1. Search Result
Search Result
Pathways Recommended: Anti-infection
Results for "

viral infection

" in MCE Product Catalog:

50

Inhibitors & Agonists

5

Screening Libraries

1

Peptides

10

Natural
Products

2

Isotope-Labeled Compounds

Cat. No. Product Name Target Research Areas
  • HY-143760
    Cap-dependent endonuclease-IN-11

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-11 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-11 has the potential for the research of viral infections (extracted from patent WO2021129602A1, compound DSC126).
  • HY-N8393
    Ascr#18

    Bacterial Fungal Infection
    Ascr#18, an ascaroside, is a hormone of nematodes. Ascr#18 is expressed during nematode development. Ascr#18 increases resistance in Arabidopsis, tomato, potato and barley to viral, bacterial, oomycete, fungal and nematode infections.
  • HY-50001
    Nucleozin

    Influenza Virus Infection
    Nucleozin, a potent inhibitor of influenza A virus infection, induces the formation of nucleoprotein (NP) aggregates and antagonizes its nuclear accumulation, leading to cessation of viral replication. Nucleozin impedes influenza A virus replication in vitro with a nanomolar EC50.
  • HY-147240
    Acloproxalap

    Others Infection Inflammation/Immunology Cardiovascular Disease
    Acloproxalap is a quinoline-based aldehyde scavenger that can be used in studies of diseases with toxic aldehyde accumulation, such as inflammatory diseases of the eye and skin, respiratory diseases such as pneumonia, organ diseases, and viral infection-related syndromes.
  • HY-143769
    Cap-dependent endonuclease-IN-15

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-15 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-15 inhibits the replication of influenza virus. Cap-dependent endonuclease-IN-15 has the potential for the research of viral infections caused by influenza viruses (extracted from patent CN113226327A, compound c-1).
  • HY-143768
    Cap-dependent endonuclease-IN-14

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-14 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-14 inhibits the replication of influenza virus. Cap-dependent endonuclease-IN-14 has the potential for the research of viral infections caused by influenza viruses (extracted from patent CN113620948A, compound 1-c).
  • HY-126419
    Kobophenol A

    SARS-CoV PKC Infection
    Kobophenol A, an oligomeric stilbene, blocks the interaction between the ACE2 receptor and S1-RBD with an IC50 of 1.81 μM and inhibits SARS-CoV-2 viral infection in cells with an EC50 of 71.6 μM. Kobophenol A inhibits the activity of partially purified rat brain protein kinase C (PKC) with an IC50 of 52 µM.
  • HY-144068
    Cap-dependent endonuclease-IN-25

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-25 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-25 is a macrocyclic pyridotriazine derivative. Cap-dependent endonuclease-IN-25 has the potential for the research of viral infections caused by viruses belonging to the Orthomyxoviridae family (extracted from patent WO2020075080A1, compound 4).
  • HY-143757
    Cap-dependent endonuclease-IN-10

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-10 is a potent inhibitor of cap-dependent endonuclease (CEN). Not only can Cap-dependent endonuclease-IN-10 inhibit influenza virus well, but also has lower cytotoxicity, better in vivo pharmacokinetic and in vivo pharmacodynamic properties, and better hepatic microsomal stability. Cap-dependent endonuclease-IN-10 has the potential for the research of viral infections (including influenza A, influenza B and influenza C) (extracted from patent WO2021129799A1, compound 1-1).
  • HY-142932
    BTK-IN-6

    Btk Cancer Inflammation/Immunology Neurological Disease
    BTK-IN-6 is a potent inhibitor of Bruton's Tyrosine Kinase (BTK). BTK is a member of the Tec family of tyrosine kinases and plays an important role in the regulation of early B-cell development and mature B-cell activation and survival. BTK-IN-6 has the potential for the research of immune disorders, cancer, cardiovascular diseases, viral infections, inflammation, metabolism/endocrine function disorders, and neurological disorders (extracted from patent WO2021136219A1, compound 8).
  • HY-B1056
    Procodazole

