Search Result

Results for "

tau

" in MedChemExpress (MCE) Product Catalog:

By Targets:	Tau Protein (48) AAK1 (1) Adenosine Receptor (1) Amyloid-β (18) Androgen Receptor (1) Apoptosis (6) Autophagy (3) Bacterial (1) Beclin1 (1) Beta-secretase (1) Caspase (1) CDK (4) Cholinesterase (ChE) (11) Dengue virus (1) Deubiquitinase (2) Dopamine Receptor (1) DYRK (4) Ferroptosis (1) Flavivirus (1) Fungal (1) GSK-3 (13) Guanylate Cyclase (2) HDAC (5) Histamine Receptor (1) HSP (2) Ligands for E3 Ligase (1) MicroRNA (1) Microtubule/Tubulin (13) Monoamine Oxidase (3) Necroptosis (1) NO Synthase (2) Phosphatase (3) Pim (1) PKC (1) PPAR (1) PROTACs (1) Proteasome (1) Reactive Oxygen Species (1) RIP kinase (2) Sodium Channel (1) α-synuclein (4)
By Research Areas:	Cancer (17) Cardiovascular Disease (1) Infection (3) Inflammation/Immunology (8) Metabolic Disease (1) Neurological Disease (99)

By Targets:

Tau Protein (48)

AAK1 (1)

Adenosine Receptor (1)

Amyloid-β (18)

Androgen Receptor (1)

Apoptosis (6)

Autophagy (3)

Bacterial (1)

Beclin1 (1)

Beta-secretase (1)

Caspase (1)

CDK (4)

Cholinesterase (ChE) (11)

Dengue virus (1)

Deubiquitinase (2)

Dopamine Receptor (1)

DYRK (4)

Ferroptosis (1)

Flavivirus (1)

Fungal (1)

GSK-3 (13)

Guanylate Cyclase (2)

HDAC (5)

Histamine Receptor (1)

HSP (2)

Ligands for E3 Ligase (1)

MicroRNA (1)

Microtubule/Tubulin (13)

Monoamine Oxidase (3)

Necroptosis (1)

NO Synthase (2)

Phosphatase (3)

Pim (1)

PKC (1)

PPAR (1)

PROTACs (1)

Proteasome (1)

Reactive Oxygen Species (1)

RIP kinase (2)

Sodium Channel (1)

α-synuclein (4)

By Research Areas:

Cancer (17)

Cardiovascular Disease (1)

Infection (3)

Inflammation/Immunology (8)

Metabolic Disease (1)

Neurological Disease (99)

122

Inhibitors & Agonists

Screening Libraries

Fluorescent Dye

Peptides

Inhibitory Antibodies

Natural
Products

Recombinant Proteins

Antibodies

Tau-aggregation and neuroinflammation-IN-1	Microtubule/Tubulin	Neurological Disease Inflammation/Immunology
Tau-aggregation and neuroinflammation-IN-1 is a potent *tau-aggregation* and neuroinflammation inhibitor. Tau-aggregation and neuroinflammation-IN-1 exhibits remarkable inhibitory activities against AcPHF6 and full-length tau aggregation. Tau-aggregation and neuroinflammation-IN-1 has a low cytotoxicity and reduced NO release in LPS-stimulated BV2 cells. Tau-aggregation and neuroinflammation-IN-1 can reverse okadaic acid-induced memory impairment in rats .

TAU-IN-1	Tau Protein	Neurological Disease
TAU-IN-1 (compound 051) is a *TAU* protein inhibitor with an EC₅₀ value of 325 nM. TAU-IN-1 can be used in the study of neurodegenerative diseases .

tau protein/α-synuclein-IN-1	α-synuclein	Neurological Disease
tau protein/α-synuclein-IN-1 is a dual inhibitor of tau protein and α-synuclein. tau protein/α-synuclein-IN-1 reduces α-syn inclusions development in M17D neuroblastoma cells. tau protein/α-synuclein-IN-1 can be used in study Alzheimer’s disease .

Tau Peptide (275-305) (Repeat 2 domain)	Tau Protein	Neurological Disease
Tau Peptide (275-305) (Repeat 2 domain) is the Alzheimer's tau fragment R2, corresponding to the second repeat unit of the microtubule-binding domain, which is believed to be pivotal to the biochemical properties of full tau protein .

Tau protein aggregation-IN-1	Tau Protein	Neurological Disease
Tau protein aggregation-IN-1 (Compound 0c) is a Tau protein aggregation inhibitor. Tau protein aggregation-IN-1 can be used in the study of protein folding disorders such as Alzheimer's disease, dementia, Parkinson's disease, Huntington's disease and prion-based spongiform encephalopathies .

Tau tracer 1	Microtubule/Tubulin	Neurological Disease
Tau tracer 1 is a Tau tracer used for imaging Tau protein aggregates. Tau tracer 1 can be used to diagnose neurodegenerative diseases .

Tau protein (592-597), human TFA	Tau Protein	Neurological Disease
Tau protein (592-597), human TFA is a peptide fragment of human Tau protein. The dysfunction of Tau protein is involved in neurodegeneration and dementia .

Tau tracer 2 Pl-2620	Microtubule/Tubulin	Neurological Disease
Tau tracer 2 (Pl-2620) is a Tau tracer used for imaging Tau protein aggregates. Tau tracer 2 can be used to diagnose neurodegenerative diseases .

Tau ASO-12 (murine) (sodium)	Tau Protein
Tau ^ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ^ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )

Tau-aggregation-IN-1	Microtubule/Tubulin Dopamine Receptor	Neurological Disease
Tau-aggregation-IN-1 (Compound D-519) is a *tau441* protein aggregation inhibitor with an IC₅₀ of 21 µM. Tau-aggregation-IN-1 is also a dopamine D₂ and D₃ receptor agonist .

Tau Peptide (273-284)	Tau Protein	Neurological Disease
Tau Peptide (273-284) is aTau fragment.

