From 11:00 pm to 12:00 pm EST ( 8:00 pm to 9:00 pm PST ) on January 6th, the website will be under maintenance. We are sorry for the inconvenience. Please arrange your schedule properly.
Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
Moloney murine leukemia virus RT is a monomeric reverse transcriptase from Moloney murine leukemia virus (MMLV). Moloney murine leukemia virus RT is a replicative polymerase that play an essential role in the life cycle of the retrovirus .
Maydispenoid A is a potent immunosuppressor. Maydispenoid A can inhibit anti-CD3/anti-CD28 mAbs activated and lipopolysaccharide activated murine splenocyte proliferation .
Maydispenoid B is a potent immunosuppressor. Maydispenoid B can inhibit anti-CD3/anti-CD28 mAbs activated and lipopolysaccharide activated murine splenocyte proliferation .
Antiviral agent 18 (Compound 5) is an anti-infection agent. Antiviral agent 18 results in good antiviral activity against murine norovirus. Antiviral agent 18 has the potential for the research of infectious and malignant diseases .
Conantokin G, a 17-amino-acid peptide, is a potent, selective and competitive antagonist of N-methyl-D-aspartate (NMDA) receptors. Conantokin G inhibits NMDA-evoked currents in murine cortical neurons with an IC50 of 480 nM. Conantokin G has neuroprotective properties .
MI-1481 is a highly potent inhibitor of the Menin-MLL1 interaction with IC50 of 3.6 nM. MI-1481 markedly reduces cell growth of murine bone marrow cells transformed and inhibits leukemia progression .
Conantokin G TFA, a 17-amino-acid peptide, is a potent, selective and competitive antagonist of N-methyl-D-aspartate (NMDA) receptors. Conantokin G TFA inhibits NMDA-evoked currents in murine cortical neurons with an IC50 of 480 nM. Conantokin G TFA has neuroprotective properties .
pFBC ([ 18F]pEBC) is a covalent CLIP-tag radiotracer for detection of viral reporter gene transfer in the murine brain. pFBC can be used in neurobiological research .
Antiviral agent 17 (Compound 4) is an anti-infection agent. Antiviral agent 17 retains its antiviral effect in a human replicon assay (EC50 = 0.015 μM). Antiviral agent 17 results in good antiviral activity against murine norovirus. Antiviral agent 17 has the potential for the research of infectious and malignant diseases .
Enibarcimab is a humanised murine monoclonal immunoglobulin G1 (IgG1) antibody, could be used for acute heart failure, COVID-19 infections and septic shock research .
Enlimomab (BI-RR 0001), a murine IgG2a monoclonal antibody to the human ICAM-1, inhibits leukocyte adhesion to the vascular endothelium, thereby decreasing leukocyte extravasation and inflammatory tissue injury. Enlimomab has anti-inflammatory effects, and can be used for stroke research .
GEM–IB is the conjugate of gemcitabine (GEM)-5'-phosphate with ibandronate (IB). GEM–IB as a single agent or in combination with Docetaxel (DTX) demonstrates reduced tumor burden, preservation of the bone architecture, and improved the survival in a murine model of osteosarcoma (OS) .
IFN alpha-IFNAR-IN-1 hydrochloride is a nonpeptidic, low-molecular-weight inhibitor of the interaction between IFN-α and IFNAR. IFN alpha-IFNAR-IN-1 hydrochloride inhibits modified Vaccinia virus ankara (MVA)-induced IFN-α responses in murine bone-marrow-derived, Flt3- L-differentiated pDC cultures (BM-pDCs) (IC50=2-8 μM) .
JS25 is a selective and covalent inhibitor of BTK that inactivates BTK with an IC50 value of 5.8 nM by chelating Tyr551. JS25 inhibits cancer cells proliferation, pronounces cell death, and promotes murine xenograft model of Burkitt’s lymphoma. JS25 effectively crosses the blood-brain barrier .
2,3,2'',3''-Tetrahydroochnaflavone is a biflavonoid, which can be isolated from the leaves of Quintinia acutifolia. 2,3,2'',3''-Tetrahydroochnaflavone shows some cytotoxicity against P388 murine lymphocytic leukemia cells, with an IC50 of 8.2 µg/mL .
Octacosane is an endogenous metabolite with antibacterial activity. Octacosane shows high cytotoxicity against murine melanoma B16F10-Nex2 cells besides inducing protection against a grafted subcutaneous melanoma. Octacosane has the larvicidal activity against mosquito Culex quinquefasciatus with the LC50 concentration of 7.2 mg/l .
UBX-382 is an orally available proteolysis-targeting chimeras (PROTACs) that target BTK to inactivate B-cell receptor signaling. UBX-382 shows superior degradation activity for wild-type and mutant BTK proteins and shows anti-cancer activity in murine xenograft models of TMD-8 cells .
Reticulol (K 251-1) is an inhibitor of cyclic adenosine 3', 5'-monophosphate phosphodiesterase. Reticulol shows antitumor activity independent with cell cycle arrest or apoptosis. Reticulol inhibits cell growth of murine melanoma cells and human lung tumor cells. Reticulol protects its lung metastasis via the bloodstream by inhibiting the growth of B16F10 melanoma .
Unesbulin (PTC596) is an orally active and selective B-cell-specific Moloney murine leukemia virus integration site 1 (BMI-1) inhibitor. Unesbulin downregulates MCL-1 and induces p53-independent mitochondrial apoptosis in acute myeloid leukemia (AML) cells. Unesbulin has anti-leukemic activity .
Fc 11a-2, a benzimidazole compound, is an orally active and potent NLRP3 inflammasome inhibitor. Fc 11a-2 restrains the formation of NLRP3 inflammasome by inhibiting activation of caspase-1 and thus the activation of IL-1b/IL-18. Fc 11a-2 prevents the development of Dextran sulfate sodium (DSS; HY-116282C)-induced murine experimental colitis .
BAY-7598 is a potent, orally bioavailable, and selective MMP12 inhibitor probe with IC50s of 0.085, 0.67 and 1.1 nM for human MMP12, murine MMP12, and rat MMP12, respectively .
PMEDAP is a potent inhibitor of human immunodeficiency virus (HIV) replication. PMEDAP has anti-murine cytomegalovirus (MCMV) activity. PMEDAP is a very potent inhibitor of Moloney murine sarcoma virus (MSV)-induced tumor formation and associated mortality .
Semzuvolimab is a murine IgG1κ antibody, targeting to p55, T cell surface antigen T4/Leu-3 (CD4). Murine CD4 antibodies can neutralize HIV infection and have the potential to inhibit HAART stable HIV infection .
Pyrindamycin A is an antibiotic that inhibits DNA synthesis. Pyrindamycin A shows antitumor activities against murine leukemia, exhibits stronger cytotoxic activities towards murine and human tumor cell lines and especially towards doxorubicin-resistant cells, inhibits P388 and P388/ADR cells with the same IC50 of 3.9 μg/ml .
Butaprost is a selective prostaglandin E receptor (EP2) agonist with an EC50 of 33 nM and a Ki of 2.4 μM for murine EP2 receptor. Butaprost is less activity against murine EP1, EP3 and EP4 receptors. Butaprost attenuates fibrosis by hampering TGF-β/Smad2 signalling .
11-epi-Chaetomugilin I is a metabolite found in Chaetomium globosum. 11-epi-Chaetomugilin I exhibits significant cytotoxic activity against the murine P388 leukemia cell line, the human HL-60 leukemia cell line, the murine L1210 leukemia cell line, and the human KB epidermoid carcinoma cell line .
Ganitumab (AMG 479) is a recombinant human monoclonal antibody to the human type 1 insulin-like growth factor receptor (IGF1R). Ganitumab recognizes murine IGF1R with sub-nanomolar affinity (KD=0.22 nM) and inhibits the interaction of murine IGF1R with IGF1 and IGF2. Ganitumab can be used in research of cancer .
Cosalane (NSC 658586) is a potent inhibitor of HIV replication. Cosalane has an intrinsic ability to block human and murineCCR7 function in vitro in response to both of its natural ligands, CCL19 and CCL21, with the IC50 of 0.207/2.66 μM in human for CCL19/CCL21 and 0.193/1.98 μM in murine, respectively .
Antibiotic PF 1052 is an antibiotic extracted from a natural product library. Antibiotic PF 1052 has an inhibitory effect on murine neutrophil migration .
GNF6702 is a selective inhibitor of the kinetoplastid proteasome. GNF6702 clears parasites in murine models of leishmaniasis, Chagas disease, and human African trypanosomiasis .
Bz 423 is a pro-apoptotic 1,4-benzodiazepine with therapeutic properties in murine models of lupus demonstrating selectivity for autoreactive lymphocytes, and activates Bax and Bak.
Radioprotectin-1 is a potent and specific nonlipid agonist of lysophosphatidic acid receptor 2 (LPA2), with an EC50 value of 25 nM for murine LPA2 subtype .
Datelliptium chloride hydrochloride is a DNA-intercalating agent derived from Ellipticine (HY-15753). Datelliptium chloride hydrochloride is effective in vivo against a variety of murine solid tumors .
Tositumomab is a murine IgG2a lambda monoclonal antibody directed against the CD20 antigen, which is found on the surface of normal and malignant B lymphocytes .
SJ000025081 is a dihydropyridine and acts as a potent antimalarial agent. SJ000025081 results in an obvious suppression of the parasitemia in a murine malaria model infected with P. yoelii .
NSC23005 sodium is a novel and effective p18 inhibitor (ED50=5.21 nM) in promoting Hematopoietic stem cells (HSCs) expansion in both murine and human models.
Troglitazone-d4 is deuterium labeled Troglitazone. Troglitazone is a PPARγ agonist, with EC50s of 550 nM and 780 nM for human and murine PPARγ receptor, respectively.
Alismol is a natural sesquiterpene. Alismol shows promising inhibitory effects on INF-γ-induced nitric oxide production in murine macrophage RAW264.7 cells .
GSK963 is a chiral, highly potent and selective inhibitor of RIP1 kinase, with an IC50 of 29 nM. GSK963 is a selective and potent inhibitor of necroptosis in murine and human cells in vitro .
Basiliximab (CHI 621) is a recombinant chimeric murine/human IgG1 monoclonal anti-interleukin-2 receptor antibody. Basiliximab can be used for the research of renal transplantation .
ZINC40099027 is a FAK activator. ZINC40099027 promotes FAK phosphorylation, inducing mucosal healing in murine models. ZINC40099027 can be used for Gastroduodenal ulcer disease research .
XR11576 (MLN576) is an orally active inhibitor of topoisomerase I and II. XR11576 shows cytotoxicity against human and murine tumor cell lines (IC50: 6-47 nM) .
sEH inhibitor-1 (compound TCPU ) is a potent and oral active inhibitor of sEH (soluble epoxide hydrolase) with IC50s of 0.4 and 5.3 nM in human and murine, respectively .
Nagilactone C is a diterpene dilactone compound isolated from Podocarpus neriifolius. Nagilactone C has potent antiproliferative activity against human fibrosarcoma and murine colon carcinoma tumor cell lines .
Troglitazone is an orally active PPARγ agonist, with EC50s of 550 nM and 780 nM for human and murine PPARγ receptor, respectively. Troglitazone has anticancer activity, prevents and inhibits the development of type 2 diabetes.
L-168049 is a potent, selective, orally active and non-competitive glucagon receptor antagonist with IC50s of 3.7 nM, 63 nM, and 60 nM for human, murine, and canine glucagon receptors, respectively .
PKCδ Peptide Substrate is an absolutely specific substrate for the δ-type of PKC, with a sequence corresponding to sequence 422-443 of murine eEF-1α and containing Thr-431 .
AMPR-22 is an antimicrobial peptide. AMPR-22 can bind to the bacterial membrane and induces membrane permeabilization. AMPR-22 is effective against murine model of sepsis induced by MDR strains
Cenerimod (ACT-334441) is a potent, selective and orally active S1P1 receptor modulator, with an EC50 of 1 nM. Cenerimod shows more than 36 fold selctivity for hS1P1 over hS1P2, hS1P3, hS1P4, and hS1P5 receptor subtypes (EC50s=>10000, 228, 2134, and 36 nM, respectively). Cenerimod can attenuate murine experimental autoimmune encephalomyelitis (EAE) and murine sclerodermatous .
