA
|
Cancer
|
hsa-miR-4505 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4505 inhibitor
hsa-miR-4505 inhibitor
- HY-RI02732
-
|
MicroRNA
|
Cancer
|
mmu-miR-1907 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1907 inhibitor
mmu-miR-1907 inhibitor
- HY-RI00418
-
|
MicroRNA
|
Cancer
|
hsa-miR-2053 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-2053 inhibitor
hsa-miR-2053 inhibitor
- HY-RI03262
-
|
MicroRNA
|
Cancer
|
mmu-miR-5118 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5118 inhibitor
mmu-miR-5118 inhibitor
- HY-RI01154
-
|
MicroRNA
|
Cancer
|
hsa-miR-4527 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4527 inhibitor
hsa-miR-4527 inhibitor
- HY-RI04380
-
|
MicroRNA
|
Cancer
|
rno-miR-3543 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3543 inhibitor
rno-miR-3543 inhibitor
- HY-RI01798
-
|
MicroRNA
|
Cancer
|
hsa-miR-575 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-575 inhibitor
hsa-miR-575 inhibitor
- HY-RI00757
-
|
MicroRNA
|
Cancer
|
hsa-miR-3651 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3651 inhibitor
hsa-miR-3651 inhibitor
- HY-RI04398
-
|
MicroRNA
|
Cancer
|
rno-miR-3560 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3560 inhibitor
rno-miR-3560 inhibitor
- HY-RI01876
-
|
MicroRNA
|
Cancer
|
hsa-miR-6131 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6131 inhibitor
hsa-miR-6131 inhibitor
- HY-RI01767
-
|
MicroRNA
|
Cancer
|
hsa-miR-5689 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5689 inhibitor
hsa-miR-5689 inhibitor
- HY-RI03386
-
|
MicroRNA
|
Cancer
|
mmu-miR-6380 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6380 inhibitor
mmu-miR-6380 inhibitor
- HY-RI04164
-
|
MicroRNA
|
Cancer
|
mmu-miR-8116 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8116 inhibitor
mmu-miR-8116 inhibitor
- HY-RI00902
-
|
MicroRNA
|
Cancer
|
hsa-miR-3941 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3941 inhibitor
hsa-miR-3941 inhibitor
- HY-RI00949
-
|
MicroRNA
|
Cancer
|
hsa-miR-4270 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4270 inhibitor
hsa-miR-4270 inhibitor
- HY-RI00621
-
|
MicroRNA
|
Cancer
|
hsa-miR-3165 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3165 inhibitor
hsa-miR-3165 inhibitor
- HY-RI03132
-
|
MicroRNA
|
Cancer
|
mmu-miR-3968 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-3968 inhibitor
mmu-miR-3968 inhibitor
- HY-RI02457
-
|
MicroRNA
|
Cancer
|
hsa-miR-8065 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8065 inhibitor
hsa-miR-8065 inhibitor
- HY-RI01158
-
|
MicroRNA
|
Cancer
|
hsa-miR-4530 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4530 inhibitor
hsa-miR-4530 inhibitor
- HY-RI01023
-
|
MicroRNA
|
Cancer
|
hsa-miR-4424 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4424 inhibitor
hsa-miR-4424 inhibitor
- HY-RI01779
-
|
MicroRNA
|
Cancer
|
hsa-miR-5698 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5698 inhibitor
hsa-miR-5698 inhibitor
- HY-RI00102
-
|
MicroRNA
|
Cancer
|
hsa-miR-12126 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12126 inhibitor
hsa-miR-12126 inhibitor
- HY-RI04432
-
|
MicroRNA
|
Cancer
|
rno-miR-3592 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3592 inhibitor
rno-miR-3592 inhibitor
- HY-RI00137
-
|
MicroRNA
|
Cancer
|
hsa-miR-1243 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1243 inhibitor
hsa-miR-1243 inhibitor
- HY-RI00096
-
|
MicroRNA
|
Cancer
|
hsa-miR-12120 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12120 inhibitor
hsa-miR-12120 inhibitor
- HY-RI00602
-
|
MicroRNA
|
Cancer
|
hsa-miR-3153 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3153 inhibitor
hsa-miR-3153 inhibitor
- HY-RI00726
-
|
MicroRNA
|
Cancer
|
hsa-miR-3610 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3610 inhibitor
hsa-miR-3610 inhibitor
- HY-RI01527
-
|
MicroRNA
|
Cancer
|
hsa-miR-5090 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5090 inhibitor
hsa-miR-5090 inhibitor
- HY-RI00800
-
|
MicroRNA
|
Cancer
|
hsa-miR-3684 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3684 inhibitor
hsa-miR-3684 inhibitor
- HY-RI00944
-
|
MicroRNA
|
Cancer
|
hsa-miR-4265 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4265 inhibitor
hsa-miR-4265 inhibitor
- HY-RI02478
-
|
MicroRNA
|
Cancer
|
hsa-miR-8086 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8086 inhibitor
hsa-miR-8086 inhibitor
- HY-RI00232
-
|
MicroRNA
|
Cancer
|
hsa-miR-1302 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1302 inhibitor
hsa-miR-1302 inhibitor
- HY-RI03345
-
|
MicroRNA
|
Cancer
|
mmu-miR-6339 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6339 inhibitor
mmu-miR-6339 inhibitor
- HY-RI01784
-
|
MicroRNA
|
Cancer
|
hsa-miR-5702 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5702 inhibitor
hsa-miR-5702 inhibitor
- HY-RI00147
-
|
MicroRNA
|
Cancer
|
hsa-miR-1248 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1248 inhibitor
hsa-miR-1248 inhibitor
- HY-RI01168
-
|
MicroRNA
|
Cancer
|
hsa-miR-4540 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4540 inhibitor
hsa-miR-4540 inhibitor
- HY-RI01448
-
|
MicroRNA
|
Cancer
|
hsa-miR-4803 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4803 inhibitor
hsa-miR-4803 inhibitor
- HY-RI04146
-
|
MicroRNA
|
Cancer
|
mmu-miR-8098 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8098 inhibitor
mmu-miR-8098 inhibitor
- HY-RI01068
-
|
MicroRNA
|
Cancer
|
hsa-miR-4464 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4464 inhibitor
hsa-miR-4464 inhibitor
- HY-RI01817
-
|
MicroRNA
|
Cancer
|
hsa-miR-587 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-587 inhibitor
hsa-miR-587 inhibitor
- HY-RI03389
-
|
MicroRNA
|
Cancer
|
mmu-miR-6383 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6383 inhibitor
mmu-miR-6383 inhibitor
- HY-RI00761
-
|
MicroRNA
|
Cancer
|
hsa-miR-3657 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3657 inhibitor
hsa-miR-3657 inhibitor
- HY-RI03135
-
|
MicroRNA
|
Cancer
|
mmu-miR-3971 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-3971 inhibitor
mmu-miR-3971 inhibitor
- HY-RI00945
-
|
MicroRNA
|
Cancer
|
hsa-miR-4266 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4266 inhibitor
hsa-miR-4266 inhibitor
- HY-RI01579
-
|
MicroRNA
|
Cancer
|
hsa-miR-5193 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5193 inhibitor
hsa-miR-5193 inhibitor
- HY-148130A
-
RG6091 sodium; RO7248824 sodium
|
E1/E2/E3 Enzyme
|
Others
|
Rugonersen sodium is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) sodium is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
|
-
- HY-RI00948
-
|
MicroRNA
|
Cancer
|
hsa-miR-4269 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4269 inhibitor
hsa-miR-4269 inhibitor
- HY-RI01841
-
|
MicroRNA
|
Cancer
|
hsa-miR-6068 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6068 inhibitor
hsa-miR-6068 inhibitor
- HY-RI01891
-
|
MicroRNA
|
Cancer
|
hsa-miR-621 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-621 inhibitor
hsa-miR-621 inhibitor
- HY-RI03364
-
|
MicroRNA
|
Cancer
|
mmu-miR-6358 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6358 inhibitor
mmu-miR-6358 inhibitor
- HY-RI01515
-
|
MicroRNA
|
Cancer
|
hsa-miR-5047 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5047 inhibitor
hsa-miR-5047 inhibitor
- HY-RI02282
-
|
MicroRNA
|
Cancer
|
hsa-miR-6860 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6860 inhibitor
hsa-miR-6860 inhibitor
- HY-RI00097
-
|
MicroRNA
|
Cancer
|
hsa-miR-12121 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12121 inhibitor
hsa-miR-12121 inhibitor
- HY-RI04401
-
|
MicroRNA
|
Cancer
|
rno-miR-3562 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3562 inhibitor
rno-miR-3562 inhibitor
- HY-RI02465
-
|
MicroRNA
|
Cancer
|
hsa-miR-8073 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8073 inhibitor
hsa-miR-8073 inhibitor
- HY-RI01084
-
|
MicroRNA
|
Cancer
|
hsa-miR-4478 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4478 inhibitor
hsa-miR-4478 inhibitor
- HY-RI00396
-
|
MicroRNA
|
Cancer
|
hsa-miR-1976 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1976 inhibitor
hsa-miR-1976 inhibitor
- HY-RI02549
-
|
MicroRNA
|
Cancer
|
hsa-miR-9903 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-9903 inhibitor
hsa-miR-9903 inhibitor
- HY-RI00662
-
|
MicroRNA
|
Cancer
|
hsa-miR-3195 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3195 inhibitor
hsa-miR-3195 inhibitor
- HY-RI00986
-
|
MicroRNA
|
Cancer
|
hsa-miR-4306 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4306 inhibitor
hsa-miR-4306 inhibitor
- HY-RI00640
-
|
MicroRNA
|
Cancer
|
hsa-miR-3181 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3181 inhibitor
hsa-miR-3181 inhibitor
- HY-RI02047
-
|
MicroRNA
|
Cancer
|
hsa-miR-6745 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6745 inhibitor
hsa-miR-6745 inhibitor
- HY-RI01251
-
|
MicroRNA
|
Cancer
|
hsa-miR-4681 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4681 inhibitor
hsa-miR-4681 inhibitor
- HY-RI01314
-
|
MicroRNA
|
Cancer
|
hsa-miR-4721 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4721 inhibitor
hsa-miR-4721 inhibitor
- HY-RI04408
-
|
MicroRNA
|
Cancer
|
rno-miR-3572 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3572 inhibitor
rno-miR-3572 inhibitor
- HY-RI01854
-
|
MicroRNA
|
Cancer
|
hsa-miR-608 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-608 inhibitor
hsa-miR-608 inhibitor
- HY-RI01915
-
|
MicroRNA
|
Cancer
|
hsa-miR-641 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-641 inhibitor
hsa-miR-641 inhibitor
- HY-RI04533
-
|
MicroRNA
|
Cancer
|
rno-miR-6321 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6321 inhibitor
rno-miR-6321 inhibitor
- HY-RI04158
-
|
MicroRNA
|
Cancer
|
mmu-miR-8110 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8110 inhibitor
mmu-miR-8110 inhibitor
- HY-RI03798
-
|
MicroRNA
|
Cancer
|
mmu-miR-703 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-703 inhibitor
mmu-miR-703 inhibitor
- HY-RI00912
-
|
MicroRNA
|
Cancer
|
hsa-miR-3974 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3974 inhibitor
hsa-miR-3974 inhibitor
- HY-RI00623
-
|
MicroRNA
|
Cancer
|
hsa-miR-3167 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3167 inhibitor
hsa-miR-3167 inhibitor
- HY-RI00338
-
|
MicroRNA
|
Cancer
|
hsa-miR-1825 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1825 inhibitor
hsa-miR-1825 inhibitor
- HY-RI00779
-
|
MicroRNA
|
Cancer
|
hsa-miR-3670 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3670 inhibitor
hsa-miR-3670 inhibitor
- HY-RI03368
-
|
MicroRNA
|
Cancer
|
mmu-miR-6362 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6362 inhibitor
mmu-miR-6362 inhibitor
- HY-RI00943
-
|
MicroRNA
|
Cancer
|
hsa-miR-4264 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4264 inhibitor
hsa-miR-4264 inhibitor
- HY-RI01115
-
|
MicroRNA
|
Cancer
|
hsa-miR-4501 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4501 inhibitor
hsa-miR-4501 inhibitor
- HY-RI04305
-
|
MicroRNA
|
Cancer
|
rno-miR-215 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-215 inhibitor
rno-miR-215 inhibitor
- HY-RI04141
-
|
MicroRNA
|
Cancer
|
mmu-miR-8093 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8093 inhibitor
mmu-miR-8093 inhibitor
- HY-RI00631
-
|
MicroRNA
|
Cancer
|
hsa-miR-3175 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3175 inhibitor
hsa-miR-3175 inhibitor
- HY-RI01186
-
|
MicroRNA
|
Cancer
|
hsa-miR-4641 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4641 inhibitor
hsa-miR-4641 inhibitor
- HY-RI01783
-
|
MicroRNA
|
Cancer
|
hsa-miR-5701 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5701 inhibitor
hsa-miR-5701 inhibitor
- HY-RI00626
-
|
MicroRNA
|
Cancer
|
hsa-miR-3170 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3170 inhibitor
hsa-miR-3170 inhibitor
- HY-RI04155
-
|
MicroRNA
|
Cancer
|
mmu-miR-8107 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8107 inhibitor
mmu-miR-8107 inhibitor
- HY-RI03348
-
|
MicroRNA
|
Cancer
|
mmu-miR-6342 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6342 inhibitor
mmu-miR-6342 inhibitor
- HY-RI00895
-
|
MicroRNA
|
Cancer
|
hsa-miR-3935 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3935 inhibitor
hsa-miR-3935 inhibitor
- HY-RI01054
-
|
MicroRNA
|
Cancer
|
hsa-miR-4448 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4448 inhibitor
hsa-miR-4448 inhibitor
- HY-RI04406
-
|