Tau Peptide (379-408)	Tau Protein	Neurological Disease
Tau Peptide (379-408) is aTau fragment.

Tau Peptide (1-16) (human)	Tau Protein	Neurological Disease
Tau Peptide (1-16) (human) is aTau fragment.

Tau Peptide (294-305) (human)	Tau Protein	Neurological Disease
Tau Peptide (294-305) (human) is aTau fragment.

tau/Aβ40 aggregation-IN-1	Tau Protein Amyloid-β Cholinesterase (ChE)	Neurological Disease
tau/Aβ40 aggregation-IN-1 (Compound 20) is a *tau* and Aβ₄₀ aggregation inhibitor with IC₅₀s of 1.8 μM and 1.3 μM, respectively .

Tau Peptide (244-274) (Repeat 1 Domain)	Tau Protein	Neurological Disease
Tau Peptide (244-274) (Repeat 1 Domain) is aTau fragment.

Tau Peptide (245-274) (Repeat 1 Domain)	Tau Protein	Neurological Disease
Tau Peptide (245-274) (Repeat 1 Domain) is aTau fragment.

Tau Peptide (306-336) (Repeat 3 Domain)	Tau Protein	Neurological Disease
Tau Peptide (306-336) (Repeat 3 Domain) is aTau fragment.

Tau Peptide (45-73) (Exon 2/Insert 1 Domain)	Tau Protein	Neurological Disease
Tau Peptide (45-73) (Exon 2/Insert 1 Domain) is aTau fragment.

Tau Peptide (74-102) (Exon 3/Insert 2 Domain)	Tau Protein	Neurological Disease
Tau Peptide (74-102) (Exon 3/Insert 2 Domain) is aTau fragment.

Tau Peptide (255-314) (Repeat 2 Domain) (human)	Tau Protein	Others
Tau Peptide (255-314) (Repeat 2 Domain) (human) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

*Aβ/tau* aggregation-IN-1**	Amyloid-β	Neurological Disease
Aβ/tau aggregation-IN-1 is a potent Aβ_1-42 β-sheets formation and *tau* aggregation inhibitor. The K_D values of Aβ/tau aggregation-IN-1 with Aβ_1-42 and *tau* are 160 μM and 337 μM, respectively. Aβ/tau aggregation-IN-1 can permeate the blood-brain barrier .

*Acetyl-Tau* Peptide (273-284) amide**	Amyloid-β	Neurological Disease
Acetyl-Tau Peptide (273-284) amide is an acetylated Tau peptide fragment. Acetyl-Tau Peptide (273-284) amide limits the substantial aggregation of Ac-Aβ(25–35)-NH2 and can be used as an inhibitor of Ac-Aβ(25–35)-NH2. Acetyl-Tau Peptide (273-284) amide can be used as an experimental model to investigate the Aβ/Tau cross-interaction .

*Aβ/tau* aggregation-IN-3**	Amyloid-β	Neurological Disease
Aβ/tau aggregation-IN-3 is a potent amyloid protein aggregation inhibitor with an IC₅₀ of 0.85 μM by Aβ-Thioflavin T (Aβ-ThT) functional aggregation assay. Aβ/tau aggregation-IN-3 has anti-amyloid activity .

THK-5105	Microtubule/Tubulin	Neurological Disease
THK-5105, an arylquinoline derivative, displays high binding affinity to tau fibrils. THK-5105 has high binding affinity to tau protein aggregates and tau-rich Alzheimer disease (AD) brain homogenates. 18F-THK-5105 has the potential to act as a tau imaging PET probe .

THK-5117	Microtubule/Tubulin	Neurological Disease
THK-5117, an arylquinoline derivative, displays high binding affinity to tau fibrils with a K_i of 10.5 nM. THK-5117 has high binding affinity to tau protein aggregates and tau-rich Alzheimer disease (AD) brain homogenates. 18F-THK-5117 has the potential to act as a tau imaging PET probe .

*Microtubule-associated protein tau* (26-44)**	Tau Protein	Neurological Disease
Microtubule-associated protein tau (26-44) is a synthetic peptide chain with an amine group attached to glutamine and an carboxyl group attached to lysine.

PHF6	Amyloid-β	Neurological Disease
PHF6 (VQIVYK) is a self-assembly sequence capable of initiating the full-length tau protein aggregation and is mapped to the third microtubule-binding repeat region of the tau protein .

Cl-NQTrp	Amyloid-β	Neurological Disease
Cl-NQTrp signifcantly disrupts the preformed fbrillar aggregates of Tau-derived PHF6 (VQIVYK) peptide and full-length tau protein .

Posdinemab JNJ-63733657	Tau Protein	Cancer
Posdinemab is a humanized IgG1κ antibody, targeting to microtubule-associated protein tau (MAPT) .

ARN25068	GSK-3 DYRK	Neurological Disease
ARN25068 is a sub-micromolar inhibitor of the three protein kinases, GSK-3β, FYN and DYRK1A to tackle tau hyperphosphorylation .

3,3'-Diethyl-9-methylthiacarbocyanine iodide	Microtubule/Tubulin	Neurological Disease
3,3'-Diethyl-9-methylthiacarbocyanine iodide is a cyanine dye, also a tau aggregation inhibitor, with an IC₅₀ value of 0.28 μM for tau. 3,3'-Diethyl-9-methylthiacarbocyanine iodide can cause misfunction of the microtubule cytoskeleton. 3,3'-Diethyl-9-methylthiacarbocyanine iodide can be used for researching Alzheimer’s disease .

IONIS-MAPTRx BIIB080; ISIS 814907	Tau Protein	Neurological Disease
IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease .

hAChE-IN-2	Cholinesterase (ChE) Tau Protein	Neurological Disease
hAChE-IN-2 is a potent hAChE inhibitor, with an IC₅₀ of 0.71 μM. hAChE-IN-2 can also inhibits tau-oligomerization, with an EC₅₀ of 2.21 μM. hAChE-IN-2 exhibits neuroprotective activity .