Valecobulin (CKD516) is a valine proagent of (S516) and a vascular disrupting agent (VDA). Valecobulin is a potent β-tubulin polymerization inhibitor with marked antitumor activity against murine and human solid tumors .
P-2281 is a mTOR inhibitor with anticancer and anti-inflammatory efficacies. P-2281 suppresses dextran sulfate sodium (DSS)-induced colitis by inhibiting T cell function and is efficacious in a murine model of human colitis .
COG1410 is an apolipoprotein E-derived peptide and an apoptosis inhibitor. COG1410 exerts neuroprotective and antiinflammatory effects in a murine model of traumatic brain injury (TBI). COG1410 can be used for the research of neurological disease .
Begelomab (SAND-26) is a murine IgG2b monoclonal antibody against DPP-4/CD26. Begelomab can be used for the research of severe refractory idiopathic inflammatory myopathy .
Abl Cytosolic Substrate is a substrate for Abelson tyrosine kinase (Abl ). Abl Protein Tyrosine Kinase (AbI) is a truncated form of the v-AbI Protein Tyrosine Kinase, a partner in the Gag-Abl fusion protein of the Abelson murine leukemia virus .
Benzyl isothiocyanate is a member of natural isothiocyanates with antimicrobial activity . Benzyl isothiocyanate potent inhibits cell mobility, migration and invasion nature and matrix metalloproteinase-2 (MMP-2) activity of murine melanoma cells .
PGP-4008 is a specific P-glycoprotein (Pgp) inhibitor. PGP-4008 inhibits tumor growth in a murine syngeneic Pgp-mediated multiple agent resistance (MDR) solid tumor model when given in combination with Doxorubicin .
Antitubercular agent-30 is an antibacterial agent against Mycobacterium tuberculosis (MIC=50 μg/mL). Antitubercular agent-30 has little cytotoxic effect on murine macrophage cells (LD85=~100 μg/mL) .
MSU-43085 is an orally active MmpL3 inhibitor of Mycobacterium tuberculosis (Mtb). MSU-43085 effectively inhibits Mtb in an acute murine tuberculosis infection model. MSU-43085 can be used in tuberculosis research .
TCPOBOP is a constitutive androstane receptor (CAR) agonist that induces robust hepatocyte proliferation and hepatomegaly without any liver injury or tissue loss . TCPOBOP attenuates Fas-induced murine liver injury by altering Bcl-2 proteins .
(Rac)-Myrislignan is the racemate of Myrislignan. Myrislignan, a lignan isolated from Myristica fragrans Houtt, possesses anti-inflammatory activities. Myrislignan attenuates LPS-induced inflammation reaction in murine macrophage cells through inhibition of NF-kB signalling pathway activation .
Lenaldekar (LDK) inhibits human and murine T-cell expansiomn. Lenaldekar inhibits autoimmune T cell response. Lenaldekar also induces cancer cell apoptosis. Lenaldekar can be used for T-cell mediated autoimmune diseases research .
Clofibrate-d4 is the deuterium labeled Clofibrate. Clofibrate is an agonist of PPAR, with EC50s of 50 μM, ∼500 μM for murine PPARα and PPARγ, and 55 μM, ∼500 μM for human PPARα and PPARγ, respectively.
Valecobulin hydrochloride (CKD-516 hydrochloride) is a valine proagent of S516 (HY-130233) and a vascular disrupting agent (VDA). Valecobulin hydrochloride is a potent β-tubulin polymerization inhibitor with marked antitumor activity against murine and human solid tumors .
Mtb-IN-3 (compound 10c) is an inhibitor of Mycobacterium tuberculosis (Mtb). Mtb-IN-3 shows selective, potent in vitro antimycobacterial activity without cytotoxicity. Mtb-IN-3 inhibits colony-forming in spleen in the murine tuberculosis model .
Voriconazole (UK-109496) is a second-generation, broad-spectrum triazole antifungal agent that inhibits fungal ergosterol biosynthesis. Voriconazole exerts its antifungal activity by inhibition of 14-α-lanosterol demethylation, which is mediated by fungal cytochrome P450 enzymes .
Flunixin meglumine is a cyclooxygenase (COX) inhibitor with IC50 values of 0.55 and 3.24 μM for COX-1 and COX-2, respectively. Flunixin meglumine shows anti-inflammatory effects .
N-Acetyl-D-cysteine has antioxidant activities and scavenges ROS through the reaction with its thiol group, but cannot enter the glutathione metabolic pathway .
N-Acetyltyramine is a quorum-sensing inhibitor (QSI) compound produced by V. alginolyticus M3-10. N-Acetyltyramine is capable of inhibiting the QS of C. violaceum ATCC 12472. N-acetyltyramine reverses resistance in Doxorubicin-resistant leukemia P388 cells .
Voriconazole (UK-109496) camphorsulfonate is a second-generation, broad-spectrum triazole antifungal agent that inhibits fungal ergosterol biosynthesis. Voriconazole camphorsulfonate exerts its antifungal activity by inhibition of 14-α-lanosterol demethylation, which is mediated by fungal cytochrome P450 enzymes .
FGFR1 inhibitor-11 (compound 5g) binds to FGFR1, inactivation of its downstream ERK1/2 and IκBα/NF-κB signaling inhibited RANKL-induced osteoclastogenesis. FGFR1 inhibitor-11 has oral bioactivity .
ML390 is a potent dihydroorotate dehydrogenase (DHODH) inhibitor. ML390 is an inducer of myeloid differentiation and causes myeloid differentiation in murine (ER-HoxA9) and human (U937 and THP1) acute myeloid leukemia (AML) models .
TM-N1324 is an agonist of G-Protein-Coupled Receptor 39 (GPR39) with EC50s of 9 nM/5 nM in the presence of Zn 2+, and 280 nM/180 nM in the absence of Zn 2+ for human/murine GPR39.
RBC10 is an anti-cancer agent. RBC10 inhibits the binding of Ral to its effector RALBP1. RBC10 also inhibits Ral-mediated cell spreading of murine embryonic fibroblasts and anchorage-independent growth of human cancer cell lines .
RBC6 is an inhibitor of GTPases RalA. RBC6 inhibits binding of Ral to its effector RALBP1. RBC6 also inhibits Ral-mediated cell spreading of murine embryonic fibroblasts, as well as anchorage-independent growth of human cancer celllines .
Aldoxorubicin (INNO-206) is an albumin-binding proagent of Doxorubicin (DNA topoisomerase II inhibitor), which is released from albumin under acidic conditions. Aldoxorubicin (INNO-206) has potent antitumor activities in various cancer cell lines and in murine tumor models.
GSK-3484862 is a non-covalent inhibitor for DNA methyltransferase (Dnmt1). GSK-3484862 induces DNA hypomethylation to against cancer. GSK-3484862 mediates dramatic demethylation in murine embryonic stem cells with minimal non-specific toxicity .
MPP hydrochloride is a potent and selective ER (estrogen receptor) modulator. MPP hydrochloride induces significant apoptosis in the endometrial cancer and oLE cell lines. MPP hydrochloride reverses the the positive effects of beta-estradiol. MPP hydrochloride has mixed agonist/antagonist action on murine uterine ERalphain vivo .
Aldoxorubicin (INNO-206) hydrochloride is an albumin-binding proagent of Doxorubicin (DNA topoisomerase II inhibitor), which is released from albumin under acidic conditions. Aldoxorubicin hydrochloride (INNO-206) has potent antitumor activities in various cancer cell lines and in murine tumor models.
Acetomycin is an antibiotic. Acetomycin inhibits the growth of CT-8 human colon adenocarcinoma cells (IC50: 1.5 μg/mL) and L1210 murine leukemia cells (IC50: 2.2 μg/mL). Acetomycin can be isolated from actinomycete WP-2661 .
Tussilagone, a major active component in Tussilago farfara, has anti-inflammatory effect. Tussilagone ameliorates inflammatory responses in dextran sulphate sodium-induced murine colitis. Tussilagone inhibits the inflammatory response and improves survival in cecal ligation and puncture (CLP)-induced septic mice .
Denopamine ((R)-(-)-Denopamine) is an orally active, selective β1-adrenergic agonist. Denopamine prolongs survival in a murine model of congestive heart failure induced by viral myocarditis: suppression of tumor necrosis factor-α production in the heart. Cardiovascular effects .
1-Dehydroxy-23-deoxojessic acid (compound 10) is a cycloartane-type triterpene. 1-Dehydroxy-23-deoxojessic acid exhibits cytotoxicity against murine colon 26-L5 carcinoma cells, with an EC50 of 62.38 μM .
Methyl everninate is the major constituent of the deuterochloroform. Methyl everninate, rhodomollosides A and B are the derivatives of Methyl everninate, with cytotoxicity against RAW264.7 cells. Both of they shows inhibitory effects with a lipopolysaccharide (LPS)-stimulated murine macrophages RAW 264.7 cells model .
Clofibrate (Standard) is the analytical standard of Clofibrate. This product is intended for research and analytical applications. Clofibrate is an agonist of PPAR, with EC50s of 50 μM, ～500 μM for murine PPARα and PPARγ, and 55 μM, ～500 μM for human PPARα and PPARγ, respectively.
Antibacterial agent 179 (Compound 23) is a potent antibacterial agent, which effectively kills both Gram-negative and Gram-positive bacteria. Antibacterial agent 179 shows potent in vivo antibacterial efficacy in murine corneal infection models caused by Staphylococcus aureus or Pseudomonas aeruginosa .
Pirinixic acid (Wy-14643) is a potent agonist of PPARα, with EC50s of 0.63 μM, 32 μM for murinePPARα and PPARγ, and 5.0 μM, 60 μM, 35 μM for human PPARα, PPARγ and PPARδ, respectively.
WYC-209, a synthetic retinoid, is a retinoic acid receptor (RAR) agonist. WYC-209 induces apoptosis primarily via the caspase 3 pathway (IC50=0.19 μM for inmalignant murine melanoma TRCs), and has long-term effects with little toxicity .
MPP dihydrochloride is a potent and selective ER (estrogen receptor) modulator. MPP dihydrochloride induces significant apoptosis in the endometrial cancer and oLE cell lines. MPP dihydrochloride reverses the positive effects of beta-estradiol. MPP dihydrochloride has mixed agonist/antagonist action on murine uterine ERalphain vivo .
Pociredir (FTX-6058) hydrochloride is a potent and orally active inhibitor of Embryonic Ectoderm Development (EED). Pociredir hydrochloride can induce HbF protein expression in cell and murine models. Pociredir hydrochloride can be used for the research of select hemoglobinopathies, including sickle cell disease and β-thalassemia .
Pociredir (FTX-6058) is a potent and orally active inhibitor of Embryonic Ectoderm Development (EED). Pociredir can induce HbF protein expression in cell and murine models. Pociredir can be used for the research of select hemoglobinopathies, including sickle cell disease and β-thalassemia .
IACS-8779 disodium is a highly potent stimulator of interferon genes (STING) agonist with robust systemic antitumor efficacy. IACS-8779 disodium shows robust activation of the STING pathway in vitro and a superior systemic anti-tumor response in the B16 murine model of melanoma .
Bezafibrate is an agonist of PPAR, with EC50s of 50 μM, 60 μM, 20 μM for human PPARα, PPARγ and PPARδ, and 90 μM, 55 μM, 110 μM for murine PPARα, PPARγ and PPARδ, respectively; Bezafibrate is used as an hypolipidemic agent.
Plecanatide, an analogue of Uroguanylin, is an orally active guanylate cyclase-C (GC-C) receptor agonist. Plecanatide activates GC-C receptors to stimulate cGMP synthesis with an EC50 of 190 nM in T84 cells assay. Plecanatide shows anti-inflammatory activity in models of murine colitis .