MicroRNA
|
Cancer
|
rno-miR-3570 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3570 inhibitor
rno-miR-3570 inhibitor
- HY-RI02453
-
|
MicroRNA
|
Cancer
|
hsa-miR-8061 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8061 inhibitor
hsa-miR-8061 inhibitor
- HY-RI00884
-
|
MicroRNA
|
Cancer
|
hsa-miR-3924 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3924 inhibitor
hsa-miR-3924 inhibitor
- HY-RI01913
-
|
MicroRNA
|
Cancer
|
hsa-miR-639 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-639 inhibitor
hsa-miR-639 inhibitor
- HY-RI00977
-
|
MicroRNA
|
Cancer
|
hsa-miR-4297 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4297 inhibitor
hsa-miR-4297 inhibitor
- HY-RI00625
-
|
MicroRNA
|
Cancer
|
hsa-miR-3169 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3169 inhibitor
hsa-miR-3169 inhibitor
- HY-RI00226
-
|
MicroRNA
|
Cancer
|
hsa-miR-1297 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1297 inhibitor
hsa-miR-1297 inhibitor
- HY-RI04383
-
|
MicroRNA
|
Cancer
|
rno-miR-3547 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3547 inhibitor
rno-miR-3547 inhibitor
- HY-RI02470
-
|
MicroRNA
|
Cancer
|
hsa-miR-8078 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8078 inhibitor
hsa-miR-8078 inhibitor
- HY-RI01978
-
|
MicroRNA
|
Cancer
|
hsa-miR-658 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-658 inhibitor
hsa-miR-658 inhibitor
- HY-RI00981
-
|
MicroRNA
|
Cancer
|
hsa-miR-4301 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4301 inhibitor
hsa-miR-4301 inhibitor
- HY-RI03284
-
|
MicroRNA
|
Cancer
|
mmu-miR-5136 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5136 inhibitor
mmu-miR-5136 inhibitor
- HY-RI01178
-
|
MicroRNA
|
Cancer
|
hsa-miR-4636 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4636 inhibitor
hsa-miR-4636 inhibitor
- HY-RI01081
-
|
MicroRNA
|
Cancer
|
hsa-miR-4476 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4476 inhibitor
hsa-miR-4476 inhibitor
- HY-RI01070
-
|
MicroRNA
|
Cancer
|
hsa-miR-4466 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4466 inhibitor
hsa-miR-4466 inhibitor
- HY-RI01365
-
|
MicroRNA
|
Cancer
|
hsa-miR-4752 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4752 inhibitor
hsa-miR-4752 inhibitor
- HY-RI04327
-
|
MicroRNA
|
Cancer
|
rno-miR-297 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-297 inhibitor
rno-miR-297 inhibitor
- HY-RI00727
-
|
MicroRNA
|
Cancer
|
hsa-miR-3611 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3611 inhibitor
hsa-miR-3611 inhibitor
- HY-RI00169
-
|
MicroRNA
|
Cancer
|
hsa-miR-1261 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1261 inhibitor
hsa-miR-1261 inhibitor
- HY-RI01753
-
|
MicroRNA
|
Cancer
|
hsa-miR-562 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-562 inhibitor
hsa-miR-562 inhibitor
- HY-RI01577
-
|
MicroRNA
|
Cancer
|
hsa-miR-5191 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5191 inhibitor
hsa-miR-5191 inhibitor
- HY-RI03351
-
|
MicroRNA
|
Cancer
|
mmu-miR-6345 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6345 inhibitor
mmu-miR-6345 inhibitor
- HY-RI02440
-
|
MicroRNA
|
Cancer
|
hsa-miR-7976 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-7976 inhibitor
hsa-miR-7976 inhibitor
- HY-RI00393
-
|
MicroRNA
|
Cancer
|
hsa-miR-1973 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1973 inhibitor
hsa-miR-1973 inhibitor
- HY-RI01074
-
|
MicroRNA
|
Cancer
|
hsa-miR-4470 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4470 inhibitor
hsa-miR-4470 inhibitor
- HY-RI03369
-
|
MicroRNA
|
Cancer
|
mmu-miR-6363 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6363 inhibitor
mmu-miR-6363 inhibitor
- HY-RI01777
-
|
MicroRNA
|
Cancer
|
hsa-miR-5696 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5696 inhibitor
hsa-miR-5696 inhibitor
- HY-RI01861
-
|
MicroRNA
|
Cancer
|
hsa-miR-6086 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6086 inhibitor
hsa-miR-6086 inhibitor
- HY-RI03561
-
|
MicroRNA
|
Cancer
|
mmu-miR-692 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-692 inhibitor
mmu-miR-692 inhibitor
- HY-RI01099
-
|
MicroRNA
|
Cancer
|
hsa-miR-4490 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4490 inhibitor
hsa-miR-4490 inhibitor
- HY-RI00178
-
|
MicroRNA
|
Cancer
|
hsa-miR-1267 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1267 inhibitor
hsa-miR-1267 inhibitor
- HY-RI01377
-
|
MicroRNA
|
Cancer
|
hsa-miR-4759 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4759 inhibitor
hsa-miR-4759 inhibitor
- HY-RI04187
-
|
MicroRNA
|
Cancer
|
mmu-miR-882 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-882 inhibitor
mmu-miR-882 inhibitor
- HY-RI00712
-
|
MicroRNA
|
Cancer
|
hsa-miR-346 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-346 inhibitor
hsa-miR-346 inhibitor
- HY-RI01087
-
|
MicroRNA
|
Cancer
|
hsa-miR-4480 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4480 inhibitor
hsa-miR-4480 inhibitor
- HY-RI00245
-
|
MicroRNA
|
Cancer
|
hsa-miR-1321 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1321 inhibitor
hsa-miR-1321 inhibitor
- HY-153485
-
ISIS 766720; IONIS-GHR-LRx
|
GHR
Small Interfering RNA (siRNA)
|
Others
|
Cimdelirsen is a novel, ligand-conjugated, hepatic-targeted investigative antisense oligonucleotide designed to reduce growth hormone receptor (GHr) synthesis, thereby inhibiting deleterious effects of growth hormone (GH) hypersecretion and reducing circulating insulin-like growth factor-1 (IGF-1) levels in acromegaly patients.
|
-
- HY-RI03063
-
|
MicroRNA
|
Cancer
|
mmu-miR-3471 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-3471 inhibitor
mmu-miR-3471 inhibitor
- HY-RI01030
-
|
MicroRNA
|
Cancer
|
hsa-miR-4431 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4431 inhibitor
hsa-miR-4431 inhibitor
- HY-RI02444
-
|
MicroRNA
|
Cancer
|
hsa-miR-8052 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8052 inhibitor
hsa-miR-8052 inhibitor
- HY-RI00664
-
|
MicroRNA
|
Cancer
|
hsa-miR-3197 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3197 inhibitor
hsa-miR-3197 inhibitor
- HY-RI02445
-
|
MicroRNA
|
Cancer
|
hsa-miR-8053 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8053 inhibitor
hsa-miR-8053 inhibitor
- HY-RI00506
-
|
MicroRNA
|
Cancer
|
hsa-miR-297 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-297 inhibitor
hsa-miR-297 inhibitor
- HY-RI00583
-
|
MicroRNA
|
Cancer
|
hsa-miR-3141 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3141 inhibitor
hsa-miR-3141 inhibitor
- HY-RI00340
-
|
MicroRNA
|
Cancer
|
hsa-miR-1827 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1827 inhibitor
hsa-miR-1827 inhibitor
- HY-RI01824
-
|
MicroRNA
|
Cancer
|
hsa-miR-592 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-592 inhibitor
hsa-miR-592 inhibitor
- HY-RI00110
-
|
MicroRNA
|
Cancer
|
hsa-miR-12135 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12135 inhibitor
hsa-miR-12135 inhibitor
- HY-RI04144
-
|
MicroRNA
|
Cancer
|
mmu-miR-8096 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8096 inhibitor
mmu-miR-8096 inhibitor
- HY-RI01179
-
|
MicroRNA
|
Cancer
|
hsa-miR-4637 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4637 inhibitor
hsa-miR-4637 inhibitor
- HY-RI01418
-
|
MicroRNA
|
Cancer
|
hsa-miR-4784 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4784 inhibitor
hsa-miR-4784 inhibitor
- HY-RI02529
-
|
MicroRNA
|
Cancer
|
hsa-miR-941 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-941 inhibitor
hsa-miR-941 inhibitor
- HY-RI01002
-
|
MicroRNA
|
Cancer
|
hsa-miR-4320 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4320 inhibitor
hsa-miR-4320 inhibitor
- HY-RI04372
-
|
MicroRNA
|
Cancer
|
rno-miR-3473 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3473 inhibitor
rno-miR-3473 inhibitor
- HY-RI00507
-
|
MicroRNA
|
Cancer
|
hsa-miR-298 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-298 inhibitor
hsa-miR-298 inhibitor
- HY-RI01793
-
|
MicroRNA
|
Cancer
|
hsa-miR-572 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-572 inhibitor
hsa-miR-572 inhibitor
- HY-RI01765
-
|
MicroRNA
|
Cancer
|
hsa-miR-5687 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5687 inhibitor
hsa-miR-5687 inhibitor
- HY-RI01892
-
|
MicroRNA
|
Cancer
|
hsa-miR-623 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-623 inhibitor
hsa-miR-623 inhibitor
- HY-RI01138
-
|
MicroRNA
|
Cancer
|
hsa-miR-4519 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4519 inhibitor
hsa-miR-4519 inhibitor
- HY-RI01984
-
|
MicroRNA
|
Cancer
|
hsa-miR-662 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-662 inhibitor
hsa-miR-662 inhibitor
- HY-RI03273
-
|
MicroRNA
|
Cancer
|
mmu-miR-5128 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5128 inhibitor
mmu-miR-5128 inhibitor
- HY-RI03358
-
|
MicroRNA
|
Cancer
|
mmu-miR-6352 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6352 inhibitor
mmu-miR-6352 inhibitor
- HY-RI00622
-
|
MicroRNA
|
Cancer
|
hsa-miR-3166 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3166 inhibitor
hsa-miR-3166 inhibitor
- HY-RI02521
-
|
MicroRNA
|
Cancer
|
hsa-miR-936 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-936 inhibitor
hsa-miR-936 inhibitor
- HY-RI02447
-
|
MicroRNA
|
Cancer
|
hsa-miR-8055 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8055 inhibitor
hsa-miR-8055 inhibitor
- HY-RI01071
-
|
MicroRNA
|
Cancer
|
hsa-miR-4467 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4467 inhibitor
hsa-miR-4467 inhibitor
- HY-RI01860
-
|
MicroRNA
|
Cancer
|
hsa-miR-6085 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6085 inhibitor
hsa-miR-6085 inhibitor
- HY-RI00991
-
|
MicroRNA
|
Cancer
|
hsa-miR-4311 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4311 inhibitor
hsa-miR-4311 inhibitor
- HY-RI03382
-
|
MicroRNA
|
Cancer
|
mmu-miR-6376 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6376 inhibitor
mmu-miR-6376 inhibitor
- HY-RI01782
-
|
MicroRNA
|
Cancer
|
hsa-miR-5700 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5700 inhibitor
hsa-miR-5700 inhibitor
- HY-RI01003
-
|
MicroRNA
|
Cancer
|
hsa-miR-4321 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4321 inhibitor
hsa-miR-4321 inhibitor
- HY-RI01770
-
|
MicroRNA
|
Cancer
|
hsa-miR-5691 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5691 inhibitor
hsa-miR-5691 inhibitor
- HY-RI04345
-
|
MicroRNA
|
Cancer
|
rno-miR-3099 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3099 inhibitor
rno-miR-3099 inhibitor
- HY-RI01103
-
|
MicroRNA
|
Cancer
|
hsa-miR-4494 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4494 inhibitor
hsa-miR-4494 inhibitor
- HY-RI01020
-
|
MicroRNA
|
Cancer
|
hsa-miR-4422 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4422 inhibitor
hsa-miR-4422 inhibitor
- HY-RI00161
-
|
MicroRNA
|
Cancer
|
hsa-miR-1257 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1257 inhibitor
hsa-miR-1257 inhibitor
- HY-RI03519
-
|
MicroRNA
|
Cancer
|
mmu-miR-690 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-690 inhibitor
mmu-miR-690 inhibitor
- HY-RI03955
-
|
MicroRNA
|
Cancer
|
mmu-miR-719 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-719 inhibitor
mmu-miR-719 inhibitor
- HY-RI02797
-
|
MicroRNA
|
Cancer
|
mmu-miR-1971 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1971 inhibitor
mmu-miR-1971 inhibitor
- HY-RI03244
-
|
MicroRNA
|
Cancer
|
mmu-miR-5098 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5098 inhibitor
mmu-miR-5098 inhibitor
- HY-RI02452
-
|
MicroRNA
|
Cancer
|
hsa-miR-8060 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8060 inhibitor
hsa-miR-8060 inhibitor
- HY-RI00546
-
|
MicroRNA
|
Cancer
|
hsa-miR-3116 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3116 inhibitor
hsa-miR-3116 inhibitor
- HY-RI00769
-
|
MicroRNA
|
Cancer
|
hsa-miR-3662 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3662 inhibitor
hsa-miR-3662 inhibitor
- HY-RI04148
-
|
MicroRNA
|
Cancer
|
mmu-miR-8100 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8100 inhibitor
mmu-miR-8100 inhibitor
- HY-RI00079
-
|
MicroRNA
|
Cancer
|
hsa-miR-1197 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1197 inhibitor
hsa-miR-1197 inhibitor
- HY-D2494
-
|
Fluorescent Dye
|
Others
|
Sulfo Cy7 bis-NHS ester is a derivative of Cy7 (HY-D0825) dye containing sulfonate ions. Sulfo Cy7 bis-NHS ester can be used to label the primary amines (R-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules.