Leucomethylene blue mesylate 5 Publications Verification TRx0237 mesylate; Methylene blue leuco base mesylate	Amyloid-β	Neurological Disease
Leucomethylene blue (TRx0237) mesylate, an orally active second-generation *tau* protein aggregation inhibitor (K_i of 0.12 μM), could be used for the study of Alzheimer's Disease. Leucomethylene blue mesylate is a common reduced form of Methylene Blue, Methylene Blue is a member of the thiazine class of dyes .

Aha1/Hsp90-IN-1	Microtubule/Tubulin	Neurological Disease Inflammation/Immunology
Aha1/Hsp90-IN-1 (Compound 17) is an Aha1/Hsp90 complex inhibitor. Aha1/Hsp90-IN-1 disrupts Aha1/Hsp90 interactions with an IC₅₀ of 3.32 μM. Aha1/Hsp90-IN-1 inhibits tau aggregation .

Bepranemab UCB 0107	Tau Protein	Neurological Disease
Bepranemab (UCB 0107) is a humanized, full-length IgG4 monoclonal antibody that binds to a central tau epitope (amino acids 235-250). Bepranemab can be used for Alzheimer’s disease (AD) research .

SB1617	Tau Protein	Neurological Disease Inflammation/Immunology
SB1617 is a neuroinflammation-modulating agent, and has neuroprotective effect by reducing pathogenic *tau* levels through microglia-mediated anti-inflammatory activity .

Cu(II)GTSM 1 Publications Verification	GSK-3 Amyloid-β	Neurological Disease
Cu(II)GTSM, a cell-permeable Cu-complex, significantly inhibits GSK3β. Cu(II)GTSM inhibits Amyloid-β oligomers (AβOs) and decreases *tau* phosphorylation. Cu(II)GTSM also decreases the abundance of Amyloid-β trimers. Cu(II)GTSM is a potential anticancer and antimicrobial agent .

MG-1102	Tau Protein MicroRNA	Neurological Disease
MG-1102 is first-in-class dual binder of monomeric *tau* and pre-miRNA-146a. MG-1102 shows specific inhibition of miRNA146a with IC₅₀s of 0.21 mM and 0.36 mM specific inhibition of doublelabeled pre-miRNA146a and mono-labeled pre-miRNA146a, respectively. MG-1102 interacts with tau monomers with a K_d of 3.21 mM by surface plasmon resonance (SPR). MG-1102 is a potential multi-target-directed ligands (MTDLs) for Alzheimer’s disease (AD) .

Nimbin	Flavivirus Dengue virus Fungal Bacterial Histamine Receptor	Infection Neurological Disease Inflammation/Immunology Cancer
Nimbin is a intermediate limonoid isolated from Azadirachta. Nimbin prevents *tau* aggregation and increases cell viability. Nimbin is effective inhibits the envelope protein of dengue virus. Nimbin has anti-inflammatory, antipyretic, antifungal, antihistamine, antiseptic, antioxidant, anti-cancer and anti-viral properties. Nimbin can across blood-brain barrier .

AChE-IN-10	Cholinesterase (ChE)	Neurological Disease
AChE-IN-10 (Compound 24r) is a potent inhibitor of AChE (IC₅₀ = 2.4 nM). AChE-IN-10 potently inhibits AChE, reduces tau phosphorylation at S396 residue, provides neuroprotection by rescuing neuronal morphology and increasing cell viability. AChE-IN-10 is also found to reduce amyloid aggregation in the presence of AChE .

hAChE-IN-6	Cholinesterase (ChE) GSK-3	Neurological Disease
hAChE-IN-6 (compound 51) is a brain penetrant AChE inhibitor with an IC₅₀ of 0.16 μM. hAChE-IN-6 also inhibits hBuChE and GSK3β with IC₅₀ values of 0.69 μM and 0.26 μM, respectively. hAChE-IN-6 inhibits tau protein and Aβ1-42 self-aggregation, and can be used for Alzheimer's disease (AD) research .

SZM679	RIP kinase	Inflammation/Immunology
SZM679 is a potent, orally active and selective RIPK1 inhibitor with K_d values of 8.6 nM and >5000 nM for RIPK1 and RIPK3, respectively. SZM679 reverses the tumor necrosis factor-induced systemic inflammatory response. SZM679 decreases the Tau hyperphosphorylation, neuroinflammation, and the RIPK1 phosphorylation level in the hippocampus and cortex. SZM679 can be used in research of Alzheimer's disease (AD) .

PD146176 2 Publications Verification NSC168807	Autophagy Ferroptosis	Cardiovascular Disease
PD146176 (NSC168807), a 15-Lipoxygenase (15-LO) inhibitor, inhibits rabbit reticulocyte 15-LO (K_i=197 nM, IC₅₀=0.54 μM). PD146176 reverses cognitive impairment, brain amyloidosis, and tau pathology by stimulating autophagy in aged triple transgenic mice .

Multitarget AD inhibitor-1	Beta-secretase Amyloid-β Cholinesterase (ChE)	Neurological Disease
Multitarget AD inhibitor-1 is a selective and reversible butyrylcholinesterase (BuChE) inhibitor with IC₅₀s of 7.22 μM and 1.55 μM for hBuChE and eqBuChE (BuChE from equine serum), respectively. Multitarget AD inhibitor-1 inhibits β-secretase (IC_50hBACE-1=41.60 μM), amyloid β aggregation (IC_50Aβ=3.09 μM), *tau* aggregation. Multitarget AD inhibitor-1, a diphenylpropylamine derivative, has the potential for multifunctional disease-modifying anti-Alzheimer’s research .