    Propazol; 2-Benzimidazolepropionic acid

    Bacterial Infection
    Procodazole is a non-specific active immunoprotective agent against viral and bacterial infections, used as a potentiator.
  • HY-107902
    RIG-1 modulator 1

    HBV HCV HIV Influenza Virus Infection
    RIG-1 modulator 1 is an anti-viral compound which can be useful for the treatment of viral infections including influenza virus, HBV, HCV and HIV extracted from patent WO 2015172099 A1.
  • HY-N0677
    Dehydroandrographolide succinate

    Influenza Virus Infection Inflammation/Immunology Cancer
    Dehydroandrographolide succinate, extracted from herbal medicine Andrographis paniculata (Burm f) Nees, is widely used for the treatment of viral pneumonia and viral upper respiratory tract infections because of its immunostimulatory, anti-infective and anti-inflammatory effect.
  • HY-N0677B
    Dehydroandrographolide succinate potassium sodium salt

    Others Infection Inflammation/Immunology
    Dehydroandrographolide succinate (potassium sodium salt), extracted from herbal medicine Andrographis paniculata (Burm f) Nees, is widely used for the treatment of viral pneumonia and viral upper respiratory tract infections because of its immunostimulatory, anti-infective and anti-inflammatory effect.
  • HY-114621
    DB772

    Others Infection
    DB772 is a bovine viral diarrhea virus (BVDV, genus Pestivirus, family Flaviviridae) infection inhibitor. Anti-prion activity.
  • HY-N0677A
    Kalii Dehydrographolidi Succinas

    Potassium dehydroandrographolide succinate

    Others Infection Inflammation/Immunology Cancer
    Kalii Dehydrographolidi Succinas (Potassium dehydroandrographolide succinate), extracted from herbal medicine Andrographis paniculata (Burm f) Nees, is widely used for the treatment of viral pneumonia and viral upper respiratory tract infections because of its immunostimulatory, anti-infective and anti-inflammatory effect.
  • HY-N0158
    Oxymatrine

    TGF-beta/Smad Influenza Virus Cancer Infection Inflammation/Immunology
    Oxymatrine, an alkaloid from the roots of Sophora species, with anti-inflammatory, antifibrosis, and antitumor effects, inhibits the iNOS expression and TGF-β/Smad pathway. Oxymatrine inhibits bocavirus minute virus of canines (MVC) replication, reduces viral gene expression and decreases apoptosis induced by viral infection.
  • HY-138061
    DENV-IN-2

    DNA/RNA Synthesis Infection
    DENV-IN-2 is a potent dengue viral replication inhibitor extracted from patent WO2018215315A1, compound 6AB, has an EC50 of 0.016 nM. DENV-IN-2 shows high potent activity against all four serotypes of the Dengue virus with EC50s ranging from 0.013 to 0.029 nM.
  • HY-B0307A
    Idoxuridine hydrate

    5-Iodo-2′-deoxyuridine hydrate; 5-IUdR hydrate; IdUrd hydrate

    Phosphatase Infection
    Idoxuridine (5-Iodo-2′-deoxyuridine, 5-IUdR, IdUrd) hydrate is an iodinated thymidine analogue that competitively inhibits phosphorylases. Idoxuridine can inhibit viral activity, particularly viral eye infections, including herpes simplex keratitis, by inhibiting DNA polymerase and affecting viral replication. Idoxuridine against feline herpesvirus has the IC50 value of 4.3 μM.
  • HY-N2840
    Allitol

    Allodulcitol

    Others Cancer Metabolic Disease
    Allitol is a rare natural polyol that can be used as a sweetener. Allitol is an important intermediate for the preparation of the agents which against diabetes, cancer, and viral infections, including AIDS.
  • HY-B0307
    Idoxuridine

    5-Iodo-2′-deoxyuridine; 5-IUdR; IdUrd

    Phosphatase Orthopoxvirus Infection Cancer
    Idoxuridine (5-Iodo-2′-deoxyuridine, 5-IUdR, IdUrd) is an iodinated thymidine analogue that competitively inhibits phosphorylases. Idoxuridine can inhibit viral activity, particularly viral eye infections, including herpes simplex keratitis, by inhibiting DNA polymerase and affecting viral replication. Idoxuridine against feline herpesvirus has the IC50 value of 4.3 μM. Idoxuridine shows anti-orthopoxvirus activity.
  • HY-144047
    HBV-IN-16