Neplanocin A ((-)-Neplanocin A) is an antitumor antibiotic with significant antitumor activity against murine L1210 leukemia. Neplanocin A is also an irreversible inhibitor of AdoHcy hydrolase (Ki=8.39 nM). Neplanocin A also has antiviral activity and is effective against vaccinia virus. Neplanocin A is obtained from Ampulariella regularis .
Cynaropicrin is a sesquiterpene lactone which can inhibit tumor necrosis factor (TNF-α) release with IC50s of 8.24 and 3.18 μM for murine and human macrophage cells, respectively. Cynaropicrin also inhibits the increase of cartilage degradation factor (MMP13) and suppresses NF-κB signaling.
BI 6901 is a potent, selective CCR10 antagonist (pIC50=9.0). BI 6901 shows high selectivity over other GPCRs, including a number of other chemokine receptors. BI 6901 is efficacious in the murine DNFB model of contact hypersensitivity and can be used for inflammation research .
UT-11 is a potent and brain-permeable microsomal prostaglandin E synthase-1 (mPGES-1) inhibitor with IC50s of 0.10 μM and 2.00 μM for inhibiting PGE2 production in human (SK-N-AS) and murine (BV2) cells, respectively .
NSI-189, benzylpiperizine-aminiopyridine, is a multi-domain neurogenic compound with brain-therapeutic properties. NSI-189 can stimulate neurogenesis of human hippocampus-derived neural stem cells in vitro and stimulates neurogenesis in murine hippocampus in vivo. NSI-189 can be used for the research of psychiatric disorders .
GW 1929 is an orally active peroxisome proliferator-activated receptor-γ (PPARγ) agonist with a pKi of 8.84 for human PPAR-γ, and pEC50s of 8.56 and 8.27 for human PPAR-γ and murinePPAR-γ, respectively. GW 1929 (hydrochloride) has antidiabetic efficacy and neuroprotective potential .
Benzyl isothiocyanate-d7 is the deuterium labeled Benzyl isothiocyanate. Benzyl isothiocyanate is a member of natural isothiocyanates with antimicrobial activity[1][2]. Benzyl isothiocyanate potent inhibits cell mobility, migration and invasion nature and matrix metalloproteinase-2 (MMP-2) activity of murine melanoma cells[2].
Dehydroevodiamine is a major bioactive quinazoline alkaloid isolated from Evodiae Fructus, has an antiarrhythmic effect in guinea-pig ventricular myocytes . Dehydroevodiamine inhibits LPS-induced iNOS, COX-2, prostaglandin E2 (PGE2) and nuclear factor-kappa B (NF-κB) expression in murine macrophage cells .
Antifungal agent 31 (compound 12) is a potent and orally active triazole antifungal agents with a pyrrolotriazinone scaffold. Antifungal agent 31 shows antifungal activity against Candida spp. and filamentous fungi. Antifungal agent 31 significantly reduced mortality rates and kidney fungal burden in two murine models of lethal systemic infections .
Dafsolimab (SPV-T3a) is an IgG2a murine monoclonal antibody (anti-CD3). Dafsolimab can induce cell death through modulation and activation of the CD3/T cell receptor complex. Dafsolimab can be used for the research of graft-versus-host disease (GVHD) .
GPR139 agonist-2 (compound 20a) is a potent GPR139 agonist with an EC50 of 24.7 nM. GPR139 agonist-2 rescues the social interaction deficits and alleviates cognitive deficits in murine schizophrenia models. GPR139 agonist-2 has the potential for antischizophrenia drug research .
ORN 06 (Compound R-0006), a U-rich single-stranded RNA (containing 6 repeats of the UUG sequence motif), is a TLR7/8 agonist. ORN 06 stimulates human TLR7/8-mediated or murineTLR7-mediated immunity .
Vadimezan (DMXAA; ASA-404), the tumor vascular disrupting agent (tumor-VDA), is a murine agonist of the stimulator of interferon genes (STING) and also a potent inducer of type I IFNs and other cytokines. Vadimezan has anti-influenza virus H1N1-PR8 activities.
AR9281 (APAU) is a potent, selective and orally active soluble epoxide hydrolase (s-EH) inhibitor. AR-9281 can inhibits human sEH (HsEH) and murine sEH (MsEH) with IC50 values of 13.8 nM and 1.7 nM, respectively. AR9281 can be used for the research of inflammation, hypertension and type 2 diabetes .
β-D-glucan is a natural non-digestible polysaccharide and high biocompatibility that can be selectively recognized by recognition receptors such as Dectin-1 and Toll-like receptors as well as being easily internalized by murine or human macrophages, which is likely to attribute to a target delivery . β-d-glucan is an enteric delivery vehicle for probiotics .
1,7-Bis(4-hydroxyphenyl)-3-hydroxy-1,3-heptadien-5-one (compound 39), a diarylheptanoid, exhibits antiproliferative activity towards human HT-1080 fibrosarcoma and murine colon 26-L5 carcinoma cells .
Biotin-COG1410 TFA is a biotin labled COG1410 (HY-P2136). COG1410 is an apolipoprotein E-derived peptide and an apoptosis inhibitor. COG1410 exerts neuroprotective and antiinflammatory effects in a murine model of traumatic brain injury (TBI). COG1410 can be used for the research of neurological disease .
JI130 (JI051 derivative?) is a stabilizer for the?Hes1-PHB2?interaction. JI130 inhibits?the ability of Hes1 to repress transcription. JI130?significantly reduces the tumor growth in a murine pancreatic tumor model and has the potential for ?managing pancreatic cancer .
RIPK1-IN-20 (compound 13c) has a favorable RIPK1 kinase inhibition activity with an IC50 value of 59.8 nM. RIPK1-IN-20 blocks TNFα-induced necroptosis in both human and murine cells (EC50=1.06–4.58 nM) .
sEH/HDAC6-IN-1 (compound M9) is a selective, orally active dual inhibitor for sEH and HDAC6, with IC50s of 2 nM, 0.72 nM and 5 nM, for human sEH, murine sEH and HDAC6, respectively. sEH/HDAC6-IN-1 reveals analgesic and anti-inflammatory effects .
GSK2256294A (GSK 2256294) is a selective and orally active inhibitor of soluble epoxide hydrolase (sEH). GSK2256294A inhibits recombinant human sEH, rat sEH orthologs and murine sEH orthologs with IC50s of 27, 61 and 189 pM, respectively. GSK2256294A can be used for the research of chronic obstructive pulmonary disease (COPD) and cardiovascular disease .
Bezafibrate-d6 is the deuterium labeled Bezafibrate. Bezafibrate is an agonist of PPAR, with EC50s of 50 μM, 60 μM, 20 μM for human PPARα, PPARγ and PPARδ, and 90 μM, 55 μM, 110 μM for murine PPARα, PPARγ and PPARδ, respectively; Bezafibrate is used as an hypolipidemic agent.
Plecanatide acetate, an analogue of Uroguanylin, is an orally active guanylate cyclase-C (GC-C) receptor agonist. Plecanatide acetate activates GC-C receptors to stimulate cGMP synthesis with an EC50 of 190 nM in T84 cells assay. Plecanatide acetate can be used for the research of chronic idiopathic constipation, and it also shows anti-inflammatory activity in models of murine colitis .
Freselestat (ONO-6818) is a potent and orally active neutrophil elastase inhibitor with a Ki of 12.2 nM. Freselestat is >100-fold less-active against other proteases such as trypsin, protein-ase 3, pancreatic elastase, plasmin, thrombin, collagenase, cathepsin G, and murine macrophage elastase. Freselestat has a potent anti-inflammatory activity .
Bezafibrate-d4 is deuterium labeled Bezafibrate. Bezafibrate is an agonist of PPAR, with EC50s of 50 μM, 60 μM, 20 μM for human PPARα, PPARγ and PPARδ, and 90 μM, 55 μM, 110 μM for murine PPARα, PPARγ and PPARδ, respectively; Bezafibrate is used as an hypolipidemic agent.
RO5461111 a highly specific and orally active antagonist of Cathepsin S with IC50s of 0.4 nM (human Cathepsin S) and 0.5 nM (murineCathepsin S), respectively. RO5461111 can effectively inhibit the activation of antigen-specific T cells and B cells. RO5461111 can improve pulmonary inflammation and lupus nephritis .
CB2 PET Radioligand 1 (compound [18F]9) is a PET Radioligand targeting to hCB2 (Ki=7.7 nM). CB2 PET Radioligand 1 is prepared with Cu-mediated 18F-fluorination. CB2 PET Radioligand 1 shows high brain uptake in a murine model of neuroinflammation .
Bis-5,5-Nortrachelogenin is isolated from active extract of root of Wikstroemia indica. Bis-5,5-Nortrachelogenin inhibits nitric oxide (NO) production in a lipopolysaccharide (LPS) and recombinant mouse interferon-γ(IFN-γ) activated murine macrophage-like cell line, RAW 264.7 with an IC50 value of 48.6 mM .
Lynronne-1 is an antimicrobial peptide. Lynronne-1 is active against Gram-positive bacterials, including MDR strains (MIC: 8-32 μg/mL for methicillin-resistant MRSA strains). Lynronne-1 reduces the bacterial load in MRSA infected wound murine model. Lynronne-1 is also effective against P. aeruginosa infection .
ssRNA42 (sodium) is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. ssRNA42 (sodium) derives from ssRNA40 by replacement of all G nucleotides with adenosine. ssRNA42 activated human PBMCs to secrete IFN-α, TNF-a, IL- 12p40, and IL-6, but ssRNA42 failed to stimulated murine pDCs and PBMCs.
Mycalolide-B is a specific inhibitor of actomyosin ATPase isolated from marine sponge. Mycalolide-B inhibits ATP-induced contraction and Mg 2+-ATPase activity in the absence of Ca 2+ .
Desoxo-narchinol A is an orally active and potent anti-inflammatory agent. Desoxo-narchinol A can be isolated from the roots and rhizomes of Nardostachys jatamansi. Desoxo-narchinol A can be used for septic shock and inflammatory diseases research .
ODN 1826 sodium is a class B CpG ODN (oligodeoxynucleotide) that is a TLR9 agonist. ODN 1826 sodium is an immunostimulatory agent that induces NO and iNOS production in mouse models. ODN 1826 sodium also enhances apoptosis (apoptosis) and may promote atherosclerosis. ODN 1826 sequence: 5’-tccatgacgttcctgacgtt-3’ .
2-Iminobiotin (Guanidinobiotin) is a biotin (vitamin H or B7) analog. 2-Iminobiotin is a reversible nitric oxide synthases inhibitor with Kis of 21.8 and 37.5μM for murineiNOS and rat n-cNOS, respectively . 2-Iminobiotin superimposes on hypothermia protects human neuronal cells from hypoxia-induced cell damage .
Mtb-IN-2 (compound 10c) is an antimicrobial agent against Mycobacterium tuberculosis (Mtb), without cytotoxicity. Mtb-IN-2 significantly decreases colony-forming units (CFU) in spleen of murine tuberculosis models, and distinguishes both drug-sensitive and drug-resistant Mtb H37Rv strains. Mtb-IN-2 affects methionine metabolism but not folate pathway directly.
Jacaric acid is a conjugated linolenic acid, which inhibits viability in cells PC-3 (IC50 is 11.8 μM), LNCaP (IC50 is 2.2 μM) and DLD-1, induces apoptosis and necrosis . Jacaric acid exhibits anticaner activity against prostate cancer and adenocarcinoma . Jacaric acid exhibits immunomodulating activity in murine peritoneal macrophages as an immunopotentiator . Jacaric acid is orally active.
Remdesivir-d5 is a deuterium labeled Remdesivir. Remdesivir (GS-5734) is a nucleoside analogue, with effective antiviral activity, with EC50s of 74 nM for SARS-CoV and MERS-CoV in HAE cells, and 30 nM for murine hepatitis virus in delayed brain tumor cells. Remdesivir is highly effective in the control of 2019-nCoV (COVID-19) infection in vitro[1][2].
AN3661, a potent antimalarial lead compound, targets a Plasmodium falciparum cleavage and polyadenylation specificity factor homologue subunit 3 (PfCPSF3). AN3661 inhibits Plasmodium falciparum laboratory-adapted strains (mean IC50=32 nM), Ugandan field isolates (mean ex vivo IC50=64 nM), and murineP. berghei and P. falciparum infections .