Cat. No.	Product Name

HY-L069

Anti-Alzheimer's Disease Compound Library

1366 compounds

Alzheimer’s Disease (AD) is a progressive degenerative brain disease which causes mental and physical decline, gradually resulting in death. Despite the significant public health issue that it poses, only few medical treatments have been approved for Alzheimer’s Disease (AD) and these act to control symptoms rather than alter the course of the disease. Discovery of new therapeutic approaches depends on the study of pathology of AD. Recent research findings have led to greater understanding of disease neurobiology in Alzheimer's Disease (AD) and identification of unique targets for drug development. Several important mechanisms have been proposed to explain the underlying pathology of AD, such as Amyloid cascade hypothesis, Tau hypothesis and Cholinergic hypothesis, etc.

MCE offers a unique collection of 1366 compounds with anti-Alzheimer’s Disease activities or targeting the unique targets of AD. MCE Anti-Alzheimer’s Disease Compound Library is a useful tool for exploring the mechanism of AD and discovering new drugs for AD.

Cat. No.	Product Name	Type

HY-19948

Leucomethylene blue mesylate 5 Publications Verification TRx0237 mesylate; Methylene blue leuco base mesylate	Chromogenic Assays
Leucomethylene blue (TRx0237) mesylate, an orally active second-generation *tau* protein aggregation inhibitor (K_i of 0.12 μM), could be used for the study of Alzheimer's Disease. Leucomethylene blue mesylate is a common reduced form of Methylene Blue, Methylene Blue is a member of the thiazine class of dyes .

HY-14536

Methylene Blue

10+ Cited Publications

Basic Blue 9; CI-52015; Methylthioninium chloride

Chromogenic Assays

Methylene blue (Basic Blue 9) is a guanylyl cyclase (sGC), monoamine oxidase A (MAO-A) and NO synthase (NOS) inhibitor. Methylene blue is a vasopressor and is often used as a dye in several medical procedures. Methylene blue through the nitric oxide syntase/guanylate cyclase signalling pathway to reduce prepulse inhibition. Methylene blue is a REDOX cycling compound and able to cross the blood-brain barrier. Methylene blue is a Tau aggregation inhibitor. Methylene blue reduces cerebral edema, attenuated microglial activation and reduced neuroinflammation .

HY-D1494

FSB	Fluorescent Dyes/Probes
FSB is a fluorescent dye that can be used to detect filamentous tau and to label human amyloid lesions with high sensitivity and specificity (excitation: 390 nm, emission: 520 nm) .

Cat. No.	Product Name	Target	Research Area

HY-P1707A

Tau protein (592-597), human TFA	Tau Protein	Neurological Disease
Tau protein (592-597), human TFA is a peptide fragment of human Tau protein. The dysfunction of Tau protein is involved in neurodegeneration and dementia .

HY-P2516

Tau Peptide (275-305) (Repeat 2 domain)	Tau Protein	Neurological Disease
Tau Peptide (275-305) (Repeat 2 domain) is the Alzheimer's tau fragment R2, corresponding to the second repeat unit of the microtubule-binding domain, which is believed to be pivotal to the biochemical properties of full tau protein .

HY-P4943

Tau Peptide (273-284)

Tau Protein Neurological Disease

Tau Peptide (273-284) is aTau fragment.
HY-P4969

Tau Peptide (379-408)

Tau Protein Neurological Disease

Tau Peptide (379-408) is aTau fragment.
HY-P4923

Tau Peptide (1-16) (human)

Tau Protein Neurological Disease

Tau Peptide (1-16) (human) is aTau fragment.
HY-P4960

Tau Peptide (294-305) (human)

Tau Protein Neurological Disease

Tau Peptide (294-305) (human) is aTau fragment.
HY-P4924

Tau Peptide (244-274) (Repeat 1 Domain)

Tau Protein Neurological Disease

Tau Peptide (244-274) (Repeat 1 Domain) is aTau fragment.
HY-P4927

Tau Peptide (245-274) (Repeat 1 Domain)

Tau Protein Neurological Disease

Tau Peptide (245-274) (Repeat 1 Domain) is aTau fragment.
HY-P4966

Tau Peptide (306-336) (Repeat 3 Domain)

Tau Protein Neurological Disease

Tau Peptide (306-336) (Repeat 3 Domain) is aTau fragment.

HY-P4935

Tau Peptide (268-282)	Peptides	Others
Tau Peptide (268-282) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4949

Tau Peptide (274-288)	Peptides	Others
Tau Peptide (274-288) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4959

Tau Peptide (277-291)	Peptides	Others
Tau Peptide (277-291) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4961

Tau Peptide (295-309)	Peptides	Others
Tau Peptide (295-309) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4962

Tau Peptide (298-312)	Peptides	Others
Tau Peptide (298-312) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4963

Tau Peptide (301-315)	Peptides	Others
Tau Peptide (301-315) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4964

Tau Peptide (304-318)	Peptides	Others
Tau Peptide (304-318) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4965

Tau Peptide (306-317)	Peptides	Others
Tau Peptide (306-317) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4967

Tau Peptide (307-321)	Peptides	Others
Tau Peptide (307-321) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4974

Tau Peptide (512-525) amide	Peptides	Others
Tau Peptide (512-525) amide is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4972

Tau Peptide (45-73) (Exon 2/Insert 1 Domain)

Tau Protein Neurological Disease

Tau Peptide (45-73) (Exon 2/Insert 1 Domain) is aTau fragment.
HY-P4977

Tau Peptide (74-102) (Exon 3/Insert 2 Domain)

Tau Protein Neurological Disease

Tau Peptide (74-102) (Exon 3/Insert 2 Domain) is aTau fragment.