    HBV DNA/RNA Synthesis Infection
    HBV-IN-16 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-16 is a quinoline derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2019121357A1, compound 1).
  • HY-144046
    HBV-IN-15

    HBV DNA/RNA Synthesis Infection
    HBV-IN-15 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-15 is a flavone derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2020052774A1, compound 2).
  • HY-144045
    HBV-IN-14

    HBV DNA/RNA Synthesis Infection
    HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5).
  • HY-136266
    HCV-IN-29

    HCV Cancer
    HCV-IN-29 is a hepatitis C virus (HCV) inhibitor exacted from patent US8329159B2, compound 1e.
  • HY-116146
    CYM50179

    LPL Receptor Inflammation/Immunology
    CYM50179 (compound 22n) is a potent and selective S1P4-R (Sphingosine-1-phosphate4 receptor) agonist with an EC50 of 46 nM.
  • HY-12725
    ML324

    Histone Demethylase HSV CMV Cancer
    ML324 is a potent JMJD2 demethylase inhibitor with antiviral activity. ML324 also exhibits inhibition for the histone demethylase KDM4B, with an IC50 of 4.9 μM. ML324 has potent anti-viral activity against both herpes simplex virus (HSV) and human cytomegalovirus (hCMV) infection via inhibition viral IE gene expression.
  • HY-143750
    Cap-dependent endonuclease-IN-7

    Influenza Virus Infection
    Cap-dependent endonuclease-IN-7 is a potent inhibitor of cap-dependent endonuclease (CEN). Cap-dependent endonuclease-IN-7 Inhibits the synthesis of viral mRNA and eventually inhibits virus proliferation. Cap-dependent endonuclease-IN-7 has the potential for the research of viral infections (including influenza A, influenza B and influenza C) (extracted from patent WO2020177715A1, compound 5)
  • HY-B0751
    Fumagillin

    Amebacilin; NSC9168

    Parasite HIV Antibiotic Infection
    Fumagillin(NSC9168) is an antimicrobial compound first isolated in 1949 from the fungus Aspergillus fumigatu. Fumagillin can inhibits HIV‐1 infection through the inhibition of HIV-1 viral protein R (Vpr) activity.
  • HY-147217
    Bepirovirsen

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
  • HY-122704A
    Surfen dihydrochloride

    Aminoquincarbamide dihydrochloride

    FGFR HSV VEGFR Infection
    Surfen dihydrochloride is a potent HS (heparan sulfate) antagonist. Surfen binds to glycosaminoglycans. Surfen neutralizes the anticoagulant activity of both unfractionated and low molecular weight heparins. Surfen affects sulfation of heparin and inhibits degradation by heparin lyases. Surfen inhibits FGF2 binding and signaling. Surfen inhibits cell attachment, and virus infection.
  • HY-126085
    (±)-Alliin

    (±)-L-Alliin

    SARS-CoV Infection
    (±)-Alliin is the main active component of garlic. (±)-Alliin is a putative inhibitor of the main protease of SARS-CoV-2 (Mpro).
  • HY-112258
    IMP-1088

    DNA/RNA Synthesis Infection
    IMP-1088 is a potent human N-myristoyltransferases NMT1 and NMT2 dual inhibitor with IC50s of <1 nM for HsNMT1 and HsNMT2. IMP-1088 has a Kd of <210 pM for HsNMT1. IMP-1088 efficiently blocks rhinovirus replication by blocking rhinovirus virus-encoded protein (VP0) N-myristoylation. IMP-1088 protects host cells from the cytotoxic effects of viral infection.
  • HY-147014
    Cyclic HPMPC

    CMV Orthopoxvirus Infection
    Cyclic HPMPC is a potent antiviral agent. Cyclic HPMPC can increase arterial oxygen saturation levels in lethal vaccinia virus (IHD strain)-infected mice. Cyclic HPMPC improves the outcome of congenital guinea pig cytomegalovirus (GPCMV) infection and decreases viral replication in guinea pig model.
  • HY-137958A
    Bemnifosbuvir

    AT-511

    HCV SARS-CoV Infection
    Bemnifosbuvir (AT-511) is a potent and orally active HCV viral replication inhibitor. Bemnifosbuvir is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC90=0.47 μM). Bemnifosbuvir has pangenotypic antiviral activity.
  • HY-13859
    Clevudine

    L-FMAU

    HBV DNA/RNA Synthesis Orthopoxvirus Infection
    Clevudine (L-FMAU), a nucleoside analog of the unnatural L-configuration, has potent anti-HBV activity with long half-life, low toxicity. Clevudine is a non-competitive inhibitor that is not incorporated into the viral DNA but rather binds to the polymerase. Clevudine is active against cowpox virus respiratory infection in mice.
  • HY-N2036
    Mosloflavone

    Enterovirus Bacterial Infection
    Mosloflavone is a flavonoid isolated from Scutellaria baicalensis Georgi with  anti-EV71 activity. Mosloflavone  inhibits VP2 virus replication and protein expression during the initial stage of virus infection and inhibits viral VP2 capsid protein synthesis. Mosloflavone is a promising biocide and inhibits P. aeruginosa virulence and biofilm formation.
  • HY-14397
    Indomethacin

    Indometacin

    COX Cancer Inflammation/Immunology
    Indomethacin (Indometacin) is a potent, orally active COX1/2 inhibitor with IC50 values of 18 nM and 26 nM for COX-1 and COX-2, respectively. Indomethacin has anticancer activity and anti-infective activity. Indomethacin can be used for cancer, inflammation and viral infection research.
  • HY-14397A
    Indomethacin sodium hydrate

    Indometacin sodium hydrate

    COX Bacterial Influenza Virus Cancer Inflammation/Immunology
    Indomethacin (Indometacin) sodium hydrateis a potent, orally active COX1/2 inhibitor with IC50 values of 18 nM and 26 nM for COX-1 and COX-2, respectively. Indomethacin sodium hydrateis has anticancer activity and anti-infective activity. Indomethacin sodium hydrateis can be used for cancer, inflammation and viral infection research.
  • HY-145871
    BA38017

    HBV Infection
    BA38017 is a potent HBV core protein assembly modulator. BA38017 inhibits HBV replication with an EC50 of 0.20 μM.
  • HY-15303B
    Pritelivir mesylate hydrate

    AIC316 mesylate hydrate; BAY 57-1293 mesylate hydrate

    HSV Infection
    Pritelivir mesylate hydrate (BAY 57-1293 mesylate hydrate), an inhibitor of the viral helicase-primase complex, exhibits antiviral activity in vitro and in animal models of herpes simplex virus (HSV) infection. Pritelivir mesylate hydrate is active against herpes simplex virus types 1 and 2 (HSV-1 and HSV-2) with the IC50 of 0.02 μM against HSV1-2.
  • HY-15303
    Pritelivir

    AIC316; BAY 57-1293

    HSV Infection
    Pritelivir (AIC316), an inhibitor of the viral helicase-primase complex, exhibits antiviral activity in vitro and in animal models of herpes simplex virus (HSV) infection. Pritelivir is active against herpes simplex virus types 1 and 2 (HSV-1 and HSV-2) with the IC50 of 0.02 μM against HSV1-2.
  • HY-15303A
    Pritelivir mesylate

    AIC316 mesylate; BAY 57-1293 mesylate

    HSV Infection
    Pritelivir mesylate (BAY 57-1293 mesylate), an inhibitor of the viral helicase-primase complex, exhibits antiviral activity in vitro and in animal models of herpes simplex virus (HSV) infection. Pritelivir mesylate is active against herpes simplex virus types 1 and 2 (HSV-1 and HSV-2) with the IC50 of 0.02 μM against HSV1-2.
  • HY-17422S1
    Acyclovir-d4

    Aciclovir-d4; Acycloguanosine-d4

    HSV Bacterial Apoptosis Antibiotic Cancer Infection
    Acyclovir-d4 (Aciclovir-d4) is the deuterium labeled Acyclovir. Acyclovir (Aciclovir) is a guanosine analogue and an orally active antiviral agent. Acyclovir inhibits HSV-1 (IC50 of 0.85 μM), HSV-2 (IC50 of 0.86 μM) and varicella-zoster virus. Acyclovir can be phosphorylated by viral thymidine kinase (TK), and Acyclovir triphosphate interferes with viral DNA polymerization through competitive inhibition with guanosine triphosphate and obligatory chain termination. Acyclovir prevents bacterial infections during induction therapy for acute leukaemia.
  • HY-17422S
    Acyclovir-d4 L-Leucinate

    HSV Bacterial Apoptosis Antibiotic Cancer Infection
    Acyclovir-d4 L-Leucinate is the deuterium labeled Acyclovir. Acyclovir (Aciclovir) is a guanosine analogue and an orally active antiviral agent. Acyclovir inhibits HSV-1 (IC50 of 0.85 μM), HSV-2 (IC50 of 0.86 μM) and varicella-zoster virus. Acyclovir can be phosphorylated by viral thymidine kinase (TK), and Acyclovir triphosphate interferes with viral DNA polymerization through competitive inhibition with guanosine triphosphate and obligatory chain termination. Acyclovir prevents bacterial infections during induction therapy for acute leukaemia.
  • HY-120072
    PF-3450074

    PF-74

    HIV Infection
    PF-3450074 (PF-74) is a specifical inhibitor of HIV-1 capsid protein (CA) and displays a broad-spectrum inhibition of HIV isolates with submicromolar potency (EC50=8-640 nM). PF-3450074 (PF-74) acts at an early stage of HIV-1 infection, inhibits viral replication by directly competing with the binding of CPSF6 and NUP153, and blocks the uncoating, assembly, and the reverse transcription steps of the viral life cycle. CPSF6: nuclear host factors cleavage and polyadenylation specific factor 6; NUP153: nucleoporin 153.
  • HY-137958
    Bemnifosbuvir hemisulfate

    AT-527

    HCV SARS-CoV Infection
    Bemnifosbuvir hemisulfate (AT-527), a hemisulfate salt of AT-511, a guanosine nucleotide prodrug, is a potent and orally active HCV viral replication inhibitor. Bemnifosbuvir hemisulfate is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro (EC90=0.47 μM). Bemnifosbuvir hemisulfate has pangenotypic antiviral activity.
  • HY-150509
    Apratoxin S4

    Apra S4

    Cancer Infection Cardiovascular Disease
    Apratoxin S4 (Apra S4) is a potent Sec61 inhibitor that prevents cotranslational translocation of secretory proteins into the endoplasmic reticulum (ER). Apratoxin S4 has antiviral effects against some flaviviruses with IC50 values ranging from 0.46 nM to 170 nM, and inhibits retinal vascular cell activation by suppressing multiple angiogenic pathways. Apratoxin S4 can be used for the research of viral infections, angiogenic diseases and cancers.
  • HY-144334
    CHIKV-IN-3

    DNA/RNA Synthesis Infection
    CHIKV-IN-3 is a potent against two low-passage CHIKV inhibitor with EC50 values of 1.55 and 0.14 µM for CHIKV-122508 and CHIKV-6708, respectively. CHIKV-IN-3 acts on the host cells to interfere with the viral replication. CHIKV-IN-3 displays minimal cytotoxic liability(CC50 > 100 µM). Prophylactic effect.
  • HY-150741
    ODN 2216

    Toll-like Receptor (TLR) IFNAR Interleukin Related Cancer Infection Inflammation/Immunology
    ODN 2216 is a TLR9 (toll-like receptor 9) ligand or agonist. ODN 2216 induces high amounts of IFN-α and IFN-β. ODN 2216 induces IFN-α by pDC (plasmacytoid DC) and IL-12 (p40) production by DC (dendritic cells). ODN 2216 stimulates IFN-γ production in peripheral blood mononuclear cells (PBMC), which is indirect and mediated by IFN-α/β. ODN 2216 can activate NK cells and promote IFN-γ production of TCR-triggered CD4 + T cells.