BLI-489 hydrate, a penem β-lactamase inhibitor, is active against class A and class C as well as some class D β-lactamases. The combination of Piperacillin and BLI-489 hydrate is efficacious against murine infections caused by class A (including extended-spectrum β-lactamases), class C (AmpC), and class D β-lactamase-expressing pathogens .
Freselestat quarterhydrate (ONO-6818 quarterhydrate) is a potent and orally active neutrophil elastase inhibitor with a Ki of 12.2 nM. Freselestat quarterhydrate is >100-fold less-active against other proteases such as trypsin, protein-ase 3, pancreatic elastase, plasmin, thrombin, collagenase, cathepsin G, and murine macrophage elastase. Freselestat quarterhydrate has a potent anti-inflammatory activity .
Remdesivir de(ethylbutyl 2-aminopropanoate) is an impurity of Remdesivir. Remdesivir, a nucleoside analogue with effective antiviral activity, has EC50s of 74 nM for SARS-CoV and MERS-CoV in HAE cells, and 30 nM for murine hepatitis virus in delayed brain tumor cells. Remdesivir is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro .
(Z)-FeCP-oxindole is a selective human vascular endothelial growth factor receptor 2 (VEGFR2) inhibitor with an IC50 value of 200 nM. (Z)-FeCP-oxindole can significantly inhibit VEGFR1 and PDGFRa or b at 10 μM. (Z)-FeCP-oxindole has some anticancer activity, acting on B16 murine melanoma lines with IC50 less than 1 μM .
CP-195543 is a potent, selective and orally active leukotriene B4 (LTB4) receptor antagonist with IC50s of 6.8, 37.0 nM for human neutrophils and murine spleen membranes, respectively. CP-195543 blocks CD11b up-regulation. CP-195543 inhibits LTB4-mediated neutrophil infiltration .
(Z)-FeCP-oxindole is a selective human vascular endothelial growth factor receptor 2 (VEGFR2) inhibitor with an IC50 value of 200 nM. (Z)-FeCP-oxindole can significantly inhibit VEGFR1 and PDGFRa or b at 10 μM. (Z)-FeCP-oxindole has some anticancer activity, acting on B16 murine melanoma lines with IC50 less than 1 μM .
(Rac)-GSK-3484862 is the isomer of GSK-3484862 (HY-135146), and can be used as an experimental control. GSK-3484862 is a non-covalent inhibitor for DNA methyltransferase (Dnmt1). GSK-3484862 induces DNA hypomethylation to against cancer. GSK-3484862 mediates dramatic demethylation in murine embryonic stem cells with minimal non-specific toxicity .
ar-Turmerone ((+)-ar-Turmerone) is a major bioactive compound of the herb Curcuma longa with anti-tumorigenesis and anti-inflammatory activities . ar-Turmerone activates apoptotic protein in human lymphoma U937 cells . ar-Turmerone exerts positive modulation on murine DCs. ar-Turmerone induces NSC proliferation and constitutes a promising therapeutic agent for various neurologic disorders .
BYK204165 is a potent and selective PARP1 inhibitor. BYK204165 inhibits cell-free recombinant human PARP-1 (hPARP-1) with a pIC50 of 7.35 (pKi=7.05), and murine PARP-2 (mPARP-2) with a pIC50 of 5.38, respectively. BYK204165 displays 100-fold selectivity for PARP-1 .
2-Iminobiotin hydrobromide (Guanidinobiotin hydrobromide) is a biotin (vitamin H or B7) analog. 2-Iminobiotin hydrobromide is a reversible nitric oxide synthases inhibitor with Kis of 21.8 and 37.5 μM for murineiNOS and rat n-cNOS, respectively . 2-Iminobiotin hydrobromide superimposes on hypothermia protects human neuronal cells from hypoxia-induced cell damage .
APC-6860 is a trypsin-like serine proteases inhibitor with ki values of 0.21 and 0.44 μM for uPA and trypsin, respectively. APC-6860 has a selectivity ratio for tPA versus uPA of 80. APC-6860 has ki values of 0.1 and 0.082 μM for human and murine urokinases, respectively. APC-6860 can be used for the research of cancer .
Remdesivir-d4 is deuterium labeled Remdesivir. Remdesivir (GS-5734), a nucleoside analogue with effective antiviral activity, has EC50s of 74 nM for SARS-CoV and MERS-CoV in HAE cells, and 30 nM for murine hepatitis virus in delayed brain tumor cells. Remdesivir is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro[1][2].
GW1929 hydrochloride is an orally active peroxisome proliferator-activated receptor-γ (PPARγ) agonist with a pKi of 8.84 for human PPAR-γ, and pEC50s of 8.56 and 8.27 for human PPAR-γ and murinePPAR-γ, respectively. GW1929 hydrochloride has antidiabetic efficacy and neuroprotective potential. GW1929 hydrochloride suppresses neuronal apoptosis and shows anti-inflammatory potential .
Volociximab (M200) is a chimeric human/murine IgG4 antibody IIA1 targeting integrin α5β1 (EC50=0.2 nM). Integrin α5β1 is a major fibronectin receptor involved in angiogenesis. Volociximab has antiangiogenic and antitumor activities and inhibits the proliferation of human umbilical vein vascular endothelial cells (HUVECs) .
Benidipine hydrochloride is an orally active calcium channel antagonist. Benidipine hydrochloride can inhibit cell proliferation and apoptosis. Benidipine hydrochloride has antioxidant activity and can increase nitric oxide synthase activity and improve coronary circulation in hypertensive rats .
Girentuximab (G250) is a chimeric monoclonal antibody that binds carbonic anhydrase IX (CAIX), a cell surface glycoprotein ubiquitously expressed in clear cell renal cell carcinoma (ccRCC) .
SP-100030 is a potent NF-κB and activator protein-1 (AP-1) double inhibitor (IC50s=50 and 50 nM, respectively). SP-100030 inhibits IL-2, IL-8, and TNF-alpha production in Jurkat and other T cell lines. SP-100030 decreases murine collagen-induced arthritis (CIA) .
SC-236 is an orally active COX-2 specific inhibitor (IC50 = 10 nM) and a PPARγ agonist. SC-236 suppresses activator protein-1 (AP-1) through c-Jun NH2-terminal kinase. SC-236 exerts anti-inflammatory effects by suppressing phosphorylation of ERK in a murine model .
GAT564 (Compound 15d) is a potent allosteric modulator of cannabinoid 1 receptor (CB1R) with EC50s of 87 and 320 nM respectively for cAMP and β-arrestin2. GAT564 markedly promotes orthosteric ligand binding to hCB1R. GAT564 is efficacious as a topical agent that significantly reduces intraocular pressure (IOP) in the ocular normotensive murine model of glaucoma .
ABT-510 is an anti-angiogenic TSP peptide (Thrombospondin-1 analogue) that induces apoptosis and inhibits ovarian tumour growth in an orthotopic, syngeneic model of epithelial ovarian cancer. ABT-510 also reduces angiogenesis and inflammatory responses in a murine model of inflammatory bowel disease. ABT-510 can be used in studies of cancer (particularly epithelial ovarian cancer) and inflammatory bowel disease (IBD) .
5-NIdR (1-(β-D-2-Deoxyribofuranosyl)-5-nitroindole), an artificial nucleoside, exhibits the ability to inhibit the replication of DNA lesions generated by Temozolomide (HY-17364). 5-NIdR induces cancer cells apoptosis and arrests cell cycle at G0 phase. 5-NIdR enhances Temozolomide anti-tumor efficacy in murine glioblastoma model .
HSGN-94 is a potent antimicrobial agent with lipoteichoic acid (LTA) biosynthesis inhibition. HSGN-94 inhibits drug-resistant Gram-positive bacteria with MIC values of 0.25-2 μg/mL. HSGN-94 inhibits biofilm formation of MRSA and Vancomycin-resistant Enterococci. HSGN-94 also inhibits pro-inflammatory cytokines, exhibits in vivo efficacy in an MRSA murine wound infection model .
ABT-510 acetate is an anti-angiogenic TSP peptide (Thrombospondin-1 analogue) that induces apoptosis and inhibits ovarian tumour growth in an orthotopic, syngeneic model of epithelial ovarian cancer. ABT-510 acetate also reduces angiogenesis and inflammatory responses in a murine model of inflammatory bowel disease. ABT-510 acetate can be used in studies of cancer (particularly epithelial ovarian cancer) and inflammatory bowel disease (IBD) .
PC-766B is a macrolide antibiotic. PC-766B is active against Gram-positive bacteria, and some fungi and yeasts, but inactive against Gram-negative bacteria. PC-766B shows antitumor activity against murine tumor cells. PC-766B has weak inhibitory activity against Na +, K +-ATPase .
Gnetol is a phenolic compound isolated from the root of Gnetum montanum . Gnetol potently inhibits COX-1 (IC50 of 0.78 μM) and HDAC. Gnetol is a potent tyrosinase inhibitor with an IC50 of 4.5 μM for murine tyrosinase and suppresses melanin biosynthesis. Gnetol has antioxidant, antiproliferative, anticancer and hepatoprotective activity. Gnetol also possesses concentration-dependent α-Amylase, α-glucosidase, and adipogenesis activities .
BIO5192 hydrate is a selective and potent integrin α4β1 (VLA-4) inhibitor (Kd<10 pM). BIO5192 hydrate selectively binds to α4β1 (IC50=1.8 nM) over a range of other integrins. BIO5192 hydrate results in a 30-fold increase in mobilization of murine hematopoietic stem and progenitors (HSPCs) over basal levels .
BIO5192 is a selective and potent integrin α4β1 (VLA-4) inhibitor (Kd<10 pM). BIO5192 selectively binds to α4β1 (IC50=1.8 nM) over a range of other integrins. BIO5192 results in a 30-fold increase in mobilization of murine hematopoietic stem and progenitors (HSPCs) over basal levels .
CDE-096 is a potent inhibitor of PAI-1. CDE-096 prevents PAI-1 from inactivating tPA and uPA with similar potency (IC50=30 and 25 nM, respectively) and is active against glycosylated PAI-1, as well as PAI-1 derived from several species (IC50=19, 22 and 18 nM for murine, rat, and Porcine PAI-1, respectively) .
Remdesivir impurity 9-d4 is deuterium labeled Remdesivir. Remdesivir (GS-5734), a nucleoside analogue with effective antiviral activity, has EC50s of 74 nM for SARS-CoV and MERS-CoV in HAE cells, and 30 nM for murine hepatitis virus in delayed brain tumor cells. Remdesivir is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro[1][2].
Antibacterial agent 107 (compound 14) is a potent antibacterial agent. Antibacterial agent 107 shows potent antibacterial activity against Gram-positive bacteria, with a MIC of 1.56 μg/mL (MRSA). Antibacterial agent 107 exhibits low hemolytic activity, high membrane selectivity, and rapid bactericidal activity. Antibacterial agent 107 shows effective in vivo efficacy in the murine model of bacterial keratitis caused by Staphylococcus aureus ATCC29213 .
Nutlin-3a (Rebemadlin), an active enantiomer of Nutlin-3, is a potent murine double minute (MDM2) inhibitor (IC50=90 nM). Nutlin-3a inhibits MDM2-p53 interactions and stabilizes the p53 protein, and induces cell autophagy and apoptosis. Nutlin-3a has the potential for the study of TP53 wild-type ovarian carcinomas .
SGC-SMARCA-BRDVIII is a potent and selective inhibitor of SMARCA2/4 and PB1(5), with Kds of 35 nM, 36 nM, and 13 nM, respectively. SGC-SMARCA-BRDVIII also inhibits PB1(2) and PB1(3), with Kds of 3.7 and 2.0 μM, respectively. SGC-SMARCA-BRDVIII can block adipogenesis of 3T3-L1 murine fibroblasts .