HY-P4968

Tau Peptide (337-368) (Repeat 4 Domain)	Peptides	Others
Tau Peptide (337-368) (Repeat 4 Domain) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4933

Tau Peptide (255-314) (Repeat 2 Domain) (human)	Tau Protein	Others
Tau Peptide (255-314) (Repeat 2 Domain) (human) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4832

*Acetyl-Tau* Peptide (273-284) amide**	Amyloid-β	Neurological Disease
Acetyl-Tau Peptide (273-284) amide is an acetylated Tau peptide fragment. Acetyl-Tau Peptide (273-284) amide limits the substantial aggregation of Ac-Aβ(25–35)-NH2 and can be used as an inhibitor of Ac-Aβ(25–35)-NH2. Acetyl-Tau Peptide (273-284) amide can be used as an experimental model to investigate the Aβ/Tau cross-interaction .

HY-P4695

(Thr(PO3H2)231)-Tau Peptide (225-237)

Peptides Neurological Disease

(Thr(PO3H2)231)-Tau Peptide (225-237) is a fragment of tau peptide .

HY-P0181

*Microtubule-associated protein tau* (26-44)**	Tau Protein	Neurological Disease
Microtubule-associated protein tau (26-44) is a synthetic peptide chain with an amine group attached to glutamine and an carboxyl group attached to lysine.

HY-P4808

PHF6	Amyloid-β	Neurological Disease
PHF6 (VQIVYK) is a self-assembly sequence capable of initiating the full-length tau protein aggregation and is mapped to the third microtubule-binding repeat region of the tau protein .

HY-P4691

*(Ser(PO3H2)396,404)-Tau* Peptide (379-408)**	Peptides	Others
(Ser(PO3H2)396,404)-Tau Peptide (379-408) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4686

*(Ser(PO3H2)202,Thr(PO3H2)205)-Tau* Peptide (194-213)**	Peptides	Others
(Ser(PO3H2)202,Thr(PO3H2)205)-Tau Peptide (194-213) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P4830

*Acetyl-Tau* Peptide (244-274) (Repeat 1 Domain)**	Peptides	Others
Acetyl-Tau Peptide (244-274) (Repeat 1 Domain) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

HY-P5334

AADvac 1

Peptides Others

AADvac 1 is a biological active peptide. (Alzheimer’s Disease Peptide Vaccine, Tau(294?305) conjugated to KLH)
HY-P1675A

Acetyl-PHF6 amide TFA

1 Publications Verification

AcPHF6 TFA; Ac-VQIVYK-NH2 TFA
Tau Protein Neurological Disease

Acetyl-PHF6 amide TFA (AcPHF6 TFA) is a tau derived hexapeptide.
HY-P4822

Acetyl-PHF5 amide

Tau Protein Others

Acetyl-PHF5 amide is an amyloidogenic protein tau peptide. Acetyl-PHF5 amide can polymerization into filamentous structures .

HY-P3307

Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2	Tau Protein	Neurological Disease
Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2 is serum stable, non-toxic to neuronal cells, and selectivity inhibits the fibrilization of tau over Aβ₄₂.

Cat. No.	Product Name	Target	Research Area

HY-P99471

Bepranemab UCB 0107	Tau Protein	Neurological Disease
Bepranemab (UCB 0107) is a humanized, full-length IgG4 monoclonal antibody that binds to a central tau epitope (amino acids 235-250). Bepranemab can be used for Alzheimer’s disease (AD) research .

HY-P99399

Semorinemab RG 6100; RO7105705; Mtau-9937A	Tau Protein	Neurological Disease
Semorinemab (RG 6100) is an anti-Tau humanized IgG4 monoclonal antibody, targets the N-terminal portion of the Tau protein (amino acid residues 6-23). Semorinemab binds with human Tau with a K_d value of 3.8 nM. Semorinemab can be used for the research of Alzheimer's Disease .

HY-P99164

Zagotenemab LY33003560	Microtubule/Tubulin	Neurological Disease
Zagotenemab (LY3303560) is a humanised anti-tau antibody that selectively binds and neutralises *tau* deposits in the brain. Zagotenemab can be used in Alzheimer's disease research .

HY-P99163

Tilavonemab ABBV-8E12; C2N-8E12	Microtubule/Tubulin	Neurological Disease
Tilavonemab (ABBV-8E12) is a humanised anti-tau antibody that binds amino acids 25-30 near the N-terminal end of the *tau* protein. Tilavonemab blocks the ability of human and mouse neurons to take up *tau* aggregates and reduces brain atrophy. Tilavonemab can be used in the study of Alzheimer's disease .

HY-P9995

Posdinemab

JNJ-63733657
Tau Protein Cancer

Posdinemab is a humanized IgG1κ antibody, targeting to microtubule-associated protein tau (MAPT) .

HY-P99648

Gosuranemab BMS-986168; IPN007; BIIB092	Tau Protein	Neurological Disease
Gosuranemab (BMS-986168) is a humanised IgG4 anti-tau monoclonal antibody. Gosuranemab binds to human N-terminal tau residues 15-22. Gosuranemab has the potential for the research of alzheimer’s disease (AD) .

Species:	Human (8) Rhesus Macaque (1) Rat (2) Mouse (2) Bovine (1)
Tag:	His (11) Tag Free (1) GST (4) Flag (2)
Source:	HEK293 (4) P. pastoris (3) Sf9 insect cells (3) E. coli (4)

Cat. No.	Compare	Product Name	Species	Source

HY-P71752

	*Microtubule-associated protein tau* Protein, Mouse (P.pastoris, His)** Mapt; Mtapt; tau; Microtubule-associated protein tau; Neurofibrillary tangle protein; Paired helical filament-tau; PHF-tau	Mouse	P. pastoris
	Microtubule-associated protein tau (MAPT) plays a key role in promoting microtubule assembly and stability, suggesting its potential contribution to the establishment of neuronal polarity. The C terminus binds to axonal microtubules, whereas the N terminus interacts with neuroplasmic membrane components, serving as a key linker protein between these structures. Microtubule-associated protein tau Protein, Mouse (P.pastoris, His) is the recombinant mouse-derived Microtubule-associated protein tau protein, expressed by P. pastoris , with N-6*His labeled tag. The total length of Microtubule-associated protein tau Protein, Mouse (P.pastoris, His) is 732 a.a., with molecular weight of ~78.1 kDa.