|
-
- HY-RI01060
-
|
MicroRNA
|
Cancer
|
hsa-miR-4454 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4454 inhibitor
hsa-miR-4454 inhibitor
- HY-RI00173
-
|
MicroRNA
|
Cancer
|
hsa-miR-1264 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1264 inhibitor
hsa-miR-1264 inhibitor
- HY-RI02443
-
|
MicroRNA
|
Cancer
|
hsa-miR-802 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-802 inhibitor
hsa-miR-802 inhibitor
- HY-RI03027
-
|
MicroRNA
|
Cancer
|
mmu-miR-327 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-327 inhibitor
mmu-miR-327 inhibitor
- HY-RI02567
-
|
MicroRNA
|
Cancer
|
mmu-miR-105 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-105 inhibitor
mmu-miR-105 inhibitor
- HY-RI00863
-
|
MicroRNA
|
Cancer
|
hsa-miR-384 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-384 inhibitor
hsa-miR-384 inhibitor
- HY-RI00799
-
|
MicroRNA
|
Cancer
|
hsa-miR-3683 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3683 inhibitor
hsa-miR-3683 inhibitor
- HY-RI01047
-
|
MicroRNA
|
Cancer
|
hsa-miR-4443 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4443 inhibitor
hsa-miR-4443 inhibitor
- HY-RI01787
-
|
MicroRNA
|
Cancer
|
hsa-miR-5704 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5704 inhibitor
hsa-miR-5704 inhibitor
- HY-RI01028
-
|
MicroRNA
|
Cancer
|
hsa-miR-4429 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4429 inhibitor
hsa-miR-4429 inhibitor
- HY-RI03264
-
|
MicroRNA
|
Cancer
|
mmu-miR-5120 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5120 inhibitor
mmu-miR-5120 inhibitor
- HY-RI00089
-
|
MicroRNA
|
Cancer
|
hsa-miR-12113 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12113 inhibitor
hsa-miR-12113 inhibitor
- HY-RI00733
-
|
MicroRNA
|
Cancer
|
hsa-miR-3615 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3615 inhibitor
hsa-miR-3615 inhibitor
- HY-RI01908
-
|
MicroRNA
|
Cancer
|
hsa-miR-634 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-634 inhibitor
hsa-miR-634 inhibitor
- HY-RI01146
-
|
MicroRNA
|
Cancer
|
hsa-miR-4523 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4523 inhibitor
hsa-miR-4523 inhibitor
- HY-RI03245
-
|
MicroRNA
|
Cancer
|
mmu-miR-5099 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5099 inhibitor
mmu-miR-5099 inhibitor
- HY-RI02458
-
|
MicroRNA
|
Cancer
|
hsa-miR-8066 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8066 inhibitor
hsa-miR-8066 inhibitor
- HY-RI01063
-
|
MicroRNA
|
Cancer
|
hsa-miR-4457 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4457 inhibitor
hsa-miR-4457 inhibitor
- HY-RI03343
-
|
MicroRNA
|
Cancer
|
mmu-miR-6337 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6337 inhibitor
mmu-miR-6337 inhibitor
- HY-RI01247
-
|
MicroRNA
|
Cancer
|
hsa-miR-4678 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4678 inhibitor
hsa-miR-4678 inhibitor
- HY-RI03540
-
|
MicroRNA
|
Cancer
|
mmu-miR-691 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-691 inhibitor
mmu-miR-691 inhibitor
- HY-RI02451
-
|
MicroRNA
|
Cancer
|
hsa-miR-8059 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8059 inhibitor
hsa-miR-8059 inhibitor
- HY-RI00818
-
|
MicroRNA
|
Cancer
|
hsa-miR-3713 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3713 inhibitor
hsa-miR-3713 inhibitor
- HY-RI01774
-
|
MicroRNA
|
Cancer
|
hsa-miR-5693 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5693 inhibitor
hsa-miR-5693 inhibitor
- HY-RI02583
-
|
MicroRNA
|
Cancer
|
mmu-miR-1195 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1195 inhibitor
mmu-miR-1195 inhibitor
- HY-RI03355
-
|
MicroRNA
|
Cancer
|
mmu-miR-6349 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6349 inhibitor
mmu-miR-6349 inhibitor
- HY-RI01562
-
|
MicroRNA
|
Cancer
|
hsa-miR-5188 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5188 inhibitor
hsa-miR-5188 inhibitor
- HY-RI04575
-
|
MicroRNA
|
Cancer
|
rno-miR-762 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-762 inhibitor
rno-miR-762 inhibitor
- HY-RI01905
-
|
MicroRNA
|
Cancer
|
hsa-miR-631 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-631 inhibitor
hsa-miR-631 inhibitor
- HY-RI00504
-
|
MicroRNA
|
Cancer
|
hsa-miR-2909 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-2909 inhibitor
hsa-miR-2909 inhibitor
- HY-RI03604
-
|
MicroRNA
|
Cancer
|
mmu-miR-694 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-694 inhibitor
mmu-miR-694 inhibitor
- HY-RI00108
-
|
MicroRNA
|
Cancer
|
hsa-miR-12132 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12132 inhibitor
hsa-miR-12132 inhibitor
- HY-RI01911
-
|
MicroRNA
|
Cancer
|
hsa-miR-637 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-637 inhibitor
hsa-miR-637 inhibitor
- HY-RI01096
-
|
MicroRNA
|
Cancer
|
hsa-miR-4487 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4487 inhibitor
hsa-miR-4487 inhibitor
- HY-RI00545
-
|
MicroRNA
|
Cancer
|
hsa-miR-3115 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3115 inhibitor
hsa-miR-3115 inhibitor
- HY-RI00057
-
|
MicroRNA
|
Cancer
|
hsa-miR-107 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-107 inhibitor
hsa-miR-107 inhibitor
- HY-RI00665
-
|
MicroRNA
|
Cancer
|
hsa-miR-3198 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3198 inhibitor
hsa-miR-3198 inhibitor
- HY-RI04209
-
|
MicroRNA
|
Cancer
|
rno-miR-105 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-105 inhibitor
rno-miR-105 inhibitor
- HY-RI04156
-
|
MicroRNA
|
Cancer
|
mmu-miR-8108 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8108 inhibitor
mmu-miR-8108 inhibitor
- HY-RI03421
-
|
MicroRNA
|
Cancer
|
mmu-miR-6414 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6414 inhibitor
mmu-miR-6414 inhibitor
- HY-RI00910
-
|
MicroRNA
|
Cancer
|
hsa-miR-3972 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3972 inhibitor
hsa-miR-3972 inhibitor
- HY-RI03266
-
|
MicroRNA
|
Cancer
|
mmu-miR-5122 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5122 inhibitor
mmu-miR-5122 inhibitor
- HY-RI00975
-
|
MicroRNA
|
Cancer
|
hsa-miR-4295 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4295 inhibitor
hsa-miR-4295 inhibitor
- HY-RI03370
-
|
MicroRNA
|
Cancer
|
mmu-miR-6364 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6364 inhibitor
mmu-miR-6364 inhibitor
- HY-RI00099
-
|
MicroRNA
|
Cancer
|
hsa-miR-12123 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12123 inhibitor
hsa-miR-12123 inhibitor
- HY-RI03366
-
|
MicroRNA
|
Cancer
|
mmu-miR-6360 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6360 inhibitor
mmu-miR-6360 inhibitor
- HY-RI04379
-
|
MicroRNA
|
Cancer
|
rno-miR-3542 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3542 inhibitor
rno-miR-3542 inhibitor
- HY-RI01989
-
|
MicroRNA
|
Cancer
|
hsa-miR-665 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-665 inhibitor
hsa-miR-665 inhibitor
- HY-RI03509
-
|
MicroRNA
|
Cancer
|
mmu-miR-687 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-687 inhibitor
mmu-miR-687 inhibitor
- HY-RI02545
-
|
MicroRNA
|
Cancer
|
hsa-miR-9899 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-9899 inhibitor
hsa-miR-9899 inhibitor
- HY-RI03157
-
|
MicroRNA
|
Cancer
|
mmu-miR-453 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-453 inhibitor
mmu-miR-453 inhibitor
- HY-RI00183
-
|
MicroRNA
|
Cancer
|
hsa-miR-1270 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1270 inhibitor
hsa-miR-1270 inhibitor
- HY-RI01091
-
|
MicroRNA
|
Cancer
|
hsa-miR-4483 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4483 inhibitor
hsa-miR-4483 inhibitor
- HY-RI01862
-
|
MicroRNA
|
Cancer
|
hsa-miR-6088 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6088 inhibitor
hsa-miR-6088 inhibitor
- HY-RI04351
-
|
MicroRNA
|
Cancer
|
rno-miR-327 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-327 inhibitor
rno-miR-327 inhibitor
- HY-RI00801
-
|
MicroRNA
|
Cancer
|
hsa-miR-3685 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3685 inhibitor
hsa-miR-3685 inhibitor
- HY-RI04386
-
|
MicroRNA
|
Cancer
|
rno-miR-3550 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3550 inhibitor
rno-miR-3550 inhibitor
- HY-RI00767
-
|
MicroRNA
|
Cancer
|
hsa-miR-3660 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3660 inhibitor
hsa-miR-3660 inhibitor
- HY-RI01785
-
|
MicroRNA
|
Cancer
|
hsa-miR-5703 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5703 inhibitor
hsa-miR-5703 inhibitor
- HY-RI01330
-
|
MicroRNA
|
Cancer
|
hsa-miR-4730 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4730 inhibitor
hsa-miR-4730 inhibitor
- HY-RI03142
-
|
MicroRNA
|
Cancer
|
mmu-miR-432 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-432 inhibitor
mmu-miR-432 inhibitor
- HY-RI00987
-
|
MicroRNA
|
Cancer
|
hsa-miR-4307 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4307 inhibitor
hsa-miR-4307 inhibitor
- HY-RI00195
-
|
MicroRNA
|
Cancer
|
hsa-miR-1278 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1278 inhibitor
hsa-miR-1278 inhibitor
- HY-RI01848
-
|
MicroRNA
|
Cancer
|
hsa-miR-6074 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6074 inhibitor
hsa-miR-6074 inhibitor
- HY-RI03404
-
|
MicroRNA
|
Cancer
|
mmu-miR-6397 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6397 inhibitor
mmu-miR-6397 inhibitor
- HY-RI00951
-
|
MicroRNA
|
Cancer
|
hsa-miR-4272 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4272 inhibitor
hsa-miR-4272 inhibitor
- HY-RI00206
-
|
MicroRNA
|
Cancer
|
hsa-miR-1286 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1286 inhibitor
hsa-miR-1286 inhibitor
- HY-RI02819
-
|
MicroRNA
|
Cancer
|
mmu-miR-207 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-207 inhibitor
mmu-miR-207 inhibitor
- HY-RI03087
-
|
MicroRNA
|
Cancer
|
mmu-miR-3552 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-3552 inhibitor
mmu-miR-3552 inhibitor
- HY-RI00619
-
|
MicroRNA
|
Cancer
|
hsa-miR-3163 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3163 inhibitor
hsa-miR-3163 inhibitor
- HY-RI03283
-
|
MicroRNA
|
Cancer
|
mmu-miR-5135 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5135 inhibitor
mmu-miR-5135 inhibitor
- HY-RI01535
-
|
MicroRNA
|
Cancer
|
hsa-miR-5100 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5100 inhibitor
hsa-miR-5100 inhibitor
- HY-RI01983
-
|
MicroRNA
|
Cancer
|
hsa-miR-661 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-661 inhibitor
hsa-miR-661 inhibitor
- HY-RI01872
-
|
MicroRNA
|
Cancer
|
hsa-miR-6128 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6128 inhibitor
hsa-miR-6128 inhibitor
- HY-RI02745
-
|
MicroRNA
|
Cancer
|
mmu-miR-1931 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1931 inhibitor
mmu-miR-1931 inhibitor
- HY-RI03251
-
|
MicroRNA
|
Cancer
|
mmu-miR-5106 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5106 inhibitor
mmu-miR-5106 inhibitor
- HY-RI03349
-
|
MicroRNA
|
Cancer
|
mmu-miR-6343 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6343 inhibitor
mmu-miR-6343 inhibitor
- HY-RI03925
-
|
MicroRNA
|
Cancer
|
mmu-miR-709 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-709 inhibitor
mmu-miR-709 inhibitor
- HY-RI00585
-
|
MicroRNA
|
Cancer
|
hsa-miR-3143 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3143 inhibitor
hsa-miR-3143 inhibitor
- HY-RI01012
-
|
MicroRNA
|
Cancer
|
hsa-miR-4328 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4328 inhibitor