B355252, a phenoxy thiophene sulfonamide small molecule, is a potent NGF receptor agonist. B355252 potentiates NGF-induced neurite outgrowth. B355252 protects ischemic neurons from neuronal loss by attenuating DNA damage, reducing ROS production and the LDH level, and preventing neuronal apoptosis. B355252 has anti-apoptotic effects in glutamate-induced excitotoxicity, as well as in a murine hippocampal cell line (HT22) model of Parkinson disease (PD) .
Alemtuzumab (Campath-IH) is a humanized monoclonal antibody against CD52. Alemtuzumab does not cross-react with murine CD52. Alemtuzumab selectively targets the CD52 antigen to induce profound lymphocyte depletion, followed by recovery of T and B cells with regulatory phenotypes. Alemtuzumab is capable of complement-dependent cytotoxicity and antibody-dependent cell-mediated cytotoxicity (ADCC), as well as induction of apoptosis. Alemtuzumab has the potential for B-cell chronic lymphocytic leukaemia research .
Octacosane-d58 is the deuterium labeled Octacosane[1]. Octacosane is an endogenous metabolite with antibacterial activity. Octacosane shows high cytotoxicity against murine melanoma B16F10-Nex2 cells besides inducing protection against a grafted subcutaneous melanoma. Octacosane has the larvicidal activity against mosquito Culex quinquefasciatus with the LC50 concentration of 7.2 mg/l[2][3][4].
(Rac)-Nutlin-3 (Rebemadlin), an active enantiomer of Nutlin-3, is a potent murine double minute (MDM2) inhibitor (IC50=90 nM). (Rac)-Nutlin-3 inhibits MDM2-p53 interactions and stabilizes the p53 protein, and induces cell autophagy and apoptosis. (Rac)-Nutlin-3 has the potential for the study of TP53 wild-type ovarian carcinomas .
CaⅡ-EDTA disodium dihydrate (Calcium disodium EDTA dihydrate) is an orally active metal chelating reagent, exhibits bactericidal activities against periodontal pathogens Aggregatibacter actinomycetemcomitans, Prevotella intermedia and Porphyromonas gingivalis . CaⅡ-EDTA disodium dihydrate is effective chelating antidotes for lead- and cadmium poisoning .
ar-Turmerone-d3 is the deuterium labeled ar-Turmerone. ar-Turmerone ((+)-ar-Turmerone) is a major bioactive compound of the herb Curcuma longa with anti-tumorigenesis and anti-inflammatory activities[1][2][3]. ar-Turmerone activates apoptotic protein in human lymphoma U937 cells[3]. ar-Turmerone exerts positive modulation on murine DCs. ar-Turmerone induces NSC proliferation and constitutes a promising therapeutic agent for various neurologic disorders[4][5].
(±)-ML 209 (compound 4n), a diphenylpropanamide, is a retinoic acid-related orphan receptor RORγ antagonist with an IC50 of 1.1 μM. (±)-ML 209 inhibits RORγt transcriptional activity with an IC50 of 300 nM in HEK293t cells. (±)-ML 209 inhibits the transcriptional activity of RORγt, but not RORα in cells. (±)-ML 209 selectively inhibits murine Th17 cell differentiation without affecting the differentiation of naïve CD4 + T cells into other lineages, including Th1 and regulatory T cells .
MDM2/XIAP-IN-2 is a dual inhibitor of murine double minute 2 (MDM2) and X-linked inhibitor of apoptosis protein (XIAP). MDM2/XIAP-IN-2 degrades MDM2, and inhibits XIAP mRNA translation to inhibits cancer cells. Particularly, MDM2/XIAP-IN-2 inhibits acute lymphoblastic leukemia cell line EU-1 with an IC50 value of 0.3 μM .
Temafloxacin (TMFX) is an orally active quinolone broad-spectrum antibacterial agent. Temafloxacin is well tolerated in lower respiratory and genitourinary tract infections .
Temafloxacin (TMFX) hydrochloride is an orally active quinolone broad-spectrum antibacterial agent. Temafloxacin hydrochloride is well tolerated in lower respiratory and genitourinary tract infections .
Antifungal agent 41 (compound B01) is an antifungal agent. Antifungal agent 41 shows inhibitory effect on Candida albicans in virto and vivo. Antifungal agent 41 can be used for the research of invasive fungal infections .
Edatrexate (CGP 30694), as known as 10-Ethyl-10-deazaaminopterin, is Methotrexate (HY-14519) analog, exhibits antitumor activity against MTX-resistant tumors. Edatrexate is an antifolate antimetabolite, can be used for reasearch of non-small-cell lung cancer, breast cancer, non-Hodgkin's lymphoma, and cancer of the head and neck .
20(R)-Ginsenoside Rh2, a matrix metalloproteinase (MMP) inhibitor, acts as a cell antiproliferator. It has anticancer effects via blocking cell proliferation and causing G1 phase arrest. 20(R)-Ginsenoside Rh2 induces apoptosis, and has anti-inflammatory and antioxidative activity . 20(R)-Ginsenoside Rh2 inhibits the replication and proliferation of mouse and human gammaherpesvirus 68 (MHV-68) with an IC50 of 2.77 μM for murine MHV-68 .
SX-517 is a dual CXCR2/1 antagonist, containing boronic acid. SX-517 inhibits CXCL1-induced Ca 2+ flux (IC50=38 nM), and antagonizes CXCL8-induced [(35)S]GTPγS binding (IC50=60 nM) and ERK1/2 phosphorylation. SX-517 has significant ability for inflammation suppression, in both humanized polymorphonuclear (PMN) cells and in murine model .
HDAC-IN-53 is an orally active, and selective HDAC1-3 inhibitor with IC50 values of 47 nM, 125 nM, and 450 nM, respectively. HDAC-IN-53 does not inhibit class II HDACs (HDAC4, 5, 6, 7, 9; IC50>10 μM). HDAC-IN-53 induces caspase-dependent apoptosis. HDAC-IN-53 significantly inhibits the growth of human tumor xenografts in nude mice and murine tumor growth in immune-competent mice bearing MC38 colon cancer .
Y-27632 is an orally active, ATP-competitive inhibitor of ROCK-I and ROCK-II, with Kis of 220 and 300 nM, respectively. Y-27632 attenuates Doxorubicin-induced apoptosis of human cardiac stem cells. Y-27632 also suppresses dissociation-induced apoptosis of murine prostate stem/progenitor cells. Y-27632 primes human induced pluripotent stem cells (hIPSCs) to selectively differentiate towards mesendodermal lineage via epithelial-mesenchymal transition-like modulation .
Cl-amidine hydrochloride is an orally active peptidylarginine deminase (PAD) inhibitor, with IC50 values of 0.8 μM, 6.2 μM and 5.9 μM for PAD1, PAD3, and PAD4, respectively. Cl-amidine hydrochloride induces apoptosis in cancer cells. Cl-amidine hydrochloride induces microRNA (miR)-16 (miRNA-16, microRNA-16) expression and causes cell cycle arrest. Cl-Amidine hydrochloride prevents histone 3 citrullination and neutrophil extracellular trap formation, and improves survival in a murine sepsis model .
Cl-amidine is an orally active peptidylarginine deminase (PAD) inhibitor, with IC50 values of 0.8 μM, 6.2 μM and 5.9 μM for PAD1, PAD3, and PAD4, respectively. Cl-amidine induces apoptosis in cancer cells. Cl-amidine induces microRNA (miR)-16 (miRNA-16, microRNA-16) expression and causes cell cycle arrest. Cl-Amidine prevents histone 3 citrullination and neutrophil extracellular trap formation, and improves survival in a murine sepsis model .
JMI-105 is a potent PfFP-2 (Plasmodium falciparum falcipain-2 protease) inhibitor. JMI-105 inhibits the growth of CQ S (3D7; IC50=8.8 µM) and CQ R (RKL-9; IC50=14.3 µM) strains of P. falciparum. JMI-105 significantly decreases parasitemia and prolonged host survival in a murine model with P. berghei ANKA infection. JMI-105 has the potential to be used as an anti-malarial agent .
11β-HSD1-IN-9 (compound c4a) is a potent 11β-HSD1 inhibitor with IC50 values of 0.48 and 1.3 µM for human and murine11β-HSD1, respectively. 11β-HSD1-IN-9 competitively interacts with rat 11β-HSD1. 11β-HSD1-IN-19 can be used in studies of obesity, hyperglycemia and cognitive impairment .
SMU-L11 is a specific TLR7 agonist (EC50=0.024 μM), which recruits MyD88 adapter protein and activates downstream NF-κB and MAPK signaling pathways. In murine models, SMU-L11 significantly enhances immune cell activation and promotes the proliferation of CD4 + T and CD8 + T cells, thereby directly killing tumor cells and inhibiting tumor growth. SMU-L11 can be used for cancer research, and also has the potential for studying immune system diseases .
Elsilimomab (B-E8) is a IgG1 monoclonal antibody against interleukin-6 (IL-6), with a KD of 22 pM and an IC50 of 1.4 nM. Elsilimomab can be used for the research of multiple myeloma, renal cell carcinoma, and rheumatoid arthritis (RA) .
Cl-amidine TFA is an orally active peptidylarginine deminase (PAD) inhibitor, with IC50 values of 0.8 μM, 6.2 μM and 5.9 μM for PAD1, PAD3, and PAD4, respectively. Cl-amidine TFA induces apoptosis in cancer cells. Cl-amidine TFA induces microRNA (miR)-16 (miRNA-16, microRNA-16) expression and causes cell cycle arrest. Cl-Amidine TFA prevents histone 3 citrullination and neutrophil extracellular trap formation, and improves survival in a murine sepsis model .
Anticancer agent 157 (compound 15) is a NO inhibitor (IC50=0.62 μg/mL) with anti-inflammatory and anticancer activities. Anticancer agent 157 can bind to iNOS (inducible NO synthase) and caspase 8, causing nuclear fragmentation and chromatin condensation, inducing apoptosis. Anticancer agent 157 inhibits HT29 colon cancer cells (IC50=2.45 μg/mL), Hep-G2 liver cancer cells (IC50=3.25 μg/mL), and B16-F10 murine melanoma cells (IC50=3.84 μg/mL) .
BML-278 is a SIRT1 activator (EC150: 1 μM). BML-278 increases H3K9 methylation and inhibits H3K9 acetylation in both the paternal and maternal pronucleus. BML-278 improves early embryonic development. BML-278 arrests the cell cycle at the G1/S phase, and reduces senescence in primary human mesenchymal cells. BML-278 reduces tubulin acetylation in U937 cells. BML-278 also increases mitochondrial density in murine C2C12 myoblasts .
Perindopril erbumine is an angiotensin-converting enzyme inhibitor. Perindopril erbumine modulates NF-κB and STAT3 signaling and inhibits glial activation and neuroinflammation. Perindopril erbumine can be used for the research of Chronic Kidney Disease and high blood pressure .
ODN 1826 (CpG 1826), a class B CpG ODN (oligodeoxynucleotide), is a TLR9 agonist. ODN 1826 promotes Apoptosis. ODN 1826 is an excellent immune stimulator with antitumor activity. ODN 1826 has protective effects on the heart. ODN 1826 sequence: 5’-tccatgacgttcctgacgtt-3’ .
CYD-2-11 is a selective Bax agonist with a Ki value of 34.1 nM. CYD-2-11 induces cell apoptosis and shows antiproliferative activity to breast cancer MDA-MB-231 and MCF-7 cell lines with IC50 values of 3.22 and 3.81 μM, respectively. CYD-2-11 suppresses tumor growth in MDA-MB-231 tumor models. CYD-2-11 can be used for the research of breast and lung cancer .
MD-224 is a first-in-class and highly potent small-molecule human murine double minute 2 (MDM2) degrader based on the proteolysistargeting chimera (PROTAC) concept. MD-224 consists of ligands for Cereblon and MDM2. MD-224 induces rapid degradation of MDM2 at concentrations <1 nM in human leukemia cells, and achieves an IC50 value of 1.5 nM in inhibition of growth of RS4;11 cells. MD-224 has the potential to be a new class of anticancer agent . MD-224 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
AF12198 is a potent, selective and specific peptide antagonist for human type I interleukin-1 receptor (IL1-R1) (IC50=8 nM) but not the human type II receptor (IC50=6.7 µM) or the murine type I receptor (IC50>200 µM). AF12198 inhibits IL-1-induced IL-8 production (IC50=25 nM) and IL-1-induced intercellular adhesion molecule-1 (ICAM-1) expression (IC50=9 nM) in vitro. AF12198 has anti-inflammatory activities and blocks responses to IL-1 in vivo .