HY-P71753

	*Microtubule-associated protein tau* Protein, Rat (P.pastoris, His)** Mapt; Mtapt; tau; Microtubule-associated protein tau; Neurofibrillary tangle protein; Paired helical filament-tau; PHF-tau	Rat	P. pastoris
	Microtubule-associated protein tau (MAPT) critically promotes microtubule assembly and stability, influencing neuronal polarity by acting as an important junction protein. Its dual role involves C-terminal binding to axonal microtubules and N-terminal binding to neuroplasmic membrane components. Microtubule-associated protein tau Protein, Rat (P.pastoris, His) is the recombinant rat-derived Microtubule-associated protein tau protein, expressed by P. pastoris , with N-His labeled tag. The total length of Microtubule-associated protein tau Protein, Rat (P.pastoris, His) is 751 a.a., with molecular weight of ~80.4 kDa.

HY-P73618

	Tau/0N3R Protein, Human (351a.a, His) MAPT; Mtapt; tau; Microtubule-associated protein tau; PHF-tau	Human	E. coli
	Tau/0N3R protein is encoded by the Tau/0N3R gene and undergoes regulated alternative splicing to produce different mRNA species. Its expression varies in the nervous system according to the maturation and type of neurons. Tau/0N3R Protein, Human (351a.a, His) is the recombinant human-derived Tau/0N3R protein, expressed by E. coli , with N-His labeled tag. The total length of Tau/0N3R Protein, Human (351a.a, His) is 351 a.a., with molecular weight of 40-50 kDa.

HY-P71102

	Tau-D/0N4R Protein, Human (133a.a, His) Microtubule-Associated Protein tau; Neurofibrillary Tangle Protein; Paired Helical Filament-tau; PHF-tau; MAPT; MAPTL; MTBT1; tau	Human	E. coli
	Microtubule-associated protein tau is a microtubule-associated protein found in large numbers in neurons of the central nervous system (CNS). MAPT promotes microtubule assembly and stability and may be involved in the establishment and maintenance of neuronal polarity. Overexpression of MAPT is associated with a poor prognosis of prostate cancer. MAPT has been linked to neurological disorders such as Alzheimer's and Parkinson's disease. Tau-D/0N4R Protein, Human (133a.a, His) is the recombinant human-derived Tau-D/0N4R protein, expressed by E. coli , with C-6*His labeled tag. The total length of Tau-D/0N4R Protein, Human (133a.a, His) is 133 a.a., with molecular weight of ~16.0 kDa.

HY-P700422

	Tau/MAPT Protein, Mouse (HEK293, His) MAPT; tau; MSTD; PPND; DDPAC; MAPTL; MTBT1; MTBT2; FTDP-17; microtubule-associated protein tau; microtubule-associated protein tau; PHF-tau; paired helical filament-tau; neurofibrillary tangle protein; microtubule-associated protein tau, isoform 4; G protein beta1/gamma2 subunit-interacting factor 1	Mouse	HEK293
	Microtubule-associated protein tau (MAPT) plays a pivotal role in promoting microtubule assembly and stability, indicating its potential contribution to neuronal polarity establishment. The C-terminus binds to axonal microtubules, while the N-terminus interacts with neural plasma membrane components, serving as a crucial linker protein between these structures. Tau's localization within the neuronal cell, particularly in the centrosome-defined domain, dictates axonal polarity. Short MAPT isoforms enhance cytoskeletal plasticity, while longer isoforms stabilize it. MAPT engages in diverse interactions with proteins like MARK1, MARK2, MARK3, MARK4, SQSTM1, PSMC2, FKBP4, CSNK1D, SGK1, EPM2A, PIN1, LRRK2, and LRP1, participating in processes from ubiquitination to dephosphorylation and endocytosis, underscoring its multifaceted role in cellular dynamics. Tau/MAPT Protein, Mouse (HEK293, His) is the recombinant mouse-derived Tau/MAPT protein, expressed by HEK293, with N-10*His labeled tag. The total length of Tau/MAPT Protein, Mouse (HEK293, His) is 732 a.a., with molecular weight of 78.9 kDa.

HY-P700424

	Tau/MAPT Protein, Rat (HEK293, His) MAPT; tau; MSTD; PPND; DDPAC; MAPTL; MTBT1; MTBT2; FTDP-17; microtubule-associated protein tau; microtubule-associated protein tau; PHF-tau; paired helical filament-tau; neurofibrillary tangle protein; microtubule-associated protein tau, isoform 4; G protein beta1/gamma2 subunit-interacting factor 1	Rat	HEK293
	Microtubule-associated protein tau (MAPT) critically promotes microtubule assembly and stability, influencing neuronal polarity by acting as a vital linker protein. Its dual role involves the C-terminus binding axonal microtubules and the N-terminus engaging neural plasma membrane components. Tau's cellular localization, especially near the centrosome, determines axonal polarity. Short tau isoforms offer cytoskeletal plasticity, while longer isoforms likely stabilize microtubules. MAPT engages with various proteins, including MARK1, MARK2, SQSTM1, LRP1, showcasing its multifaceted role in cellular processes. The interaction with LRP1, leading to endocytosis, highlights the intricate regulatory mechanisms governing tau's functional versatility. Tau/MAPT Protein, Rat (HEK293, His) is the recombinant rat-derived Tau/MAPT protein, expressed by HEK293, with N-10*His labeled tag. The total length of Tau/MAPT Protein, Rat (HEK293, His) is 751 a.a., with molecular weight of 81.2 kDa.

