2. Epigenetics
  3. MicroRNA
  4. MicroRNA Agomir Negative Control

MicroRNA Agomir Negative Control is a chemically-modified double-strand miRNA mimic, and can be used as a negative control.

For research use only. We do not sell to patients.

RNA, (UUGUACUACACAAAAGUACUG), complex with RNA, (GUACUUUUGUGUAGUACAANN) (with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification)

MicroRNA Agomir Negative Control Chemical Structure

Size Price Stock Quantity
5 nmol USD 225 Get quote 1-2 weeks 1-2 weeks
20 nmol USD 560 Get quote 1-2 weeks 1-2 weeks
Synthetic products have potential research and development risk.

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Customer Review

Based on 1 publication(s) in Google Scholar

Other Forms of MicroRNA Agomir Negative Control:

MicroRNA Agomir Negative Control Related Antibodies

Top Publications Citing Use of Products

  • Biological Activity

  • Purity & Documentation

  • Customer Review

Description

MicroRNA Agomir Negative Control is a chemically-modified double-strand miRNA mimic, and can be used as a negative control.

Molecular Weight

13973.44

Appearance

Solid

Color

Colorless to off-white

SMILES

[MicroRNA Agomir Negative Control]
Shipping

Room temperature in continental US; may vary elsewhere.
Storage

-20°C, sealed storage, away from moisture

*In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

Purity & Documentation
  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.

MicroRNA Agomir Negative Control Related Classifications

  • Molarity Calculator

  • Dilution Calculator

The molarity calculator equation

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass   Concentration   Volume   Molecular Weight *
= × ×

The dilution calculator equation

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)
× = ×
C1   V1   C2   V2
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Keywords:

MicroRNA Agomir Negative ControlMicroRNAmiRNAInhibitorinhibitorinhibit

Your Recently Viewed Products:

Inquiry Online

Your information is safe with us. * Required Fields.

Product Name

  

Salutation

Applicant Name *

 

Email Address *

Phone Number *

 

Organization Name *

Department *

 

Requested quantity *

Country or Region *

      

Remarks

Bulk Inquiry

Inquiry Information

Product Name:
MicroRNA Agomir Negative Control
Cat. No.:
HY-R04602A
Quantity:
MCE Japan Authorized Agent:

Customer Review

Thank You for Your Feedback!

Request for HNMR Report

Please fill out this form to request the QC report. We will send it to your Email address shortly.

Your information is safe with us. * Required Fields.

Product Name

  

Lot #

Applicant Name *

 

Email Address *

Phone Number

 

Department *

Organization Name *

 

Country or Region *

Remarks

Request for HNMR Report

We have received your request and will respond to you as soon as possible.