DQP-997-74 (compound 2i) is a selective inhibitor of N-methyl-d-aspartate receptor (NMDAR), specifically targeting GluN2C/D (IC50: 0.069 μM and 0.035 μM), with blood-brain barrier penetrability. Where DQP refers to dihydroquinoline-pyrazoline. DQP-997-74 acts synergistically with the agonist glutamate to exhibit time-dependent enhanced potency in inhibiting hypersynchronous activity driven by high-frequency excitatory synaptic transmission. DQP-997-74 reduces the number of epileptogenesis in a murine model of tuberous sclerosis complex (TSC)-induced epilepsy. DQP-997-74 can be used for research on NMDAR-related neurological diseases .
Peramivir is an novel cyclopentane neuraminidase inhibitor of influenza virus. Peramivir has antiviral activity and anti-cytokines stom effects. Peramivir can be used for the research of COVID-19 .
Nidanilimab (CAN04) is a fully humanized monoclonal anti-IL1RAP antibody with a Kd value of 1.10 pM. Nidanilimab blocks IL1α and IL1β signaling and stimulates the immune system to destroy tumour cells. Nidanilimab can be used in research of non-small lung cancer (NSCLC) and pancreatic ductal adenocarcinoma (PDAC) .
CB2 receptor agonist 6 (compound 70) is an agonist of CB2R, with EC50 of 162 nM. The IC50 values of CB2 receptor agonist 6 are 4.83 μM for CB1R and 0.88 μM for CB2R.
CB2 receptor agonist 6 is a neuroprotective agent that can be used for the reseach of neurological disease .
3'-Azido-3'-deoxy-5-methylcytidine (CS-92) is a potent xenotropic murine leukemia-related retrovirus (XMRV) inhibitor with a CC50 of 43.5 μM in MCF-7 cells. 3'-Azido-3'-deoxy-5-methylcytidine also inhibits HIV-1 reverse transcriptase with an EC50 of 0.06 μM in peripheral blood mononuclear (PBM) cells . 3'-Azido-3'-deoxy-5-methylcytidine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. Strain-promoted alkyne-azide cycloaddition (SPAAC) can also occur with molecules containing DBCO or BCN groups.
α7 nAchR-JAK2-STAT3 agonist 1 is a potent α7 nAchR-JAK2-STAT3 agonist, with an IC50 value of 0.32 μM for nitric oxide (NO). α7 nAchR-JAK2-STAT3 agonist 1 effectively suppresses the expression of iNOS, IL-1β, and IL-6 in murine RAW264.7 macrophages. α7 nAchR-JAK2-STAT3 agonist 1 can inhibit LPS-induced NO release, NF-κB activation and cytokine production. α7 nAchR-JAK2-STAT3 can be used for researching sepsis .
Perindopril erbumine is an angiotensin-converting enzyme inhibitor. Perindopril erbumine modulates NFκB and STAT3 signaling and inhibits glial activation and neuroinflammation. Perindopril erbumine can be used for the research of Chronic Kidney Disease and high blood pressure .
PTP1B/AKR1B1-IN-2 (Compound 7f) is a dual PTP1B/AKR1B1 inhibitor (IC50s: 3.2 and 2.1 μM, Kis: 4.0 and 0.9μM). PTP1B/AKR1B1-IN-2 is an insulin-mimetic agent. PTP1B/AKR1B1-IN-2 improves glucose uptake in murine C2C12 myoblasts. PTP1B/AKR1B1-IN-2 can be used for research of Type 2 diabetes mellitus (T2DM) .
5-epi-Arvestonate A is a sesquiterpenoid isolated from the whole plants of Seriphidium transiliense. 5-epi-Arvestonate A promotes melanogenic production by activating the transcription of microphthalmia-associated transcription factor (MITF) and tyrosinase family genes. 5-epi-Arvestonate A inhibits the expression of IFN-γ-chemokine through the JAK/STAT signaling pathway in immortalized human keratinocyte (HaCaT) cells .
Vinaxanthone (SM-345431) is a potent and selective semaphorin3A, phospholipase C (PLC) and FabI inhibitor, with IC50s of 0.1-0.2 μM and 0.9 mM for semaphorin3A and FabI. Vinaxanthone inhibits the substrate (t-o-NAC thioester) and the cofactor (NADPH) with Kis of 3.1 μM and 1.0 μM, respectively. Vinaxanthone can be used to handle infections caused by multidrug-resistant pathogens .
PTP1B/AKR1B1-IN-1 is a dual inhibitor of protein tyrosine phosphatase 1B (PTP1B) and aldose reductase (AKR1B1), with IC50s of 0.06 μM and 4.3 μM, respectively. PTP1B/AKR1B1-IN-1 also inhibits TC-PTP with an IC50 value of 9 μM. PTP1B/AKR1B1-IN-1 serves as an insulin-mimetic agent in murine myoblasts, and reduces AKR1B1-dependent sorbitol accumulation. PTP1B/AKR1B1-IN-1 inhibits development of type 2 diabetes mellitus (T2DM) to control blood glucose levels .
Phosphatidylglycerol is a naturally occurring anionic phospholipid that is a component of plant, animal and bacterial cell membranes. It is present in prokaryotes and eukaryotes less than phosphatidylethanolamine, and in eukaryotes less than phosphatidylcholine. It is formed by the reaction between CDP-diglyceride and L-α-glycerol 3-phosphate followed by dephosphorylation and is the metabolic precursor of cardiolipin. Phosphatidylglycerols containing polyunsaturated and monounsaturated fatty acyl chains inhibit and promote the proliferation of murine keratinocytes, respectively. Phosphatidylglycerol is the second-largest lipid component of mammalian lung surfactant, accounting for 10% of lipids, and has reduced levels of pulmonary surfactant in infants with respiratory distress syndrome. Phosphatidylglycerol (egg) is a mixture of phosphatidylglycerols isolated from eggs with various fatty acyl groups at the sn-1 and sn-2 positions. References: [1]. Ohtsuka, T., Nishijima, M., and Akamatsu, Y. Phosphatidylglycerol phosphate synthase-deficient somatic mutants with impaired phosphatidylglycerol and cardiolipin biosynthesis J. Biol. Chemical. 268(30), 22908-22913 (1993).[2]. Furse, S. Are phosphatidylglycerols essential for terrestrial life J. Chemistry. biology. 10(1), 1-9 (2016).[3]. Xie, D., Seremwe, M., Edwards, JG, et al. Different effects of different phosphatidylglycerols on the proliferation of mouse keratinocytes PLoS One 9(9), e107119 (2014).
β-D-glucan is a natural non-digestible polysaccharide and high biocompatibility that can be selectively recognized by recognition receptors such as Dectin-1 and Toll-like receptors as well as being easily internalized by murine or human macrophages, which is likely to attribute to a target delivery . β-d-glucan is an enteric delivery vehicle for probiotics .
Phosphatidylglycerol is a naturally occurring anionic phospholipid that is a component of plant, animal and bacterial cell membranes. It is present in prokaryotes and eukaryotes less than phosphatidylethanolamine, and in eukaryotes less than phosphatidylcholine. It is formed by the reaction between CDP-diglyceride and L-α-glycerol 3-phosphate followed by dephosphorylation and is the metabolic precursor of cardiolipin. Phosphatidylglycerols containing polyunsaturated and monounsaturated fatty acyl chains inhibit and promote the proliferation of murine keratinocytes, respectively. Phosphatidylglycerol is the second-largest lipid component of mammalian lung surfactant, accounting for 10% of lipids, and has reduced levels of pulmonary surfactant in infants with respiratory distress syndrome. Phosphatidylglycerol (egg) is a mixture of phosphatidylglycerols isolated from eggs with various fatty acyl groups at the sn-1 and sn-2 positions. References: [1]. Ohtsuka, T., Nishijima, M., and Akamatsu, Y. Phosphatidylglycerol phosphate synthase-deficient somatic mutants with impaired phosphatidylglycerol and cardiolipin biosynthesis J. Biol. Chemical. 268(30), 22908-22913 (1993).[2]. Furse, S. Are phosphatidylglycerols essential for terrestrial life J. Chemistry. biology. 10(1), 1-9 (2016).[3]. Xie, D., Seremwe, M., Edwards, JG, et al. Different effects of different phosphatidylglycerols on the proliferation of mouse keratinocytes PLoS One 9(9), e107119 (2014).
CaⅡ-EDTA disodium dihydrate (Calcium disodium EDTA dihydrate) is an orally active metal chelating reagent, exhibits bactericidal activities against periodontal pathogens Aggregatibacter actinomycetemcomitans, Prevotella intermedia and Porphyromonas gingivalis . CaⅡ-EDTA disodium dihydrate is effective chelating antidotes for lead- and cadmium poisoning .
Conantokin G, a 17-amino-acid peptide, is a potent, selective and competitive antagonist of N-methyl-D-aspartate (NMDA) receptors. Conantokin G inhibits NMDA-evoked currents in murine cortical neurons with an IC50 of 480 nM. Conantokin G has neuroprotective properties .
Conantokin G TFA, a 17-amino-acid peptide, is a potent, selective and competitive antagonist of N-methyl-D-aspartate (NMDA) receptors. Conantokin G TFA inhibits NMDA-evoked currents in murine cortical neurons with an IC50 of 480 nM. Conantokin G TFA has neuroprotective properties .
PKCδ Peptide Substrate is an absolutely specific substrate for the δ-type of PKC, with a sequence corresponding to sequence 422-443 of murine eEF-1α and containing Thr-431 .
AMPR-22 is an antimicrobial peptide. AMPR-22 can bind to the bacterial membrane and induces membrane permeabilization. AMPR-22 is effective against murine model of sepsis induced by MDR strains
COG1410 is an apolipoprotein E-derived peptide and an apoptosis inhibitor. COG1410 exerts neuroprotective and antiinflammatory effects in a murine model of traumatic brain injury (TBI). COG1410 can be used for the research of neurological disease .
Abl Cytosolic Substrate is a substrate for Abelson tyrosine kinase (Abl ). Abl Protein Tyrosine Kinase (AbI) is a truncated form of the v-AbI Protein Tyrosine Kinase, a partner in the Gag-Abl fusion protein of the Abelson murine leukemia virus .
Abl protein tyrosine kinase substrate is a biological active peptide. (Abltide is a peptide substrate for Abl Kinase (Abl protein tyrosine kinase), a partner in the gag-Abl fusion protein of the Abelson murine leukemia virus. Used in Western blot and kinase assay.)
pVEC (Cadherin-5) is a cell-penetrating 18-amino acid-long peptide derived from the murine sequence of the cell adhesion molecule vascular endothelial cadherin. pVEC (Cadherin-5) is efficiently and rapidly taken up into cells, it can be used as a carrier peptide .
Plecanatide, an analogue of Uroguanylin, is an orally active guanylate cyclase-C (GC-C) receptor agonist. Plecanatide activates GC-C receptors to stimulate cGMP synthesis with an EC50 of 190 nM in T84 cells assay. Plecanatide shows anti-inflammatory activity in models of murine colitis .
BMP-2 Epitope (73-92) is a biological active peptide. (This is amino acids 73 to 92 fragment of bone morphogenetic protein (BMP) knuckle epitope. It is a member of transforming growth factor beta (TGF-b). This peptide fragment is able to raise alkaline phosphate activity in murine multipotent mesenchymal cells.)
IGRP(206-214) is a biological active peptide. (This peptide corresponds to residues 206–214 of murine islet-specific glucose-6-phosphatase catalytic subunit–related protein (IGRP). This peptide is T cells specific for proinsulin and IGRP induces diabetes in non-obese diabetic (NOD) mice.)
mTRP-2 (180-188) is a murine tyrosinase-related protein 2 (TRP-2) -derived peptide, corresponding to residues 180-188. TRP-2 (180-188) is identified as the major reactive epitope within TRP-2 recognized by anti-B16 CTLs .
Biotin-COG1410 TFA is a biotin labled COG1410 (HY-P2136). COG1410 is an apolipoprotein E-derived peptide and an apoptosis inhibitor. COG1410 exerts neuroprotective and antiinflammatory effects in a murine model of traumatic brain injury (TBI). COG1410 can be used for the research of neurological disease .
Plecanatide acetate, an analogue of Uroguanylin, is an orally active guanylate cyclase-C (GC-C) receptor agonist. Plecanatide acetate activates GC-C receptors to stimulate cGMP synthesis with an EC50 of 190 nM in T84 cells assay. Plecanatide acetate can be used for the research of chronic idiopathic constipation, and it also shows anti-inflammatory activity in models of murine colitis .
Lynronne-1 is an antimicrobial peptide. Lynronne-1 is active against Gram-positive bacterials, including MDR strains (MIC: 8-32 μg/mL for methicillin-resistant MRSA strains). Lynronne-1 reduces the bacterial load in MRSA infected wound murine model. Lynronne-1 is also effective against P. aeruginosa infection .
ABT-510 is an anti-angiogenic TSP peptide (Thrombospondin-1 analogue) that induces apoptosis and inhibits ovarian tumour growth in an orthotopic, syngeneic model of epithelial ovarian cancer. ABT-510 also reduces angiogenesis and inflammatory responses in a murine model of inflammatory bowel disease. ABT-510 can be used in studies of cancer (particularly epithelial ovarian cancer) and inflammatory bowel disease (IBD) .
ABT-510 acetate is an anti-angiogenic TSP peptide (Thrombospondin-1 analogue) that induces apoptosis and inhibits ovarian tumour growth in an orthotopic, syngeneic model of epithelial ovarian cancer. ABT-510 acetate also reduces angiogenesis and inflammatory responses in a murine model of inflammatory bowel disease. ABT-510 acetate can be used in studies of cancer (particularly epithelial ovarian cancer) and inflammatory bowel disease (IBD) .
G6PI 325-339 (human) hydrochloride is an efficient inducer of arthritis in B10.Q mice. G6PI 325-339 (human) hydrochloride primes Th1 and Th17 cells cross-reacted with the murine G6PI protein. G6PI 325-339 (human) hydrochloride induces arthritis model operating through a T and B cell-dependent pathway but without antibody effector mechanisms .
G6PI 325-339 (human) is an efficient inducer of arthritis in B10.Q mice. G6PI 325-339 (human) primes Th1 and Th17 cells cross-reacted with the murine G6PI protein. G6PI 325-339 (human) induces arthritis model operating through a T and B cell-dependent pathway but without antibody effector mechanisms .
FN-A208 is a biological active peptide. (This peptide is a fusion of A208, derived from murine laminin a1, and the active site of fibronectin (GRGDS), with a glycine spacer. This peptide forms amyloid-like fibrils and promotes formation of actin stress fibers that mediate fibroblast cell attachment, offering it potential as a bioadhesive for tissue regeneration and engineering. FN-A208 interacts with IKVAV receptors and integrins. Its activity is disrupted by the presence of EDTA.)
AF12198 is a potent, selective and specific peptide antagonist for human type I interleukin-1 receptor (IL1-R1) (IC50=8 nM) but not the human type II receptor (IC50=6.7 µM) or the murine type I receptor (IC50>200 µM). AF12198 inhibits IL-1-induced IL-8 production (IC50=25 nM) and IL-1-induced intercellular adhesion molecule-1 (ICAM-1) expression (IC50=9 nM) in vitro. AF12198 has anti-inflammatory activities and blocks responses to IL-1 in vivo .
Enlimomab (BI-RR 0001), a murine IgG2a monoclonal antibody to the human ICAM-1, inhibits leukocyte adhesion to the vascular endothelium, thereby decreasing leukocyte extravasation and inflammatory tissue injury. Enlimomab has anti-inflammatory effects, and can be used for stroke research .
Semzuvolimab is a murine IgG1κ antibody, targeting to p55, T cell surface antigen T4/Leu-3 (CD4). Murine CD4 antibodies can neutralize HIV infection and have the potential to inhibit HAART stable HIV infection .
Enibarcimab is a humanised murine monoclonal immunoglobulin G1 (IgG1) antibody, could be used for acute heart failure, COVID-19 infections and septic shock research .
Ganitumab (AMG 479) is a recombinant human monoclonal antibody to the human type 1 insulin-like growth factor receptor (IGF1R). Ganitumab recognizes murine IGF1R with sub-nanomolar affinity (KD=0.22 nM) and inhibits the interaction of murine IGF1R with IGF1 and IGF2. Ganitumab can be used in research of cancer .
Tositumomab is a murine IgG2a lambda monoclonal antibody directed against the CD20 antigen, which is found on the surface of normal and malignant B lymphocytes .
Minretumomab (CC-49) is a murine monoclonal antibody against TAG-72 (tumor-associated glycoprotein 72). Minretumomab is used in cancer and immunity research .
Basiliximab (CHI 621) is a recombinant chimeric murine/human IgG1 monoclonal anti-interleukin-2 receptor antibody. Basiliximab can be used for the research of renal transplantation .
Edrecolomab (Panorex) is a murine monoclonal antibody to the cell-surface glycoprotein 17-1A, expressed on epithelial tissues and on various carcinomas. Edrecolomab shows anti-tumor activity and can be used in colorectal carcinoma research .
Begelomab (SAND-26) is a murine IgG2b monoclonal antibody against DPP-4/CD26. Begelomab can be used for the research of severe refractory idiopathic inflammatory myopathy .
Gavilimomab (ABX-CBL) is an IgM murine monoclonal antibody that recognizes CD147 on the cell surface and initiates cell killing through complement-mediated lysis. Gavilimomab can be used for the research of graft-versus-host disease (GVHD) .
Sulesomab (IMMU-MN3) is a murine monoclonal antibody fragment of the IgG1 class that binds to Normal Cross-Reactive Antigen-90 present on leukocytes. Sulesomab is cleared into infection nonspecifically through increased capillary membrane permeability .
Tenatumomab (ST2146) is a murine monoclonal antibody against tenascin-C. And tenascin-C, the large extracellular glycoprotein, is overexpressed in cancer. Tenatumomab has been used for Pretargeted Antibody Guided Radioimmunoresearch (PAGRIT), and delivering radionuclides to tumors via PAGRIT and direct 131Iodine labeling approach .
Dafsolimab (SPV-T3a) is an IgG2a murine monoclonal antibody (anti-CD3). Dafsolimab can induce cell death through modulation and activation of the CD3/T cell receptor complex. Dafsolimab can be used for the research of graft-versus-host disease (GVHD) .
Anatumomab mafenatox (ABR-214936) is a 73 KDa recombinant protein to recognize the tumor-associated antigen 5T4, which is widely expressing in malignancy. Anatumomab mafenatox is between a modified form of SEA and a murine Fab. The main side effects of Anatumomab mafenatox are reported to include fever, low blood pressure, pain, nausea and drowsiness .
Abagovomab (Anti-Human CA-125 Recombinant Antibody) is a murine monoclonal anti-idiotypic antibody, against the tumor-associated antigen, CA-125. Abagovomab is generated by a mouse hybridoma, can imitate the human TAA, CA-125. Abagovomab can elicit humoral and cellular immune responses against ovarian cancer (oc) .
Volociximab (M200) is a chimeric human/murine IgG4 antibody IIA1 targeting integrin α5β1 (EC50=0.2 nM). Integrin α5β1 is a major fibronectin receptor involved in angiogenesis. Volociximab has antiangiogenic and antitumor activities and inhibits the proliferation of human umbilical vein vascular endothelial cells (HUVECs) .
Girentuximab (G250) is a chimeric monoclonal antibody that binds carbonic anhydrase IX (CAIX), a cell surface glycoprotein ubiquitously expressed in clear cell renal cell carcinoma (ccRCC) .
Atibuclimab, is a chimeric monoclonal antibody directed against CD14 and is composed of murine variable and human IgG4 Fc regions. Atibuclimab can be used for the research of amyotrophic lateral sclerosis . Atibuclimab attenuates LPS-induced symptoms and strongly inhibits LPS-induced proinflammatory cytokine release, while only delaying the release of the anti-inflammatory cytokines soluble TNF receptor type I and IL-1 receptor antagonist .
Alemtuzumab (Campath-IH) is a humanized monoclonal antibody against CD52. Alemtuzumab does not cross-react with murine CD52. Alemtuzumab selectively targets the CD52 antigen to induce profound lymphocyte depletion, followed by recovery of T and B cells with regulatory phenotypes. Alemtuzumab is capable of complement-dependent cytotoxicity and antibody-dependent cell-mediated cytotoxicity (ADCC), as well as induction of apoptosis. Alemtuzumab has the potential for B-cell chronic lymphocytic leukaemia research .
Elsilimomab (B-E8) is a IgG1 monoclonal antibody against interleukin-6 (IL-6), with a KD of 22 pM and an IC50 of 1.4 nM. Elsilimomab can be used for the research of multiple myeloma, renal cell carcinoma, and rheumatoid arthritis (RA) .
Nidanilimab (CAN04) is a fully humanized monoclonal anti-IL1RAP antibody with a Kd value of 1.10 pM. Nidanilimab blocks IL1α and IL1β signaling and stimulates the immune system to destroy tumour cells. Nidanilimab can be used in research of non-small lung cancer (NSCLC) and pancreatic ductal adenocarcinoma (PDAC) .
Maydispenoid A is a potent immunosuppressor. Maydispenoid A can inhibit anti-CD3/anti-CD28 mAbs activated and lipopolysaccharide activated murine splenocyte proliferation .
Maydispenoid B is a potent immunosuppressor. Maydispenoid B can inhibit anti-CD3/anti-CD28 mAbs activated and lipopolysaccharide activated murine splenocyte proliferation .
Conantokin G, a 17-amino-acid peptide, is a potent, selective and competitive antagonist of N-methyl-D-aspartate (NMDA) receptors. Conantokin G inhibits NMDA-evoked currents in murine cortical neurons with an IC50 of 480 nM. Conantokin G has neuroprotective properties .
Conantokin G TFA, a 17-amino-acid peptide, is a potent, selective and competitive antagonist of N-methyl-D-aspartate (NMDA) receptors. Conantokin G TFA inhibits NMDA-evoked currents in murine cortical neurons with an IC50 of 480 nM. Conantokin G TFA has neuroprotective properties .
2,3,2'',3''-Tetrahydroochnaflavone is a biflavonoid, which can be isolated from the leaves of Quintinia acutifolia. 2,3,2'',3''-Tetrahydroochnaflavone shows some cytotoxicity against P388 murine lymphocytic leukemia cells, with an IC50 of 8.2 µg/mL .
Octacosane is an endogenous metabolite with antibacterial activity. Octacosane shows high cytotoxicity against murine melanoma B16F10-Nex2 cells besides inducing protection against a grafted subcutaneous melanoma. Octacosane has the larvicidal activity against mosquito Culex quinquefasciatus with the LC50 concentration of 7.2 mg/l .
Reticulol (K 251-1) is an inhibitor of cyclic adenosine 3', 5'-monophosphate phosphodiesterase. Reticulol shows antitumor activity independent with cell cycle arrest or apoptosis. Reticulol inhibits cell growth of murine melanoma cells and human lung tumor cells. Reticulol protects its lung metastasis via the bloodstream by inhibiting the growth of B16F10 melanoma .
11-epi-Chaetomugilin I is a metabolite found in Chaetomium globosum. 11-epi-Chaetomugilin I exhibits significant cytotoxic activity against the murine P388 leukemia cell line, the human HL-60 leukemia cell line, the murine L1210 leukemia cell line, and the human KB epidermoid carcinoma cell line .
Antibiotic PF 1052 is an antibiotic extracted from a natural product library. Antibiotic PF 1052 has an inhibitory effect on murine neutrophil migration .