HY-P700421

	Tau-F/MAPT Protein, Human (HEK293, His) MAPT; tau; MSTD; PPND; DDPAC; MAPTL; MTBT1; MTBT2; FTDP-17; microtubule-associated protein tau; microtubule-associated protein tau; PHF-tau; paired helical filament-tau; neurofibrillary tangle protein; microtubule-associated protein tau, isoform 4; G protein beta1/gamma2 subunit-interacting factor 1	Human	HEK293
	Microtubule-associated protein tau is a microtubule-associated protein found in large numbers in neurons of the central nervous system (CNS). MAPT promotes microtubule assembly and stability and may be involved in the establishment and maintenance of neuronal polarity. Overexpression of MAPT is associated with a poor prognosis of prostate cancer. MAPT has been linked to neurological disorders such as Alzheimer's and Parkinson's disease. Tau-F/MAPT Protein, Human (HEK293, His) is the recombinant human-derived Tau-F/MAPT protein, expressed by HEK293 , with N-10*His labeled tag. The total length of Tau-F/MAPT Protein, Human (HEK293, His) is 441 a.a., with molecular weight of 49.5 kDa.

HY-P700423

	Tau/MAPT Protein, Macaca mulatta (HEK293, His) MAPT; tau; MSTD; PPND; DDPAC; MAPTL; MTBT1; MTBT2; FTDP-17; microtubule-associated protein tau; microtubule-associated protein tau; PHF-tau; paired helical filament-tau; neurofibrillary tangle protein; microtubule-associated protein tau, isoform 4; G protein beta1/gamma2 subunit-interacting factor 1	Rhesus Macaque	HEK293
	Tau/MAPT Protein crucially promotes microtubule assembly and stability, essential for neuronal polarity. Structurally, its C-terminus binds axonal microtubules, and the N-terminus engages neural plasma membrane components, suggesting a role as a linker protein connecting microtubules to the plasma membrane. Tau's localization dictates axonal polarity, particularly near the centrosome. Short isoforms offer cytoskeletal plasticity, while longer isoforms stabilize microtubules. Tau interacts with proteins like MARK1, MARK2, SQSTM1, and LRP1, revealing its multifaceted role in cellular processes. Tau/MAPT Protein, Macaca mulatta (HEK293, His) is the recombinant Rhesus Macaque-derived Tau/MAPT protein, expressed by HEK293, with N-10*His labeled tag. The total length of Tau/MAPT Protein, Macaca mulatta (HEK293, His) is 458 a.a., with molecular weight of 50.6 kDa.

HY-P70589

	Tau-F/MAPT Protein, Human DDPAC; FLJ31424; FTDP-17; G protein beta1/gamma2 subunit-interacting factor 1; MAPT; MGC138549; microtubule-associated protein tau; MSTD; MSTDMAPTL; MTBT1; MTBT1Neurofibrillary tangle protein; MTBT2; Neurofibrillary tangle protein; PHF-tau; PPND; tau; tauPaired helical filament-tau	Human	E. coli
	Microtubule-associated protein tau is a microtubule-associated protein found in large numbers in neurons of the central nervous system (CNS). MAPT promotes microtubule assembly and stability and may be involved in the establishment and maintenance of neuronal polarity. Overexpression of MAPT is associated with a poor prognosis of prostate cancer. MAPT has been linked to neurological disorders such as Alzheimer's and Parkinson's disease. Tau-F/MAPT Protein, Human is the recombinant human-derived Tau-F/MAPT protein, expressed by E. coli , with tag free. The total length of Tau-F/MAPT Protein, Human is 441 a.a., with molecular weight of ~60.0 kDa.

HY-P701658

	CK1d Protein, Human (Sf9, GST) CSNK1D; Casein kinase I isoform delta; CKI-delta; CKId; tau-protein kinase CSNK1D	Human	Sf9 insect cells
	The CK1d protein is an important serine/threonine protein kinase that complexly controls cellular processes such as Wnt signaling, DNA repair, and circadian rhythms. Its versatility is evident in phosphorylating a variety of proteins, including connexin-43/GJA1, MAP1A, p53/TP53, and YAP1. CK1d Protein, Human (Sf9, GST) is the recombinant human-derived CK1d protein, expressed by Sf9 insect cells , with N-GST labeled tag. The total length of CK1d Protein, Human (Sf9, GST) is 414 a.a., .

HY-P702685

	CDK5-p25 Protein, Human (sf9, GST, His, Flag) CDK5; cyclin-dependent kinase 5; PSSALRE; TPKII catalytic subunit; protein kinase CDK5 splicing; cell division protein kinase 5; serine/threonine-protein kinase PSSALRE; tau protein kinase II catalytic subunit	Human	Sf9 insect cells

HY-P702686

	CDK5-p35 Protein, Human (sf9, GST, His, Flag) CDK5; cyclin-dependent kinase 5; PSSALRE; TPKII catalytic subunit; protein kinase CDK5 splicing; cell division protein kinase 5; serine/threonine-protein kinase PSSALRE; tau protein kinase II catalytic subunit	Human	Sf9 insect cells

HY-P71798

	*Interferon tau-1/IFNT1 Protein, Bovine (P.pastoris, His)* IFNT1; Interferon tau-1; IFN-tau-1; Antiluteolysin; Trophoblast antiluteolytic protein; Trophoblast protein 1; TP-1; Trophoblastin	Bovine	P. pastoris
	Interferon tau-1 (IFNT1) serves as an important paracrine hormone that initiates maternal recognition of pregnancy. After interacting with endometrial receptors, possibly type I interferon receptors, IFNT1 blocks estrogen receptor expression and prevents estrogen-induced upregulation of oxytocin receptor expression. Interferon tau-1/IFNT1 Protein, Bovine (P.pastoris, His) is the recombinant bovine-derived Interferon tau-1/IFNT1 protein, expressed by P. pastoris , with N-His labeled tag. The total length of Interferon tau-1/IFNT1 Protein, Bovine (P.pastoris, His) is 172 a.a., with molecular weight of ~21.8 kDa.