hsa-miR-4328 inhibitor
- HY-RI01836
-
|
MicroRNA
|
Cancer
|
hsa-miR-603 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-603 inhibitor
hsa-miR-603 inhibitor
- HY-RI01845
-
|
MicroRNA
|
Cancer
|
hsa-miR-6071 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6071 inhibitor
hsa-miR-6071 inhibitor
- HY-RI00866
-
|
MicroRNA
|
Cancer
|
hsa-miR-3909 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3909 inhibitor
hsa-miR-3909 inhibitor
- HY-RI03127
-
|
MicroRNA
|
Cancer
|
mmu-miR-3963 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-3963 inhibitor
mmu-miR-3963 inhibitor
- HY-RI01044
-
|
MicroRNA
|
Cancer
|
hsa-miR-4440 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4440 inhibitor
hsa-miR-4440 inhibitor
- HY-RI01866
-
|
MicroRNA
|
Cancer
|
hsa-miR-610 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-610 inhibitor
hsa-miR-610 inhibitor
- HY-RI03280
-
|
MicroRNA
|
Cancer
|
mmu-miR-5133 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5133 inhibitor
mmu-miR-5133 inhibitor
- HY-RI02481
-
|
MicroRNA
|
Cancer
|
hsa-miR-8089 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8089 inhibitor
hsa-miR-8089 inhibitor
- HY-RI03271
-
|
MicroRNA
|
Cancer
|
mmu-miR-5126 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5126 inhibitor
mmu-miR-5126 inhibitor
- HY-RI00186
-
|
MicroRNA
|
Cancer
|
hsa-miR-1272 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1272 inhibitor
hsa-miR-1272 inhibitor
- HY-RI00095
-
|
MicroRNA
|
Cancer
|
hsa-miR-12119 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12119 inhibitor
hsa-miR-12119 inhibitor
- HY-RI02776
-
|
MicroRNA
|
Cancer
|
mmu-miR-1956 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1956 inhibitor
mmu-miR-1956 inhibitor
- HY-RI04375
-
|
MicroRNA
|
Cancer
|
rno-miR-350 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-350 inhibitor
rno-miR-350 inhibitor
- HY-RI01189
-
|
MicroRNA
|
Cancer
|
hsa-miR-4644 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4644 inhibitor
hsa-miR-4644 inhibitor
- HY-RI01086
-
|
MicroRNA
|
Cancer
|
hsa-miR-448 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-448 inhibitor
hsa-miR-448 inhibitor
- HY-RI02761
-
|
MicroRNA
|
Cancer
|
mmu-miR-1945 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1945 inhibitor
mmu-miR-1945 inhibitor
- HY-RI00911
-
|
MicroRNA
|
Cancer
|
hsa-miR-3973 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3973 inhibitor
hsa-miR-3973 inhibitor
- HY-RI02740
-
|
MicroRNA
|
Cancer
|
mmu-miR-1928 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1928 inhibitor
mmu-miR-1928 inhibitor
- HY-RI01832
-
|
MicroRNA
|
Cancer
|
hsa-miR-599 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-599 inhibitor
hsa-miR-599 inhibitor
- HY-RI02548
-
|
MicroRNA
|
Cancer
|
hsa-miR-9902 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-9902 inhibitor
hsa-miR-9902 inhibitor
- HY-RI01288
-
|
MicroRNA
|
Cancer
|
hsa-miR-4705 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4705 inhibitor
hsa-miR-4705 inhibitor
- HY-RI00763
-
|
MicroRNA
|
Cancer
|
hsa-miR-3659 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3659 inhibitor
hsa-miR-3659 inhibitor
- HY-RI00645
-
|
MicroRNA
|
Cancer
|
hsa-miR-3185 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3185 inhibitor
hsa-miR-3185 inhibitor
- HY-RI02519
-
|
MicroRNA
|
Cancer
|
hsa-miR-935 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-935 inhibitor
hsa-miR-935 inhibitor
- HY-RI04033
-
|
MicroRNA
|
Cancer
|
mmu-miR-7578 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-7578 inhibitor
mmu-miR-7578 inhibitor
- HY-RI01792
-
|
MicroRNA
|
Cancer
|
hsa-miR-571 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-571 inhibitor
hsa-miR-571 inhibitor
- HY-RI00624
-
|
MicroRNA
|
Cancer
|
hsa-miR-3168 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3168 inhibitor
hsa-miR-3168 inhibitor
- HY-RI02479
-
|
MicroRNA
|
Cancer
|
hsa-miR-8087 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8087 inhibitor
hsa-miR-8087 inhibitor
- HY-RI03394
-
|
MicroRNA
|
Cancer
|
mmu-miR-6388 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6388 inhibitor
mmu-miR-6388 inhibitor
- HY-RI00963
-
|
MicroRNA
|
Cancer
|
hsa-miR-4284 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4284 inhibitor
hsa-miR-4284 inhibitor
- HY-RI01816
-
|
MicroRNA
|
Cancer
|
hsa-miR-586 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-586 inhibitor
hsa-miR-586 inhibitor
- HY-RI00961
-
|
MicroRNA
|
Cancer
|
hsa-miR-4282 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4282 inhibitor
hsa-miR-4282 inhibitor
- HY-RI00875
-
|
MicroRNA
|
Cancer
|
hsa-miR-3916 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3916 inhibitor
hsa-miR-3916 inhibitor
- HY-RI02551
-
|
MicroRNA
|
Cancer
|
hsa-miR-9985 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-9985 inhibitor
hsa-miR-9985 inhibitor
- HY-RI01194
-
|
MicroRNA
|
Cancer
|
hsa-miR-4647 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4647 inhibitor
hsa-miR-4647 inhibitor
- HY-RI02466
-
|
MicroRNA
|
Cancer
|
hsa-miR-8074 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8074 inhibitor
hsa-miR-8074 inhibitor
- HY-RI02460
-
|
MicroRNA
|
Cancer
|
hsa-miR-8068 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8068 inhibitor
hsa-miR-8068 inhibitor
- HY-RI03401
-
|
MicroRNA
|
Cancer
|
mmu-miR-6394 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6394 inhibitor
mmu-miR-6394 inhibitor
- HY-RI03294
-
|
MicroRNA
|
Cancer
|
mmu-miR-546 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-546 inhibitor
mmu-miR-546 inhibitor
- HY-RI00892
-
|
MicroRNA
|
Cancer
|
hsa-miR-3929 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3929 inhibitor
hsa-miR-3929 inhibitor
- HY-RI04163
-
|
MicroRNA
|
Cancer
|
mmu-miR-8115 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8115 inhibitor
mmu-miR-8115 inhibitor
- HY-RI03952
-
|
MicroRNA
|
Cancer
|
mmu-miR-714 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-714 inhibitor
mmu-miR-714 inhibitor
- HY-RI00620
-
|
MicroRNA
|
Cancer
|
hsa-miR-3164 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3164 inhibitor
hsa-miR-3164 inhibitor
- HY-RI01100
-
|
MicroRNA
|
Cancer
|
hsa-miR-4491 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4491 inhibitor
hsa-miR-4491 inhibitor
- HY-RI01043
-
|
MicroRNA
|
Cancer
|
hsa-miR-4439 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4439 inhibitor
hsa-miR-4439 inhibitor
- HY-RI03377
-
|
MicroRNA
|
Cancer
|
mmu-miR-6371 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6371 inhibitor
mmu-miR-6371 inhibitor
- HY-RI01085
-
|
MicroRNA
|
Cancer
|
hsa-miR-4479 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4479 inhibitor
hsa-miR-4479 inhibitor
- HY-RI00774
-
|
MicroRNA
|
Cancer
|
hsa-miR-3665 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3665 inhibitor
hsa-miR-3665 inhibitor
- HY-RI02468
-
|
MicroRNA
|
Cancer
|
hsa-miR-8076 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8076 inhibitor
hsa-miR-8076 inhibitor
- HY-RI01576
-
|
MicroRNA
|
Cancer
|
hsa-miR-5190 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5190 inhibitor
hsa-miR-5190 inhibitor
- HY-RI01216
-
|
MicroRNA
|
Cancer
|
hsa-miR-4660 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4660 inhibitor
hsa-miR-4660 inhibitor
- HY-RI01065
-
|
MicroRNA
|
Cancer
|
hsa-miR-4460 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4460 inhibitor
hsa-miR-4460 inhibitor
- HY-RI00213
-
|
MicroRNA
|
Cancer
|
hsa-miR-1291 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1291 inhibitor
hsa-miR-1291 inhibitor
- HY-RI00879
-
|
MicroRNA
|
Cancer
|
hsa-miR-3920 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3920 inhibitor
hsa-miR-3920 inhibitor
- HY-RI03395
-
|
MicroRNA
|
Cancer
|
mmu-miR-6389 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6389 inhibitor
mmu-miR-6389 inhibitor
- HY-RI00569
-
|
MicroRNA
|
Cancer
|
hsa-miR-3131 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3131 inhibitor
hsa-miR-3131 inhibitor
- HY-RI01875
-
|
MicroRNA
|
Cancer
|
hsa-miR-6130 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6130 inhibitor
hsa-miR-6130 inhibitor
- HY-RI00064
-
|
MicroRNA
|
Cancer
|
hsa-miR-11399 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-11399 inhibitor
hsa-miR-11399 inhibitor
- HY-RI00218
-
|
MicroRNA
|
Cancer
|
hsa-miR-1293 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1293 inhibitor
hsa-miR-1293 inhibitor
- HY-RI01453
-
|
MicroRNA
|
Cancer
|
hsa-miR-484 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-484 inhibitor
hsa-miR-484 inhibitor
- HY-RI02751
-
|
MicroRNA
|
Cancer
|
mmu-miR-1936 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1936 inhibitor
mmu-miR-1936 inhibitor
- HY-RI01177
-
|
MicroRNA
|
Cancer
|
hsa-miR-4635 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4635 inhibitor
hsa-miR-4635 inhibitor
- HY-RI01162
-
|
MicroRNA
|
Cancer
|
hsa-miR-4535 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4535 inhibitor
hsa-miR-4535 inhibitor
- HY-RI01057
-
|
MicroRNA
|
Cancer
|
hsa-miR-4451 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4451 inhibitor
hsa-miR-4451 inhibitor
- HY-RI03500
-
|
MicroRNA
|
Cancer
|
mmu-miR-678 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-678 inhibitor
mmu-miR-678 inhibitor
- HY-RI01045
-
|
MicroRNA
|
Cancer
|
hsa-miR-4441 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4441 inhibitor
hsa-miR-4441 inhibitor
- HY-RI00211
-
|
MicroRNA
|
Cancer
|
hsa-miR-1289 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1289 inhibitor
hsa-miR-1289 inhibitor
- HY-RI01008
-
|
MicroRNA
|
Cancer
|
hsa-miR-4325 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4325 inhibitor
hsa-miR-4325 inhibitor
- HY-RI04562
-
|
MicroRNA
|
Cancer
|
rno-miR-678 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-678 inhibitor
rno-miR-678 inhibitor
- HY-RI01801
-
|
MicroRNA
|
Cancer
|
hsa-miR-577 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-577 inhibitor
hsa-miR-577 inhibitor
- HY-RI03362
-
|
MicroRNA
|
Cancer
|
mmu-miR-6356 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6356 inhibitor
mmu-miR-6356 inhibitor
- HY-RI00593
-
|
MicroRNA
|
Cancer
|
hsa-miR-3149 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3149 inhibitor
hsa-miR-3149 inhibitor
- HY-RI00762
-
|
MicroRNA
|
Cancer
|
hsa-miR-3658 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3658 inhibitor
hsa-miR-3658 inhibitor
- HY-RI01874
-
|
MicroRNA
|
Cancer
|
hsa-miR-613 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-613 inhibitor
hsa-miR-613 inhibitor
- HY-RI01887
-
|
MicroRNA
|
Cancer
|
hsa-miR-618 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-618 inhibitor
hsa-miR-618 inhibitor
- HY-RI03667
-
|
MicroRNA
|
Cancer
|
mmu-miR-697 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-697 inhibitor
mmu-miR-697 inhibitor
- HY-RI00947
-
|
MicroRNA
|
Cancer
|
hsa-miR-4268 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4268 inhibitor
hsa-miR-4268 inhibitor
- HY-RI03239
-
|
MicroRNA
|
Cancer
|
mmu-miR-5046 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5046 inhibitor
mmu-miR-5046 inhibitor
- HY-RI01106
-
|
MicroRNA
|
Cancer
|
hsa-miR-4497 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4497 inhibitor
hsa-miR-4497 inhibitor
- HY-RI00199
-
|
MicroRNA
|
Cancer
|
hsa-miR-1282 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1282 inhibitor
hsa-miR-1282 inhibitor
- HY-RI01842
-
|
MicroRNA
|
Cancer
|
hsa-miR-6069 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6069 inhibitor
hsa-miR-6069 inhibitor
- HY-RI01253
-
|
MicroRNA
|
Cancer
|
hsa-miR-4683 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4683 inhibitor
hsa-miR-4683 inhibitor
- HY-RI01870
-
|
MicroRNA
|
Cancer
|
hsa-miR-6126 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6126 inhibitor
hsa-miR-6126 inhibitor
- HY-RI01775
-
|
MicroRNA
|
Cancer
|
hsa-miR-5694 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5694 inhibitor
hsa-miR-5694 inhibitor
- HY-RI01909
-
|
MicroRNA
|
Cancer
|
hsa-miR-635 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-635 inhibitor
hsa-miR-635 inhibitor
- HY-RI04411
-
|
MicroRNA
|
Cancer
|
rno-miR-3574 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3574 inhibitor
rno-miR-3574 inhibitor
- HY-RI00084
-
|
MicroRNA
|
Cancer
|
hsa-miR-1204 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1204 inhibitor
hsa-miR-1204 inhibitor
- HY-RI02510
-
|
MicroRNA
|
Cancer
|
hsa-miR-924 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-924 inhibitor
hsa-miR-924 inhibitor
- HY-RI00236
-
|
MicroRNA
|
Cancer
|
hsa-miR-1305 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1305 inhibitor
hsa-miR-1305 inhibitor
- HY-RI01277
-
|
MicroRNA
|
Cancer
|
hsa-miR-4698 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4698 inhibitor
hsa-miR-4698 inhibitor
- HY-RI02730
-
|
MicroRNA
|
Cancer
|
mmu-miR-1905 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1905 inhibitor
mmu-miR-1905 inhibitor
- HY-RI00083
-
|
MicroRNA
|
Cancer
|
hsa-miR-1203 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1203 inhibitor
hsa-miR-1203 inhibitor
- HY-RI00941
-
|
MicroRNA
|
Cancer
|
hsa-miR-4262 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4262 inhibitor
hsa-miR-4262 inhibitor
- HY-RI01352
-
|
MicroRNA
|
Cancer
|
hsa-miR-4744 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4744 inhibitor
hsa-miR-4744 inhibitor
- HY-RI01062
-
|
MicroRNA
|
Cancer
|
hsa-miR-4456 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4456 inhibitor
hsa-miR-4456 inhibitor
- HY-RI01522
-
|
MicroRNA
|
Cancer
|
hsa-miR-5087 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5087 inhibitor
hsa-miR-5087 inhibitor
- HY-RI03396
-
|
MicroRNA
|
Cancer
|
mmu-miR-6390 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6390 inhibitor
mmu-miR-6390 inhibitor
- HY-RI00591
-
|
MicroRNA
|
Cancer
|
hsa-miR-3147 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3147 inhibitor
hsa-miR-3147 inhibitor
- HY-RI03405
-
|
MicroRNA
|
Cancer
|
mmu-miR-6398 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6398 inhibitor
mmu-miR-6398 inhibitor
- HY-RI00988
-
|
MicroRNA
|
Cancer
|
hsa-miR-4308 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4308 inhibitor
hsa-miR-4308 inhibitor
- HY-RI02456
-
|
MicroRNA
|
Cancer
|
hsa-miR-8064 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8064 inhibitor
hsa-miR-8064 inhibitor
- HY-RI01827
-
|
MicroRNA
|
Cancer
|
hsa-miR-595 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-595 inhibitor
hsa-miR-595 inhibitor
- HY-RI01855
-
|
MicroRNA
|
Cancer
|
hsa-miR-6080 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6080 inhibitor
hsa-miR-6080 inhibitor
- HY-RI02471
-
|
MicroRNA
|
Cancer
|
hsa-miR-8079 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8079 inhibitor
hsa-miR-8079 inhibitor
- HY-RI02716
-
|
MicroRNA
|
Cancer
|
mmu-miR-1895 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1895 inhibitor
mmu-miR-1895 inhibitor
- HY-RI03937
-
|
MicroRNA
|
Cancer
|
mmu-miR-710 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-710 inhibitor
mmu-miR-710 inhibitor
- HY-RI02838
-
|
MicroRNA
|
Cancer
|
mmu-miR-2183 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-2183 inhibitor
mmu-miR-2183 inhibitor
- HY-RI01261
-
|
MicroRNA
|
Cancer
|
hsa-miR-4688 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4688 inhibitor
hsa-miR-4688 inhibitor
- HY-RI01757
-
|
MicroRNA
|
Cancer
|
hsa-miR-568 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-568 inhibitor
hsa-miR-568 inhibitor
- HY-RI04540
-
|
MicroRNA
|
Cancer
|
rno-miR-6328 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6328 inhibitor
rno-miR-6328 inhibitor
- HY-RI04429
-
|
MicroRNA
|
Cancer
|
rno-miR-3589 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3589 inhibitor
rno-miR-3589 inhibitor
- HY-RI04532
-
|
MicroRNA
|
Cancer
|
rno-miR-6320 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6320 inhibitor
rno-miR-6320 inhibitor
- HY-RI04140
-
|
MicroRNA
|
Cancer
|
mmu-miR-8092 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8092 inhibitor
mmu-miR-8092 inhibitor
- HY-RI03376
-
|
MicroRNA
|
Cancer
|
mmu-miR-6370 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6370 inhibitor
mmu-miR-6370 inhibitor
- HY-RI02475
-
|
MicroRNA
|
Cancer
|
hsa-miR-8083 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8083 inhibitor
hsa-miR-8083 inhibitor
- HY-RI01802
-
|
MicroRNA
|
Cancer
|
hsa-miR-578 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-578 inhibitor
hsa-miR-578 inhibitor
- HY-RI02420
-
|
MicroRNA
|
Cancer
|
hsa-miR-7705 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-7705 inhibitor
hsa-miR-7705 inhibitor
- HY-RI00781
-
|
MicroRNA
|
Cancer
|
hsa-miR-3672 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3672 inhibitor
hsa-miR-3672 inhibitor
- HY-RI00584
-
|
MicroRNA
|
Cancer
|
hsa-miR-3142 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3142 inhibitor
hsa-miR-3142 inhibitor
- HY-RI02480
-
|
MicroRNA
|
Cancer
|
hsa-miR-8088 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8088 inhibitor
hsa-miR-8088 inhibitor
- HY-RI00810
-
|
MicroRNA
|
Cancer
|
hsa-miR-3690 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3690 inhibitor
hsa-miR-3690 inhibitor
- HY-RI02772
-
|
MicroRNA
|
Cancer
|
mmu-miR-1953 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1953 inhibitor
mmu-miR-1953 inhibitor
- HY-RI01762
-
|
MicroRNA
|
Cancer
|
hsa-miR-5683 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5683 inhibitor
hsa-miR-5683 inhibitor
- HY-RI03411
-
|
MicroRNA
|
Cancer
|
mmu-miR-6404 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6404 inhibitor
mmu-miR-6404 inhibitor
- HY-RI03125
-
|
MicroRNA
|
Cancer
|
mmu-miR-3961 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-3961 inhibitor
mmu-miR-3961 inhibitor
- HY-RI01429
-
|
MicroRNA
|
Cancer
|
hsa-miR-4791 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4791 inhibitor
hsa-miR-4791 inhibitor
- HY-RI04573
-
|
MicroRNA
|
Cancer
|
rno-miR-7578 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-7578 inhibitor
rno-miR-7578 inhibitor
- HY-RI03375
-
|
MicroRNA
|
Cancer
|
mmu-miR-6369 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6369 inhibitor
mmu-miR-6369 inhibitor
- HY-RI00936
-
|
MicroRNA
|
Cancer
|
hsa-miR-4257 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4257 inhibitor
hsa-miR-4257 inhibitor
- HY-RI01134
-
|
MicroRNA
|
Cancer
|
hsa-miR-4515 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4515 inhibitor
hsa-miR-4515 inhibitor
- HY-RI00094
-
|
MicroRNA
|
Cancer
|
hsa-miR-12118 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12118 inhibitor
hsa-miR-12118 inhibitor
- HY-RI03353
-
|
MicroRNA
|
Cancer
|
mmu-miR-6347 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6347 inhibitor
mmu-miR-6347 inhibitor
- HY-RI03016
-
|
MicroRNA
|
Cancer
|
mmu-miR-3154 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-3154 inhibitor
mmu-miR-3154 inhibitor
- HY-RI01341
-
|
MicroRNA
|
Cancer
|
hsa-miR-4737 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4737 inhibitor
hsa-miR-4737 inhibitor
- HY-RI02793
-
|
MicroRNA
|
Cancer
|
mmu-miR-1970 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1970 inhibitor
mmu-miR-1970 inhibitor
- HY-RI04527
-
|
MicroRNA
|
Cancer
|
rno-miR-6316 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6316 inhibitor
rno-miR-6316 inhibitor
- HY-RI00974
-
|
MicroRNA
|
Cancer
|
hsa-miR-4294 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4294 inhibitor
hsa-miR-4294 inhibitor
- HY-RI00432
-
|
MicroRNA
|
Cancer
|
hsa-miR-2113 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-2113 inhibitor
hsa-miR-2113 inhibitor
- HY-RI01337
-
|
MicroRNA
|
Cancer
|
hsa-miR-4734 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4734 inhibitor
hsa-miR-4734 inhibitor
- HY-RI01717
-
|
MicroRNA
|
Cancer
|
hsa-miR-554 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-554 inhibitor
hsa-miR-554 inhibitor
- HY-RI01116
-
|
MicroRNA
|
Cancer
|
hsa-miR-4502 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4502 inhibitor
hsa-miR-4502 inhibitor
- HY-RI00985
-
|
MicroRNA
|
Cancer
|
hsa-miR-4305 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4305 inhibitor
hsa-miR-4305 inhibitor
- HY-RI00100
-
|
MicroRNA
|
Cancer
|
hsa-miR-12124 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12124 inhibitor
hsa-miR-12124 inhibitor
- HY-RI02770
-
|
MicroRNA
|
Cancer
|
mmu-miR-1951 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1951 inhibitor
mmu-miR-1951 inhibitor
- HY-RI01528
-
|
MicroRNA
|
Cancer
|
hsa-miR-5091 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5091 inhibitor
hsa-miR-5091 inhibitor
- HY-RI01755
-
|
MicroRNA
|
Cancer
|
hsa-miR-564 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-564 inhibitor
hsa-miR-564 inhibitor
- HY-RI02694
-
|
MicroRNA
|
Cancer
|
mmu-miR-1668 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1668 inhibitor
mmu-miR-1668 inhibitor
- HY-RI02448
-
|
MicroRNA
|
Cancer
|
hsa-miR-8056 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8056 inhibitor
hsa-miR-8056 inhibitor
- HY-RI00571
-
|
MicroRNA
|
Cancer
|
hsa-miR-3133 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3133 inhibitor
hsa-miR-3133 inhibitor
- HY-RI00311
-
|
MicroRNA
|
Cancer
|
hsa-miR-1538 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1538 inhibitor
hsa-miR-1538 inhibitor
- HY-RI01828
-
|
MicroRNA
|
Cancer
|
hsa-miR-596 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-596 inhibitor
hsa-miR-596 inhibitor
- HY-RI00887
-
|
MicroRNA
|
Cancer
|
hsa-miR-3926 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3926 inhibitor
hsa-miR-3926 inhibitor
- HY-RI00106
-
|
MicroRNA
|
Cancer
|
hsa-miR-12130 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12130 inhibitor
hsa-miR-12130 inhibitor
- HY-RI02374
-
|
MicroRNA
|
Cancer
|
hsa-miR-7150 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-7150 inhibitor
hsa-miR-7150 inhibitor
- HY-RI00392
-
|
MicroRNA
|
Cancer
|
hsa-miR-1972 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1972 inhibitor
hsa-miR-1972 inhibitor
- HY-RI01788
-
|
MicroRNA
|
Cancer
|
hsa-miR-5705 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5705 inhibitor
hsa-miR-5705 inhibitor
- HY-RI03842
-
|
MicroRNA
|
Cancer
|
mmu-miR-705 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-705 inhibitor
mmu-miR-705 inhibitor
- HY-D2486
-
|
Fluorescent Dye
|
Others
|
Sulfo Cy3 bis NHS ester is a derivative of Cy3 (HY-D0822) dye containing sulfonate ions. Sulfo Cy3 bis NHS ester can be used to label the primary amines (R-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules.
|
-
- HY-RI00246
-
|
MicroRNA
|
Cancer
|
hsa-miR-1322 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1322 inhibitor
hsa-miR-1322 inhibitor
- HY-RI01121
-
|
MicroRNA
|
Cancer
|
hsa-miR-4507 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4507 inhibitor
hsa-miR-4507 inhibitor
- HY-RI00579
-
|
MicroRNA
|
Cancer
|
hsa-miR-3139 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3139 inhibitor
hsa-miR-3139 inhibitor
- HY-RI00627
-
|
MicroRNA
|
Cancer
|
hsa-miR-3171 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3171 inhibitor
hsa-miR-3171 inhibitor
- HY-RI03441
-
|
MicroRNA
|
Cancer
|
mmu-miR-6541 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6541 inhibitor
mmu-miR-6541 inhibitor
- HY-RI03272
-
|
MicroRNA
|
Cancer
|
mmu-miR-5127 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5127 inhibitor
mmu-miR-5127 inhibitor
- HY-RI00930
-
|
MicroRNA
|
Cancer
|
hsa-miR-4252 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4252 inhibitor
hsa-miR-4252 inhibitor
- HY-RI00515
-
|
MicroRNA
|
Cancer
|
hsa-miR-300 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-300 inhibitor
hsa-miR-300 inhibitor
- HY-RI02399
-
|
MicroRNA
|
Cancer
|
hsa-miR-718 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-718 inhibitor
hsa-miR-718 inhibitor
- HY-RI01077
-
|
MicroRNA
|
Cancer
|
hsa-miR-4473 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4473 inhibitor
hsa-miR-4473 inhibitor
- HY-RI04168
-
|
MicroRNA
|
Cancer
|
mmu-miR-8120 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8120 inhibitor
mmu-miR-8120 inhibitor
- HY-RI00683
-
|
MicroRNA
|
Cancer
|
hsa-miR-325 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-325 inhibitor
hsa-miR-325 inhibitor
- HY-RI04382
-
|
MicroRNA
|
Cancer
|
rno-miR-3546 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3546 inhibitor
rno-miR-3546 inhibitor
- HY-RI04139
-
|
MicroRNA
|
Cancer
|
mmu-miR-8091 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8091 inhibitor
mmu-miR-8091 inhibitor
- HY-RI00995
-
|
MicroRNA
|
Cancer
|
hsa-miR-4314 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4314 inhibitor
hsa-miR-4314 inhibitor
- HY-RI01274
-
|
MicroRNA
|
Cancer
|
hsa-miR-4696 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4696 inhibitor
hsa-miR-4696 inhibitor
- HY-RI00160
-
|
MicroRNA
|
Cancer
|
hsa-miR-1256 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1256 inhibitor
hsa-miR-1256 inhibitor
- HY-RI02524
-
|
MicroRNA
|
Cancer
|
hsa-miR-938 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-938 inhibitor
hsa-miR-938 inhibitor
- HY-RI00127
-
|
MicroRNA
|
Cancer
|
hsa-miR-1231 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1231 inhibitor
hsa-miR-1231 inhibitor
- HY-RI01879
-
|
MicroRNA
|
Cancer
|
hsa-miR-6134 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6134 inhibitor
hsa-miR-6134 inhibitor
- HY-RI02528
-
|
MicroRNA
|
Cancer
|
hsa-miR-940 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-940 inhibitor
hsa-miR-940 inhibitor
- HY-RI03510
-
|
MicroRNA
|
Cancer
|
mmu-miR-688 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-688 inhibitor
mmu-miR-688 inhibitor
- HY-RI01761
-
|
MicroRNA
|
Cancer
|
hsa-miR-5682 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5682 inhibitor
hsa-miR-5682 inhibitor
- HY-RI01018
-
|
MicroRNA
|
Cancer
|
hsa-miR-4420 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4420 inhibitor
hsa-miR-4420 inhibitor
- HY-RI02720
-
|
MicroRNA
|
Cancer
|
mmu-miR-1898 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1898 inhibitor
mmu-miR-1898 inhibitor
- HY-RI00970
-
|
MicroRNA
|
Cancer
|
hsa-miR-4290 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4290 inhibitor
hsa-miR-4290 inhibitor
- HY-RI00965
-
|
MicroRNA
|
Cancer
|
hsa-miR-4286 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4286 inhibitor
hsa-miR-4286 inhibitor
- HY-RI00139
-
|
MicroRNA
|
Cancer
|
hsa-miR-1244 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1244 inhibitor
hsa-miR-1244 inhibitor
- HY-RI01766
-
|
MicroRNA
|
Cancer
|
hsa-miR-5688 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5688 inhibitor
hsa-miR-5688 inhibitor
- HY-RI00065
-
|
MicroRNA
|
Cancer
|
hsa-miR-11400 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-11400 inhibitor
hsa-miR-11400 inhibitor
- HY-RI01397
-
|
MicroRNA
|
Cancer
|
hsa-miR-4771 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4771 inhibitor
hsa-miR-4771 inhibitor
- HY-RI02508
-
|
MicroRNA
|
Cancer
|
hsa-miR-921 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-921 inhibitor
hsa-miR-921 inhibitor
- HY-RI01010
-
|
MicroRNA
|
Cancer
|
hsa-miR-4326 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4326 inhibitor
hsa-miR-4326 inhibitor
- HY-RI02787
-
|
MicroRNA
|
Cancer
|
mmu-miR-1967 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1967 inhibitor
mmu-miR-1967 inhibitor
- HY-RI03416
-
|
MicroRNA
|
|
mmu-miR-6409 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6409 inhibitor
mmu-miR-6409 inhibitor
- HY-RI04273
-
|
MicroRNA
|
Cancer
|
rno-miR-1949 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-1949 inhibitor
rno-miR-1949 inhibitor
- HY-RI00955
-
|
MicroRNA
|
Cancer
|
hsa-miR-4276 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4276 inhibitor
hsa-miR-4276 inhibitor
- HY-RI01258
-
|
MicroRNA
|
Cancer
|
hsa-miR-4686 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4686 inhibitor
hsa-miR-4686 inhibitor
- HY-RI02408
-
|
MicroRNA
|
Cancer
|
hsa-miR-761 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-761 inhibitor
hsa-miR-761 inhibitor
- HY-RI02477
-
|
MicroRNA
|
Cancer
|
hsa-miR-8085 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8085 inhibitor
hsa-miR-8085 inhibitor
- HY-RI04165
-
|
MicroRNA
|
Cancer
|
mmu-miR-8117 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8117 inhibitor
mmu-miR-8117 inhibitor
- HY-RI01153
-
|
MicroRNA
|
Cancer
|
hsa-miR-4526 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4526 inhibitor
hsa-miR-4526 inhibitor
- HY-RI01396
-
|
MicroRNA
|
Cancer
|
hsa-miR-4770 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4770 inhibitor
hsa-miR-4770 inhibitor
- HY-RI03390
-
|
MicroRNA
|
Cancer
|
mmu-miR-6384 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6384 inhibitor
mmu-miR-6384 inhibitor
- HY-153485A
-
ISIS 766720 sodium; IONIS-GHR-LRx sodium
|
GHR
Small Interfering RNA (siRNA)
|
Others
|
Cimdelirsen is a novel, ligand-conjugated, hepatic-targeted investigative antisense oligonucleotide designed to reduce growth hormone receptor (GHr) synthesis, thereby inhibiting deleterious effects of growth hormone (GH) hypersecretion and reducing circulating insulin-like growth factor-1 (IGF-1) levels in acromegaly patients.
|
-
- HY-RI00578
-
|
MicroRNA
|
Cancer
|
hsa-miR-3138 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3138 inhibitor
hsa-miR-3138 inhibitor
- HY-RI00937
-
|
MicroRNA
|
Cancer
|
hsa-miR-4258 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4258 inhibitor
hsa-miR-4258 inhibitor
- HY-RI01833
-
|
MicroRNA
|
Cancer
|
hsa-miR-600 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-600 inhibitor
hsa-miR-600 inhibitor
- HY-RI00090
-
|
MicroRNA
|
Cancer
|
hsa-miR-12114 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12114 inhibitor
hsa-miR-12114 inhibitor
- HY-RI04523
-
|
MicroRNA
|
Cancer
|
rno-miR-6216 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6216 inhibitor
rno-miR-6216 inhibitor
- HY-RI03407
-
|
MicroRNA
|
Cancer
|
mmu-miR-6400 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6400 inhibitor
mmu-miR-6400 inhibitor
- HY-RI00956
-
|
MicroRNA
|
Cancer
|
hsa-miR-4277 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4277 inhibitor
hsa-miR-4277 inhibitor
- HY-RI01136
-
|
MicroRNA
|
Cancer
|
hsa-miR-4517 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4517 inhibitor
hsa-miR-4517 inhibitor
- HY-RI01859
-
|
MicroRNA
|
Cancer
|
hsa-miR-6084 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6084 inhibitor
hsa-miR-6084 inhibitor
- HY-RI04587
-
|
MicroRNA
|
Cancer
|
rno-miR-878 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-878 inhibitor
rno-miR-878 inhibitor
- HY-RI00756
-
|
MicroRNA
|
Cancer
|
hsa-miR-3650 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3650 inhibitor
hsa-miR-3650 inhibitor
- HY-RI01922
-
|
MicroRNA
|
Cancer
|
hsa-miR-647 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-647 inhibitor
hsa-miR-647 inhibitor
- HY-RI04167
-
|
MicroRNA
|
Cancer
|
mmu-miR-8119 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8119 inhibitor
mmu-miR-8119 inhibitor
- HY-RI01723
-
|
MicroRNA
|
Cancer
|
hsa-miR-5572 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5572 inhibitor
hsa-miR-5572 inhibitor
- HY-RI01578
-
|
MicroRNA
|
Cancer
|
hsa-miR-5192 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5192 inhibitor
hsa-miR-5192 inhibitor
- HY-RI02287
-
|
MicroRNA
|
Cancer
|
hsa-miR-6863 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6863 inhibitor
hsa-miR-6863 inhibitor
- HY-RI00203
-
|
MicroRNA
|
Cancer
|
hsa-miR-1284 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1284 inhibitor
hsa-miR-1284 inhibitor
- HY-RI03277
-
|
MicroRNA
|
Cancer
|
mmu-miR-5131 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5131 inhibitor
mmu-miR-5131 inhibitor
- HY-RI01756
-
|
MicroRNA
|
Cancer
|
hsa-miR-567 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-567 inhibitor
hsa-miR-567 inhibitor
- HY-RI03326
-
|
MicroRNA
|
Cancer
|
mmu-miR-5710 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5710 inhibitor
mmu-miR-5710 inhibitor
- HY-RI03506
-
|
MicroRNA
|
Cancer
|
mmu-miR-683 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-683 inhibitor
mmu-miR-683 inhibitor
- HY-RI00958
-
|
MicroRNA
|
Cancer
|
hsa-miR-4279 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4279 inhibitor
hsa-miR-4279 inhibitor
- HY-RI00670
-
|
MicroRNA
|
Cancer
|
hsa-miR-3202 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3202 inhibitor
hsa-miR-3202 inhibitor
- HY-RI01073
-
|
MicroRNA
|
Cancer
|
hsa-miR-4469 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4469 inhibitor
hsa-miR-4469 inhibitor
- HY-RI02656
-
|
MicroRNA
|
Cancer
|
mmu-miR-1291 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1291 inhibitor
mmu-miR-1291 inhibitor
- HY-RI01011
-
|
MicroRNA
|
Cancer
|
hsa-miR-4327 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4327 inhibitor
hsa-miR-4327 inhibitor
- HY-RI02746
-
|
MicroRNA
|
Cancer
|
mmu-miR-1932 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1932 inhibitor
mmu-miR-1932 inhibitor
- HY-RI00976
-
|
MicroRNA
|
Cancer
|
hsa-miR-4296 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4296 inhibitor
hsa-miR-4296 inhibitor
- HY-RI03247
-
|
MicroRNA
|
Cancer
|
mmu-miR-5101 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5101 inhibitor
mmu-miR-5101 inhibitor
- HY-RI04378
-
|
MicroRNA
|
Cancer
|
rno-miR-3541 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3541 inhibitor
rno-miR-3541 inhibitor
- HY-RI00085
-
|
MicroRNA
|
Cancer
|
hsa-miR-1205 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1205 inhibitor
hsa-miR-1205 inhibitor
- HY-RI00556
-
|
MicroRNA
|
Cancer
|
hsa-miR-3123 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3123 inhibitor
hsa-miR-3123 inhibitor
- HY-RI02582
-
|
MicroRNA
|
Cancer
|
mmu-miR-1194 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1194 inhibitor
mmu-miR-1194 inhibitor
- HY-RI01926
-
|
MicroRNA
|
Cancer
|
hsa-miR-650 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-650 inhibitor
hsa-miR-650 inhibitor
- HY-RI03360
-
|
MicroRNA
|
Cancer
|
mmu-miR-6354 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6354 inhibitor
mmu-miR-6354 inhibitor
- HY-RI03073
-
|
MicroRNA
|
Cancer
|
mmu-miR-3474 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-3474 inhibitor
mmu-miR-3474 inhibitor
- HY-RI01195
-
|
MicroRNA
|
Cancer
|
hsa-miR-4648 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4648 inhibitor
hsa-miR-4648 inhibitor
- HY-RI02509
-
|
MicroRNA
|
Cancer
|
hsa-miR-922 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-922 inhibitor
hsa-miR-922 inhibitor
- HY-RI04324
-
|
MicroRNA
|
Cancer
|
rno-miR-294 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-294 inhibitor
rno-miR-294 inhibitor
- HY-RI03334
-
|
MicroRNA
|
Cancer
|
mmu-miR-6236 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6236 inhibitor
mmu-miR-6236 inhibitor
- HY-RI01137
-
|
MicroRNA
|
Cancer
|
hsa-miR-4518 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4518 inhibitor
hsa-miR-4518 inhibitor
- HY-RI03391
-
|
MicroRNA
|
Cancer
|
mmu-miR-6385 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6385 inhibitor
mmu-miR-6385 inhibitor
- HY-RI02712
-
|
MicroRNA
|
Cancer
|
mmu-miR-1892 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1892 inhibitor
mmu-miR-1892 inhibitor
- HY-RI03383
-
|
MicroRNA
|
Cancer
|
mmu-miR-6377 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6377 inhibitor
mmu-miR-6377 inhibitor
- HY-RI04166
-
|
MicroRNA
|
Cancer
|
mmu-miR-8118 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8118 inhibitor
mmu-miR-8118 inhibitor
- HY-RI00972
-
|
MicroRNA
|
Cancer
|
hsa-miR-4292 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4292 inhibitor
hsa-miR-4292 inhibitor
- HY-RI02441
-
|
MicroRNA
|
Cancer
|
hsa-miR-7977 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-7977 inhibitor
hsa-miR-7977 inhibitor
- HY-RI01864
-
|
MicroRNA
|
Cancer
|
hsa-miR-609 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-609 inhibitor
hsa-miR-609 inhibitor
- HY-RI01846
-
|
MicroRNA
|
Cancer
|
hsa-miR-6072 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6072 inhibitor
hsa-miR-6072 inhibitor
- HY-RI00019
-
|
MicroRNA
|
Cancer
|
hsa-miR-10226 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-10226 inhibitor
hsa-miR-10226 inhibitor
- HY-RI00144
-
|
MicroRNA
|
Cancer
|
hsa-miR-1246 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1246 inhibitor
hsa-miR-1246 inhibitor
- HY-RI00898
-
|
MicroRNA
|
Cancer
|
hsa-miR-3938 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3938 inhibitor
hsa-miR-3938 inhibitor
- HY-RI00950
-
|
MicroRNA
|
Cancer
|
hsa-miR-4271 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4271 inhibitor
hsa-miR-4271 inhibitor
- HY-RI04565
-
|
MicroRNA
|
Cancer
|
rno-miR-709 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-709 inhibitor
rno-miR-709 inhibitor
- HY-RI00883
-
|
MicroRNA
|
Cancer
|
hsa-miR-3923 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3923 inhibitor
hsa-miR-3923 inhibitor
- HY-RI03265
-
|
MicroRNA
|
Cancer
|
mmu-miR-5121 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5121 inhibitor
mmu-miR-5121 inhibitor
- HY-RI00612
-
|
MicroRNA
|
Cancer
|
hsa-miR-3159 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3159 inhibitor
hsa-miR-3159 inhibitor
- HY-RI00247
-
|
MicroRNA
|
Cancer
|
hsa-miR-1323 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1323 inhibitor
hsa-miR-1323 inhibitor
- HY-RI01001
-
|
MicroRNA
|
Cancer
|
hsa-miR-4319 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4319 inhibitor
hsa-miR-4319 inhibitor
- HY-RI02739
-
|
MicroRNA
|
Cancer
|
mmu-miR-1927 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1927 inhibitor
mmu-miR-1927 inhibitor
- HY-RI00219
-
|
MicroRNA
|
Cancer
|
hsa-miR-1294 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1294 inhibitor
hsa-miR-1294 inhibitor
- HY-RI00170
-
|
MicroRNA
|
Cancer
|
hsa-miR-1262 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1262 inhibitor
hsa-miR-1262 inhibitor
- HY-RI00969
-
|
MicroRNA
|
Cancer
|
hsa-miR-429 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-429 inhibitor
hsa-miR-429 inhibitor
- HY-RI01122
-
|
MicroRNA
|
Cancer
|
hsa-miR-4508 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4508 inhibitor
hsa-miR-4508 inhibitor
- HY-RI01042
-
|
MicroRNA
|
Cancer
|
hsa-miR-4438 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4438 inhibitor
hsa-miR-4438 inhibitor
- HY-RI03276
-
|
MicroRNA
|
Cancer
|
mmu-miR-5130 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5130 inhibitor
mmu-miR-5130 inhibitor
- HY-RI01904
-
|
MicroRNA
|
Cancer
|
hsa-miR-630 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-630 inhibitor
hsa-miR-630 inhibitor
- HY-RI01776
-
|
MicroRNA
|
Cancer
|
hsa-miR-5695 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5695 inhibitor
hsa-miR-5695 inhibitor
- HY-RI01868
-
|
MicroRNA
|
Cancer
|
hsa-miR-6124 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6124 inhibitor
hsa-miR-6124 inhibitor
- HY-RI03956
-
|
MicroRNA
|
Cancer
|
mmu-miR-721 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-721 inhibitor
mmu-miR-721 inhibitor
- HY-RI04416
-
|
MicroRNA
|
Cancer
|
rno-miR-3579 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3579 inhibitor
rno-miR-3579 inhibitor
- HY-RI02777
-
|
MicroRNA
|
Cancer
|
mmu-miR-1958 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1958 inhibitor
mmu-miR-1958 inhibitor
- HY-RI00093
-
|
MicroRNA
|
Cancer
|
hsa-miR-12117 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12117 inhibitor
hsa-miR-12117 inhibitor
- HY-RI02500
-
|
MicroRNA
|
Cancer
|
hsa-miR-890 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-890 inhibitor
hsa-miR-890 inhibitor
- HY-RI04137
-
|
MicroRNA
|
Cancer
|
mmu-miR-804 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-804 inhibitor
mmu-miR-804 inhibitor
- HY-RI00635
-
|
MicroRNA
|
Cancer
|
hsa-miR-3178 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3178 inhibitor
hsa-miR-3178 inhibitor
- HY-RI04546
-
|
MicroRNA
|
Cancer
|
rno-miR-6334 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6334 inhibitor
rno-miR-6334 inhibitor
- HY-RI02802
-
|
MicroRNA
|
Cancer
|
mmu-miR-1983 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1983 inhibitor
mmu-miR-1983 inhibitor
- HY-RI01069
-
|
MicroRNA
|
Cancer
|
hsa-miR-4465 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4465 inhibitor
hsa-miR-4465 inhibitor
- HY-RI04377
-
|
MicroRNA
|
Cancer
|
rno-miR-352 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-352 inhibitor
rno-miR-352 inhibitor
- HY-RI02442
-
|
MicroRNA
|
Cancer
|
hsa-miR-7978 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-7978 inhibitor
hsa-miR-7978 inhibitor
- HY-RI01055
-
|
MicroRNA
|
Cancer
|
hsa-miR-4449 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4449 inhibitor
hsa-miR-4449 inhibitor
- HY-RI00946
-
|
MicroRNA
|
Cancer
|
hsa-miR-4267 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4267 inhibitor
hsa-miR-4267 inhibitor
- HY-RI00778
-
|
MicroRNA
|
Cancer
|
hsa-miR-3668 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3668 inhibitor
hsa-miR-3668 inhibitor
- HY-RI03821
-
|
MicroRNA
|
Cancer
|
mmu-miR-704 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-704 inhibitor
mmu-miR-704 inhibitor
- HY-RI00091
-
|
MicroRNA
|
Cancer
|
hsa-miR-12115 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12115 inhibitor
hsa-miR-12115 inhibitor
- HY-RI01036
-
|
MicroRNA
|
Cancer
|
hsa-miR-4434 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4434 inhibitor
hsa-miR-4434 inhibitor
- HY-RI01914
-
|
MicroRNA
|
Cancer
|
hsa-miR-640 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-640 inhibitor
hsa-miR-640 inhibitor
- HY-RI00503
-
|
MicroRNA
|
Cancer
|
hsa-miR-2861 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-2861 inhibitor
hsa-miR-2861 inhibitor
- HY-RI03371
-
|
MicroRNA
|
Cancer
|
mmu-miR-6365 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6365 inhibitor
mmu-miR-6365 inhibitor
- HY-RI00201
-
|
MicroRNA
|
Cancer
|
hsa-miR-1283 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1283 inhibitor
hsa-miR-1283 inhibitor
- HY-RI03428
-
|
MicroRNA
|
Cancer
|
mmu-miR-6419 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6419 inhibitor
mmu-miR-6419 inhibitor
- HY-RI01758
-
|
MicroRNA
|
Cancer
|
hsa-miR-5680 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5680 inhibitor
hsa-miR-5680 inhibitor
- HY-RI01118
-
|
MicroRNA
|
Cancer
|
hsa-miR-4504 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4504 inhibitor
hsa-miR-4504 inhibitor
- HY-RI01104
-
|
MicroRNA
|
Cancer
|
hsa-miR-4495 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4495 inhibitor
hsa-miR-4495 inhibitor
- HY-RI03064
-
|
MicroRNA
|
Cancer
|
mmu-miR-3472 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-3472 inhibitor
mmu-miR-3472 inhibitor
- HY-RI00896
-
|
MicroRNA
|
Cancer
|
hsa-miR-3936 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3936 inhibitor
hsa-miR-3936 inhibitor
- HY-RI00663
-
|
MicroRNA
|
Cancer
|
hsa-miR-3196 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3196 inhibitor
hsa-miR-3196 inhibitor
- HY-RI00101
-
|
MicroRNA
|
Cancer
|
hsa-miR-12125 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12125 inhibitor
hsa-miR-12125 inhibitor
- HY-RI00107
-
|
MicroRNA
|
Cancer
|
hsa-miR-12131 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12131 inhibitor
hsa-miR-12131 inhibitor
- HY-RI00196
-
|
MicroRNA
|
Cancer
|
hsa-miR-1279 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1279 inhibitor
hsa-miR-1279 inhibitor
- HY-RI01017
-
|
MicroRNA
|
Cancer
|
hsa-miR-4418 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4418 inhibitor
hsa-miR-4418 inhibitor
- HY-RI00192
-
|
MicroRNA
|
Cancer
|
hsa-miR-1276 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1276 inhibitor
hsa-miR-1276 inhibitor
- HY-RI01884
-
|
MicroRNA
|
Cancer
|
hsa-miR-6165 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6165 inhibitor
hsa-miR-6165 inhibitor
- HY-RI01863
-
|
MicroRNA
|
Cancer
|
hsa-miR-6089 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6089 inhibitor
hsa-miR-6089 inhibitor
- HY-RI02533
-
|
MicroRNA
|
Cancer
|
hsa-miR-944 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-944 inhibitor
hsa-miR-944 inhibitor
- HY-RI00865
-
|
MicroRNA
|
Cancer
|
hsa-miR-3908 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3908 inhibitor
hsa-miR-3908 inhibitor
- HY-RI00417
-
|
MicroRNA
|
Cancer
|
hsa-miR-2052 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-2052 inhibitor
hsa-miR-2052 inhibitor
- HY-RI02446
-
|
MicroRNA
|
Cancer
|
hsa-miR-8054 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8054 inhibitor
hsa-miR-8054 inhibitor
- HY-RI02454
-
|
MicroRNA
|
Cancer
|
hsa-miR-8062 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8062 inhibitor
hsa-miR-8062 inhibitor
- HY-RI00171
-
|
MicroRNA
|
Cancer
|
hsa-miR-1263 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1263 inhibitor
hsa-miR-1263 inhibitor
- HY-RI04402
-
|
MicroRNA
|
Cancer
|
rno-miR-3564 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3564 inhibitor
rno-miR-3564 inhibitor
- HY-RI02729
-
|
MicroRNA
|
Cancer
|
mmu-miR-1904 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1904 inhibitor
mmu-miR-1904 inhibitor
- HY-RI03951
-
|
MicroRNA
|
Cancer
|
mmu-miR-713 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-713 inhibitor
mmu-miR-713 inhibitor
- HY-RI00344
-
|
MicroRNA
|
Cancer
|
hsa-miR-1843 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1843 inhibitor
hsa-miR-1843 inhibitor
- HY-RI04157
-
|
MicroRNA
|
Cancer
|
mmu-miR-8109 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-8109 inhibitor
mmu-miR-8109 inhibitor
- HY-RI00105
-
|
MicroRNA
|
Cancer
|
hsa-miR-12129 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-12129 inhibitor
hsa-miR-12129 inhibitor
- HY-RI00935
-
|
MicroRNA
|
Cancer
|
hsa-miR-4256 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4256 inhibitor
hsa-miR-4256 inhibitor
- HY-RI03402
-
|
MicroRNA
|
Cancer
|
mmu-miR-6395 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6395 inhibitor
mmu-miR-6395 inhibitor
- HY-RI00984
-
|
MicroRNA
|
Cancer
|
hsa-miR-4304 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4304 inhibitor
hsa-miR-4304 inhibitor
- HY-RI00759
-
|
MicroRNA
|
Cancer
|
hsa-miR-3654 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3654 inhibitor
hsa-miR-3654 inhibitor
- HY-RI01072
-
|
MicroRNA
|
Cancer
|
hsa-miR-4468 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4468 inhibitor
hsa-miR-4468 inhibitor
- HY-RI01029
-
|
MicroRNA
|
Cancer
|
hsa-miR-4430 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4430 inhibitor
hsa-miR-4430 inhibitor
- HY-RI00431
-
|
MicroRNA
|
Cancer
|
hsa-miR-2110 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-2110 inhibitor
hsa-miR-2110 inhibitor
- HY-RI01108
-
|
MicroRNA
|
Cancer
|
hsa-miR-4499 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4499 inhibitor
hsa-miR-4499 inhibitor
- HY-RI01364
-
|
MicroRNA
|
Cancer
|
hsa-miR-4751 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4751 inhibitor
hsa-miR-4751 inhibitor
- HY-RI04414
-
|
MicroRNA
|
Cancer
|
rno-miR-3577 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3577 inhibitor
rno-miR-3577 inhibitor
- HY-RI00754
-
|
MicroRNA
|
Cancer
|
hsa-miR-3648 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3648 inhibitor
hsa-miR-3648 inhibitor
- HY-RI03354
-
|
MicroRNA
|
Cancer
|
mmu-miR-6348 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6348 inhibitor
mmu-miR-6348 inhibitor
- HY-RI01867
-
|
MicroRNA
|
Cancer
|
hsa-miR-612 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-612 inhibitor
hsa-miR-612 inhibitor
- HY-RI00642
-
|
MicroRNA
|
Cancer
|
hsa-miR-3183 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3183 inhibitor
hsa-miR-3183 inhibitor
- HY-RI01907
-
|
MicroRNA
|
Cancer
|
hsa-miR-633 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-633 inhibitor
hsa-miR-633 inhibitor
- HY-RI03409
-
|
MicroRNA
|
Cancer
|
mmu-miR-6402 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6402 inhibitor
mmu-miR-6402 inhibitor
- HY-RI00249
-
|
MicroRNA
|
Cancer
|
hsa-miR-1324 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1324 inhibitor
hsa-miR-1324 inhibitor
- HY-RI00650
-
|
MicroRNA
|
Cancer
|
hsa-miR-3188 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3188 inhibitor
hsa-miR-3188 inhibitor
- HY-RI01878
-
|
MicroRNA
|
Cancer
|
hsa-miR-6133 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6133 inhibitor
hsa-miR-6133 inhibitor
- HY-RI01803
-
|
MicroRNA
|
Cancer
|
hsa-miR-5787 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5787 inhibitor
hsa-miR-5787 inhibitor
- HY-RI00564
-
|
MicroRNA
|
Cancer
|
hsa-miR-3128 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3128 inhibitor
hsa-miR-3128 inhibitor
- HY-RI01403
-
|
MicroRNA
|
Cancer
|
hsa-miR-4775 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4775 inhibitor
hsa-miR-4775 inhibitor
- HY-RI01873
-
|
MicroRNA
|
Cancer
|
hsa-miR-6129 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6129 inhibitor
hsa-miR-6129 inhibitor
- HY-RI02403
-
|
MicroRNA
|
Cancer
|
hsa-miR-7515 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-7515 inhibitor
hsa-miR-7515 inhibitor
- HY-RI00577
-
|
MicroRNA
|
Cancer
|
hsa-miR-3137 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3137 inhibitor
hsa-miR-3137 inhibitor
- HY-RI04524
-
|
MicroRNA
|
Cancer
|
rno-miR-628 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-628 inhibitor
rno-miR-628 inhibitor
- HY-RI01852
-
|
MicroRNA
|
Cancer
|
hsa-miR-6078 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-6078 inhibitor
hsa-miR-6078 inhibitor
- HY-RI02473
-
|
MicroRNA
|
Cancer
|
hsa-miR-8081 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8081 inhibitor
hsa-miR-8081 inhibitor
- HY-RI01419
-
|
MicroRNA
|
Cancer
|
hsa-miR-4785 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4785 inhibitor
hsa-miR-4785 inhibitor
- HY-RI03508
-
|
MicroRNA
|
Cancer
|
mmu-miR-686 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-686 inhibitor
mmu-miR-686 inhibitor
- HY-RI03357
-
|
MicroRNA
|
Cancer
|
mmu-miR-6351 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6351 inhibitor
mmu-miR-6351 inhibitor
- HY-RI00968
-
|
MicroRNA
|
Cancer
|
hsa-miR-4289 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4289 inhibitor
hsa-miR-4289 inhibitor
- HY-RI01794
-
|
MicroRNA
|
Cancer
|
hsa-miR-573 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-573 inhibitor
hsa-miR-573 inhibitor
- HY-RI03254
-
|
MicroRNA
|
Cancer
|
mmu-miR-5108 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5108 inhibitor
mmu-miR-5108 inhibitor
- HY-RI04534
-
|
MicroRNA
|
Cancer
|
rno-miR-6322 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6322 inhibitor
rno-miR-6322 inhibitor
- HY-RI03333
-
|
MicroRNA
|
Cancer
|
mmu-miR-599 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-599 inhibitor
mmu-miR-599 inhibitor
- HY-RI00953
-
|
MicroRNA
|
Cancer
|
hsa-miR-4274 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4274 inhibitor
hsa-miR-4274 inhibitor
- HY-RI00549
-
|
MicroRNA
|
Cancer
|
hsa-miR-3118 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3118 inhibitor
hsa-miR-3118 inhibitor
- HY-RI01834
-
|
MicroRNA
|
Cancer
|
hsa-miR-601 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-601 inhibitor
hsa-miR-601 inhibitor
- HY-RI00913
-
|
MicroRNA
|
Cancer
|
hsa-miR-3975 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3975 inhibitor
hsa-miR-3975 inhibitor
- HY-RI03646
-
|
MicroRNA
|
Cancer
|
mmu-miR-696 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-696 inhibitor
mmu-miR-696 inhibitor
- HY-RI02464
-
|
MicroRNA
|
Cancer
|
hsa-miR-8072 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8072 inhibitor
hsa-miR-8072 inhibitor
- HY-RI04535
-
|
MicroRNA
|
Cancer
|
rno-miR-6323 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-6323 inhibitor
rno-miR-6323 inhibitor
- HY-RI01101
-
|
MicroRNA
|
Cancer
|
hsa-miR-4492 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4492 inhibitor
hsa-miR-4492 inhibitor
- HY-RI02459
-
|
MicroRNA
|
Cancer
|
hsa-miR-8067 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-8067 inhibitor
hsa-miR-8067 inhibitor
- HY-RI03126
-
|
MicroRNA
|
Cancer
|
mmu-miR-3962 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-3962 inhibitor
mmu-miR-3962 inhibitor
- HY-RI03380
-
|
MicroRNA
|
Cancer
|
mmu-miR-6374 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-6374 inhibitor
mmu-miR-6374 inhibitor
- HY-RI00983
-
|
MicroRNA
|
Cancer
|
hsa-miR-4303 inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4303 inhibitor
hsa-miR-4303 inhibitor
- HY-RI00292
-
|
MicroRNA
|
Cancer
|
hsa-miR-147a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-147a inhibitor
hsa-miR-147a inhibitor
- HY-RI00604
-
|
MicroRNA
|
Cancer
|
hsa-miR-3155a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3155a inhibitor
hsa-miR-3155a inhibitor
- HY-D2767
-
|
Fluorescent Dye
|
Others
|
MB 660R NHS Ester is a fluroescent agent with a terminal NHS ester group.MB 660R NHS Ester is a far-red fluorescent dye that has a maximal absorption of 665 nm and emission at 690 nm. The NHS ester can be applied to label the primary amines (-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules.
|
-
- HY-RI01082
-
|
MicroRNA
|
Cancer
|
hsa-miR-4477a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4477a inhibitor
hsa-miR-4477a inhibitor
- HY-RI02576
-
|
MicroRNA
|
Cancer
|
mmu-miR-1191a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1191a inhibitor
mmu-miR-1191a inhibitor
- HY-RI01711
-
|
MicroRNA
|
Cancer
|
hsa-miR-551a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-551a inhibitor
hsa-miR-551a inhibitor
- HY-RI01139
-
|
MicroRNA
|
Cancer
|
hsa-miR-451a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-451a inhibitor
hsa-miR-451a inhibitor
- HY-W010744
-
5'-O-DMT-dI; 2'-Deoxy-5'-O-DMT-inosine
|
Nucleoside Antimetabolite/Analog
|
Others
|
DMT-dI (5'-O-DMT-dI) is a deoxyribonucleoside containing a hypoxanthine base. DMT-dI can be used to prepare convertible nucleoside derivatives to prepare modified oligonucleotides complementary to target genes for gene editing. DMT-dI can be used to study various conditions, disorders or diseases modified by adenosine .
|
-
- HY-RI01771
-
|
MicroRNA
|
Cancer
|
hsa-miR-5692a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5692a inhibitor
hsa-miR-5692a inhibitor
- HY-RI01759
-
|
MicroRNA
|
Cancer
|
hsa-miR-5681a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-5681a inhibitor
hsa-miR-5681a inhibitor
- HY-RI02762
-
|
MicroRNA
|
Cancer
|
mmu-miR-1946a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-1946a inhibitor
mmu-miR-1946a inhibitor
- HY-RI01109
-
|
MicroRNA
|
Cancer
|
hsa-miR-449a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-449a inhibitor
hsa-miR-449a inhibitor
- HY-RI00573
-
|
MicroRNA
|
Cancer
|
hsa-miR-3135a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-3135a inhibitor
hsa-miR-3135a inhibitor
- HY-RI00924
-
|
MicroRNA
|
Cancer
|
hsa-miR-422a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-422a inhibitor
hsa-miR-422a inhibitor
- HY-RI01920
-
|
MicroRNA
|
Cancer
|
hsa-miR-644a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-644a inhibitor
hsa-miR-644a inhibitor
- HY-RI00157
-
|
MicroRNA
|
Cancer
|
hsa-miR-1255a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1255a inhibitor
hsa-miR-1255a inhibitor
- HY-RI04438
-
|
MicroRNA
|
Cancer
|
rno-miR-3596a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3596a inhibitor
rno-miR-3596a inhibitor
- HY-RI01649
-
|
MicroRNA
|
Cancer
|
hsa-miR-548an inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-548an inhibitor
hsa-miR-548an inhibitor
- HY-RI04390
-
|
MicroRNA
|
Cancer
|
rno-miR-3556a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
rno-miR-3556a inhibitor
rno-miR-3556a inhibitor
- HY-RI01038
-
|
MicroRNA
|
Cancer
|
hsa-miR-4436a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-4436a inhibitor
hsa-miR-4436a inhibitor
- HY-RI02504
-
|
MicroRNA
|
Cancer
|
hsa-miR-892a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-892a inhibitor
hsa-miR-892a inhibitor
- HY-RI00220
-
|
MicroRNA
|
Cancer
|
hsa-miR-1295a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1295a inhibitor
hsa-miR-1295a inhibitor
- HY-D2741
-
|
Fluorescent Dye
|
Others
|
MB 488 NHS ester is a fluroescent agent with a terminal NHS ester group. MB 488 NHS ester is a green fluorescent, very hydrophilic dye molecule that has a maximal absorption of 501 nm and emission at 524 nm. The NHS ester can be applied to label the primary amines (-NH2) of proteins, amine-modified oligonucleotides, and other amine-containing molecules.
|
-
- HY-149117
-
|
Fluorescent Dye
|
Others
|
AF430 NHS ester is an AF 430 maleimide is a derivative of the yellow fluorescent dye AF 430. AF430 has an excitation wavelength of 425 nm and an emission wavelength of 542 nm. AF430 NHS ester can be uesd for the labeling of amino-groups in peptides, proteins, and oligonucleotides. To achieve specific coupling of dye labels and biomolecules .
|
-
- HY-RI01627
-
|
MicroRNA
|
Cancer
|
hsa-miR-544a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-544a inhibitor
hsa-miR-544a inhibitor
- HY-RI03061
-
|
MicroRNA
|
Cancer
|
mmu-miR-3470a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-3470a inhibitor
mmu-miR-3470a inhibitor
- HY-RI00140
-
|
MicroRNA
|
Cancer
|
hsa-miR-1245a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1245a inhibitor
hsa-miR-1245a inhibitor
- HY-RI00179
-
|
MicroRNA
|
Cancer
|
hsa-miR-1268a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1268a inhibitor
hsa-miR-1268a inhibitor
- HY-RI01691
-
|
MicroRNA
|
Cancer
|
hsa-miR-548l inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-548l inhibitor
hsa-miR-548l inhibitor
- HY-RI00181
-
|
MicroRNA
|
Cancer
|
hsa-miR-1269a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
hsa-miR-1269a inhibitor
hsa-miR-1269a inhibitor
- HY-RI03065
-
|
MicroRNA
|
Cancer
|
mmu-miR-3473a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-3473a inhibitor
mmu-miR-3473a inhibitor
- HY-RI03268
-
|
MicroRNA
|
Cancer
|
mmu-miR-5124a inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
|
-
mmu-miR-5124a inhibitor
mmu-miR-5124a inhibitor
- HY-W590538A
-
|
Liposome
|
Others
|
HAPC-Chol is a cationic cholesterol that can be used as a component of lipoplexes complexes .
|
-
- HY-W340832
-
|
Liposome
|
Cancer
|
18:1 Biotinyl Cap PE is a fluorescent lipid, which features a head group that has been altered to include biotinyl cap PE.
|
-
- HY-W591461
-
|
Liposome
|
Cancer
|
DSPE-PEG-COOH, MW 2000 is a phospholipid polyPEG which can be used to prepare liposomes or nanoparticles. The terminal carboxylic acid can react with primary amine groups to form a stable amide bond.
|
-
- HY-W440991
-
|
Liposome
|
Cancer
|
DOPE-PEG-Amine (MW 2000) is a polydisperse PEG covalently attached to a phospholipid. The polymer is an amphiphilic molecule with hydrophobic fatty acid chains and hydrophilic PEG head which enables lipid bilayer or micelle formation in water. The phospholipid PEG can be used to prepare liposome or nanoparticles for targeted drug delivery and is reactive with alkyne to form a triazole ring.
|
-
- HY-138913
-
|
Liposome
|
Cancer
|
2H-Cho-Arg (TFA) is a steroid-based cationic lipid that contains a 2H-cholesterol skeleton coupled to an L-arginine head group and can be used to facilitate gene transfection.
|
-
- HY-W590535
-
1,2-DNPC;
1,2-Dinonadecanoyl-sn-glycero-3-phosphocholine
|
Liposome
|
Cancer
|
19:0 PC is a saturated phospholipid that has been used as a standard for the quantification of phosphatidylcholines in human synovial fluid. It has also been used to study dynamics of lipid bilayer phase transition.
|
-
- HY-W440711
-
|
Liposome
|
Cancer
|
Cholesterol-PEG-Biotin (MW 2000) is a pegylated lipids which has strong binding to avidin or streptavidin.
|
-
- HY-W800777
-
|
Liposome
|
Cancer
|
6-(3-Hydroxypropylamino)hexyl 2-hexyldecanoate is an ionizable lipid which can be used to make ALC-0315. The lipid has an ester bond adjacent to C6 relative to the amine nitrogen. The introduction of ester linkages can improve the clearance of the lipid in the liver.
|
-
- HY-W440957
-
PC(16:0/14:0); 1-palmitoyl-2-myristoyl-sn-glycero-3-phosphocholine
|
Liposome
|
Cancer
|
PMPC is a phosphatidylcholine with asymmetrical fatty acid. Palmitic acid occupies sn-1 position while myristic acid is placed at the sn-2 position.
|
-
- HY-W440690
-
|
Liposome
|
Cancer
|
Cholesterol-PEG-Amine (MW 2000) is a pegylated lipids which can be used for preparation of liposome or nanoparticle. The lipophilic moiety can encapsulate hydrophobic drugs whereas the hydrophilic PEG chain helps the overal water solubility of the micelles.
|
-
- HY-W590555
-
|
Liposome
|
Cancer
|
Thiol-PEG-DMG, MW 2000 is a phospholipid polyPEG which can be used to prepare liposomes or nanoparticles. The terminal thiol group reacts with maleimide, OPSS, vinylsulfone and transition metal surfaces including gold, silver, etc.
|
-
- HY-141615
-