Alismol is a natural sesquiterpene. Alismol shows promising inhibitory effects on INF-γ-induced nitric oxide production in murine macrophage RAW264.7 cells .
Nagilactone C is a diterpene dilactone compound isolated from Podocarpus neriifolius. Nagilactone C has potent antiproliferative activity against human fibrosarcoma and murine colon carcinoma tumor cell lines .
Benzyl isothiocyanate is a member of natural isothiocyanates with antimicrobial activity . Benzyl isothiocyanate potent inhibits cell mobility, migration and invasion nature and matrix metalloproteinase-2 (MMP-2) activity of murine melanoma cells .
(Rac)-Myrislignan is the racemate of Myrislignan. Myrislignan, a lignan isolated from Myristica fragrans Houtt, possesses anti-inflammatory activities. Myrislignan attenuates LPS-induced inflammation reaction in murine macrophage cells through inhibition of NF-kB signalling pathway activation .
1-Dehydroxy-23-deoxojessic acid (compound 10) is a cycloartane-type triterpene. 1-Dehydroxy-23-deoxojessic acid exhibits cytotoxicity against murine colon 26-L5 carcinoma cells, with an EC50 of 62.38 μM .
Methyl everninate is the major constituent of the deuterochloroform. Methyl everninate, rhodomollosides A and B are the derivatives of Methyl everninate, with cytotoxicity against RAW264.7 cells. Both of they shows inhibitory effects with a lipopolysaccharide (LPS)-stimulated murine macrophages RAW 264.7 cells model .
Neplanocin A ((-)-Neplanocin A) is an antitumor antibiotic with significant antitumor activity against murine L1210 leukemia. Neplanocin A is also an irreversible inhibitor of AdoHcy hydrolase (Ki=8.39 nM). Neplanocin A also has antiviral activity and is effective against vaccinia virus. Neplanocin A is obtained from Ampulariella regularis .
Cynaropicrin is a sesquiterpene lactone which can inhibit tumor necrosis factor (TNF-α) release with IC50s of 8.24 and 3.18 μM for murine and human macrophage cells, respectively. Cynaropicrin also inhibits the increase of cartilage degradation factor (MMP13) and suppresses NF-κB signaling.
Bis-5,5-Nortrachelogenin is isolated from active extract of root of Wikstroemia indica. Bis-5,5-Nortrachelogenin inhibits nitric oxide (NO) production in a lipopolysaccharide (LPS) and recombinant mouse interferon-γ(IFN-γ) activated murine macrophage-like cell line, RAW 264.7 with an IC50 value of 48.6 mM .
Mycalolide-B is a specific inhibitor of actomyosin ATPase isolated from marine sponge. Mycalolide-B inhibits ATP-induced contraction and Mg 2+-ATPase activity in the absence of Ca 2+ .
Jacaric acid is a conjugated linolenic acid, which inhibits viability in cells PC-3 (IC50 is 11.8 μM), LNCaP (IC50 is 2.2 μM) and DLD-1, induces apoptosis and necrosis . Jacaric acid exhibits anticaner activity against prostate cancer and adenocarcinoma . Jacaric acid exhibits immunomodulating activity in murine peritoneal macrophages as an immunopotentiator . Jacaric acid is orally active.
ar-Turmerone ((+)-ar-Turmerone) is a major bioactive compound of the herb Curcuma longa with anti-tumorigenesis and anti-inflammatory activities . ar-Turmerone activates apoptotic protein in human lymphoma U937 cells . ar-Turmerone exerts positive modulation on murine DCs. ar-Turmerone induces NSC proliferation and constitutes a promising therapeutic agent for various neurologic disorders .
PC-766B is a macrolide antibiotic. PC-766B is active against Gram-positive bacteria, and some fungi and yeasts, but inactive against Gram-negative bacteria. PC-766B shows antitumor activity against murine tumor cells. PC-766B has weak inhibitory activity against Na +, K +-ATPase .
Gnetol is a phenolic compound isolated from the root of Gnetum montanum . Gnetol potently inhibits COX-1 (IC50 of 0.78 μM) and HDAC. Gnetol is a potent tyrosinase inhibitor with an IC50 of 4.5 μM for murine tyrosinase and suppresses melanin biosynthesis. Gnetol has antioxidant, antiproliferative, anticancer and hepatoprotective activity. Gnetol also possesses concentration-dependent α-Amylase, α-glucosidase, and adipogenesis activities .
20(R)-Ginsenoside Rh2, a matrix metalloproteinase (MMP) inhibitor, acts as a cell antiproliferator. It has anticancer effects via blocking cell proliferation and causing G1 phase arrest. 20(R)-Ginsenoside Rh2 induces apoptosis, and has anti-inflammatory and antioxidative activity . 20(R)-Ginsenoside Rh2 inhibits the replication and proliferation of mouse and human gammaherpesvirus 68 (MHV-68) with an IC50 of 2.77 μM for murine MHV-68 .
Perindopril erbumine is an angiotensin-converting enzyme inhibitor. Perindopril erbumine modulates NFκB and STAT3 signaling and inhibits glial activation and neuroinflammation. Perindopril erbumine can be used for the research of Chronic Kidney Disease and high blood pressure .
5-epi-Arvestonate A is a sesquiterpenoid isolated from the whole plants of Seriphidium transiliense. 5-epi-Arvestonate A promotes melanogenic production by activating the transcription of microphthalmia-associated transcription factor (MITF) and tyrosinase family genes. 5-epi-Arvestonate A inhibits the expression of IFN-γ-chemokine through the JAK/STAT signaling pathway in immortalized human keratinocyte (HaCaT) cells .
Vinaxanthone (SM-345431) is a potent and selective semaphorin3A, phospholipase C (PLC) and FabI inhibitor, with IC50s of 0.1-0.2 μM and 0.9 mM for semaphorin3A and FabI. Vinaxanthone inhibits the substrate (t-o-NAC thioester) and the cofactor (NADPH) with Kis of 3.1 μM and 1.0 μM, respectively. Vinaxanthone can be used to handle infections caused by multidrug-resistant pathogens .
The major capsid protein, the VP1 protein, is a 40 nm diameter icosahedral capsid composed of 72 pentamers linked by disulfide bonds. During infection, VP1 participates in nucleosome rearrangement and encapsulates replicated genomic DNA. Major capsid protein VP1 Protein, Murine polyomavirus (Sf9, His) is the recombinant Virus-derived Major capsid protein VP1 protein, expressed by Sf9 insect cells , with C-His labeled tag. The total length of Major capsid protein VP1 Protein, Murine polyomavirus (Sf9, His) is 372 a.a., with molecular weight of ~42.5 kDa.
ABL1, Human (GST) is a non-receptor tyrosine-protein kinase. ABL1, Human is implicated in a wide range of cellular processes, including regulation of cell growth and survival, oxidative stress and DNA-damage responses, actin dynamics and cell migration, transmission of information about the cellular environment through integrin signaling.
ABL1 is a non-receptor tyrosine protein kinase that coordinates key cellular processes for growth and survival. It affects cytoskeletal remodeling, cell motility, and receptor endocytosis. ABL1 Protein, Human (sf9, GST) is the recombinant human-derived ABL1 protein, expressed by Sf9 insect cells , with N-GST labeled tag. The total length of ABL1 Protein, Human (sf9, GST) is 418 a.a., with molecular weight of ~65 kDa.
Bezafibrate-d6 is the deuterium labeled Bezafibrate. Bezafibrate is an agonist of PPAR, with EC50s of 50 μM, 60 μM, 20 μM for human PPARα, PPARγ and PPARδ, and 90 μM, 55 μM, 110 μM for murine PPARα, PPARγ and PPARδ, respectively; Bezafibrate is used as an hypolipidemic agent.
Troglitazone-d4 is deuterium labeled Troglitazone. Troglitazone is a PPARγ agonist, with EC50s of 550 nM and 780 nM for human and murine PPARγ receptor, respectively.
Clofibrate-d4 is the deuterium labeled Clofibrate. Clofibrate is an agonist of PPAR, with EC50s of 50 μM, ∼500 μM for murine PPARα and PPARγ, and 55 μM, ∼500 μM for human PPARα and PPARγ, respectively.
Benzyl isothiocyanate-d7 is the deuterium labeled Benzyl isothiocyanate. Benzyl isothiocyanate is a member of natural isothiocyanates with antimicrobial activity[1][2]. Benzyl isothiocyanate potent inhibits cell mobility, migration and invasion nature and matrix metalloproteinase-2 (MMP-2) activity of murine melanoma cells[2].
Bezafibrate-d4 is deuterium labeled Bezafibrate. Bezafibrate is an agonist of PPAR, with EC50s of 50 μM, 60 μM, 20 μM for human PPARα, PPARγ and PPARδ, and 90 μM, 55 μM, 110 μM for murine PPARα, PPARγ and PPARδ, respectively; Bezafibrate is used as an hypolipidemic agent.
Remdesivir-d5 is a deuterium labeled Remdesivir. Remdesivir (GS-5734) is a nucleoside analogue, with effective antiviral activity, with EC50s of 74 nM for SARS-CoV and MERS-CoV in HAE cells, and 30 nM for murine hepatitis virus in delayed brain tumor cells. Remdesivir is highly effective in the control of 2019-nCoV (COVID-19) infection in vitro[1][2].
Remdesivir-d4 is deuterium labeled Remdesivir. Remdesivir (GS-5734), a nucleoside analogue with effective antiviral activity, has EC50s of 74 nM for SARS-CoV and MERS-CoV in HAE cells, and 30 nM for murine hepatitis virus in delayed brain tumor cells. Remdesivir is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro[1][2].
Remdesivir impurity 9-d4 is deuterium labeled Remdesivir. Remdesivir (GS-5734), a nucleoside analogue with effective antiviral activity, has EC50s of 74 nM for SARS-CoV and MERS-CoV in HAE cells, and 30 nM for murine hepatitis virus in delayed brain tumor cells. Remdesivir is highly effective in the control of SARS-CoV-2 (COVID-19) infection in vitro[1][2].
Octacosane-d58 is the deuterium labeled Octacosane[1]. Octacosane is an endogenous metabolite with antibacterial activity. Octacosane shows high cytotoxicity against murine melanoma B16F10-Nex2 cells besides inducing protection against a grafted subcutaneous melanoma. Octacosane has the larvicidal activity against mosquito Culex quinquefasciatus with the LC50 concentration of 7.2 mg/l[2][3][4].
ar-Turmerone-d3 is the deuterium labeled ar-Turmerone. ar-Turmerone ((+)-ar-Turmerone) is a major bioactive compound of the herb Curcuma longa with anti-tumorigenesis and anti-inflammatory activities[1][2][3]. ar-Turmerone activates apoptotic protein in human lymphoma U937 cells[3]. ar-Turmerone exerts positive modulation on murine DCs. ar-Turmerone induces NSC proliferation and constitutes a promising therapeutic agent for various neurologic disorders[4][5].
BRAF Antibody is a non-conjugated and Mouse origined monoclonal antibody about 84 kDa, targeting to BRAF (4E1). It can be used for WB assays with tag free, in the background of Human, Mouse.
Phospho-BRAF (Thr401) Antibody is a non-conjugated and Rabbit origined monoclonal antibody about 84 kDa, targeting to Phospho-BRAF (Thr401). It can be used for WB,IP assays with tag free, in the background of Human, Mouse, Rat.
3'-Azido-3'-deoxy-5-methylcytidine (CS-92) is a potent xenotropic murine leukemia-related retrovirus (XMRV) inhibitor with a CC50 of 43.5 μM in MCF-7 cells. 3'-Azido-3'-deoxy-5-methylcytidine also inhibits HIV-1 reverse transcriptase with an EC50 of 0.06 μM in peripheral blood mononuclear (PBM) cells . 3'-Azido-3'-deoxy-5-methylcytidine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. Strain-promoted alkyne-azide cycloaddition (SPAAC) can also occur with molecules containing DBCO or BCN groups.
Inquiry Online
Your information is safe with us. * Required Fields.