HY-P75548

	14-3-3 theta Protein, Human (GST) 14-3-3 protein theta; 14-3-3 protein tau; Protein HS1; YWHAQ	Human	E. coli
	14-3-3 theta protein, an adapter in diverse signaling pathways, recognizes phosphoserine or phosphothreonine motifs, modulating partner activity upon binding. It negatively regulates PDPK1 kinase activity, forms homodimers, and interacts with CDK16, phosphorylated RGS7, SSH1, phosphorylated CDKN1B, GAB2, phosphorylated PDPK1, and phosphorylated DAPK2. Additional interactions include PI4KB, TBC1D22A, TBC1D22B, SLITRK1, RIPOR2 isoform 2, INAVA, MARK2, MARK3, MARK4, and MEFV, highlighting its versatile role. 14-3-3 theta Protein, Human (GST) is the recombinant human-derived 14-3-3 theta protein, expressed by E. coli, with N-GST labeled tag. The total length of 14-3-3 theta Protein, Human (GST) is 245 a.a., with molecular weight of ~53 kDa.

Cat. No.	Product Name	Application	Reactivity

HY-P80861

*Phospho-Tau* (Thr181) Antibody** MAPT; MAPTL; MTBT1; tau; Microtubule-associated protein tau; Neurofibrillary tangle protein; Paired helical filament-tau; PHF-tau	WB, IP	Human
Phospho-Tau (Thr181) Antibody is a non-conjugated and Rabbit origined monoclonal antibody about 79 kDa, targeting to Phospho-Tau (Thr181). It can be used for WB,IP assays with tag free, in the background of Human.

HY-P80860

*Phospho-Tau* (Ser404) Antibody** MAPT; MAPTL; MTBT1; tau; Microtubule-associated protein tau; Neurofibrillary tangle protein; Paired helical filament-tau; PHF-tau	WB	Human, Rat
Phospho-Tau (Ser404) Antibody is a non-conjugated and Rabbit origined monoclonal antibody about 79 kDa, targeting to Phospho-Tau (Ser404). It can be used for WB assays with tag free, in the background of Human, Rat.

HY-P80859

*Phospho-Tau* (Ser198) Antibody** MAPT; MAPTL; MTBT1; tau; Microtubule-associated protein tau; Neurofibrillary tangle protein; Paired helical filament-tau; PHF-tau	WB, IP	Human
Phospho-Tau (Ser198) Antibody is a non-conjugated and Rabbit origined monoclonal antibody about 79 kDa, targeting to Phospho-Tau (Ser198). It can be used for WB,IP assays with tag free, in the background of Human.

HY-P80909

Tau Antibody MAPT; MAPTL; MTBT1; tau; Microtubule-associated protein tau; Neurofibrillary tangle protein; Paired helical filament-tau; PHF-tau	WB	Human, Mouse, Rat
Tau Antibody is a non-conjugated and Rabbit origined monoclonal antibody about 79 kDa, targeting to Tau. It can be used for WB assays with tag free, in the background of Human, Mouse, Rat.

HY-P80539

AMPK alpha 1 Antibody PRKAA1; AMPK1; 5'-AMP-activated protein kinase catalytic subunit alpha-1; AMPK subunit alpha-1; Acetyl-CoA carboxylase kinase; ACACA kinase; Hydroxymethylglutaryl-CoA reductase kinase; HMGCR kinase; tau-protein kinase PRKAA1	WB, IHC-P, ICC/IF, IP, FC	Human, Mouse, Rat
AMPK alpha 1 Antibody is a non-conjugated and Rabbit origined polyclonal antibody about 64 kDa, targeting to AMPK alpha 1. It can be used for WB,IHC-P,ICC/IF,IP,FC assays with tag free, in the background of Human, Mouse, Rat.

HY-P80790

Phospho-AMPK alpha 1 (Ser496) Antibody PRKAA1; AMPK1; 5'-AMP-activated protein kinase catalytic subunit alpha-1; AMPK subunit alpha-1; Acetyl-CoA carboxylase kinase; ACACA kinase; Hydroxymethylglutaryl-CoA reductase kinase; HMGCR kinase; tau-protein kinase PRKAA1	WB, IHC-P, ICC/IF	Human, Mouse, Rat
Phospho-AMPK alpha 1 (Ser496) Antibody is a non-conjugated and Rabbit origined polyclonal antibody about 64 kDa, targeting to Phospho-AMPK alpha 1 (Ser496). It can be used for WB,IHC-P,ICC/IF assays with tag free, in the background of Human, Mouse, Rat.

HY-P80613

CDK5 Antibody (YA796) Cdk 5; Cdk5; CDK5_HUMAN; Cell division protein kinase 5; Crk6; Cyclin dependent kinase 5; Cyclin-dependent kinase 5; Protein kinase CDK5 splicing; PSSALRE; Serine threonine protein kinase PSSALRE; Serine/threonine-protein kinase PSSALRE; tau protein kinas	WB, ICC/IF	Human, Mouse, Rat, Monkey
CDK5 Antibody (YA796) is a non-conjugated and Mouse origined monoclonal antibody about 33 kDa, targeting to CDK5 (2E8). It can be used for WB,ICC/IF assays with tag free, in the background of Human, Mouse, Rat, Monkey.

HY-P80480

*Phospho-Tau* (Ser396) Antibody**	WB, ICC/IF, IHC-P	Mouse, Rat, Human
Phospho-Tau (Ser396) Antibody is a non-conjugated and Rabbit origined monoclonal antibody about 79 kDa, targeting to Phospho-Tau(S396). It can be used for WB,ICC/IF,IHC-P assays with tag free, in the background of Mouse, Rat, Human.

HY-P82210

14-3-3 theta Antibody (YA1955)

YWHAQ; 14-3-3 protein theta; 14-3-3 protein T-cell; 14-3-3 protein tau; Protein HS1
WB Human, Mouse, Rat

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks