Search Result

Search Result

Results for "

ASO

" in MedChemExpress (MCE) Product Catalog:

By Targets:	Complement System (2) DNA/RNA Synthesis (2) E1/E2/E3 Enzyme (1) Endogenous Metabolite (1) HCV (1) Liposome (1) PCSK9 (5) Tau Protein (3)
By Research Areas:	Cancer (1) Cardiovascular Disease (2) Metabolic Disease (5) Neurological Disease (3)

22

Inhibitors & Agonists

1

Biochemical Assay Reagents

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

ASO 556089 sodium	Others	Others
ASO 556089 sodium is a 16 nucleotide length gapmer (3-10-3) that targets the human and mouse long non-coding RNA MALAT1, with the sequence: 5’-GmCATTmCTAATAGmCAGmC-3’ .

*Tau ASO-12 (murine) (sodium)*	Tau Protein
Tau ^ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ^ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )

*Inactive ASO* (in vivo) sodium**	Others	Others
Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications

Ascorbate oxidase ASO	Endogenous Metabolite	Metabolic Disease
Ascorbate oxidase, also known as vitamin C oxidase, is a REDOX enzyme involved in the regulation of extracellular matrix. Ascorbate oxidase catalyzes the reaction of ascorbic acid and oxygen to produce dehydroascorbic acid .

*MDM4-targeting ASO* sodium**	Others	Cancer
MDM4-targeting ASO sodium is a 25mer antisense oligonucleotide targeting?MDM4. MDM4-targeting ASO sodium induced exon 6 skipping, leading to nonsense-mediated decay of the mRNA transcript that excludes exon-6. In multiple human melanoma cell lines and in melanoma patient-derived xenograft (PDX) mouse models, MDM4-targeting ASO-mediated skipping of exon 6 decreased MDM4 abundance, inhibited melanoma growth, and enhanced sensitivity to MAPK-targeting therapeutics.

HY-W570887

LNA-A(Bz) amidite

DNA/RNA Synthesis Others

LNA-A(Bz) amidite can be used for synthesis of ASOs (antisense oligonucleotides) .

306-O12B-3	Liposome	Others
306-O12B-3 is a lipidoid that can efficiently deliver ASO both in vitro and in vivo. 306-O12B-3 is used to transport small molecule drugs across the blood-brain barrier (BBB) .

SPC5001	PCSK9	Cardiovascular Disease
SPC5001 is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .

SPC5001 sodium	PCSK9	Cardiovascular Disease
SPC5001 sodium is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 sodium can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .

HY-157261

UNC2383

Others Others

UNC2383 is an oligonucleotide enhancing compound that can enhance effects of antisense oligonucleotides (ASOs), and splice switching oligonucleotides (SSOs) .

IONIS-MAPTRx sodium BIIB080 sodium; ISIS 814907 sodium	Tau Protein	Neurological Disease
IONIS-MAPTRx sodium is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx sodium has the potential for the research of Alzheimer Disease .

Tadnersen BIIB078; IONIS-C9Rx	Others	Neurological Disease
Tadnersen (BIIB078), an antisense oligonucleotide (ASO), selectively targets *C9ORF72* transcript variants 1 and 3 that carry the expansion .

IONIS-MAPTRx BIIB080; ISIS 814907	Tau Protein	Neurological Disease
IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease .

Cepadacursen sodium CIVI007 sodium	PCSK9	Metabolic Disease
Cepadacursen sodium is a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. Cepadacursen sodium can be used for hypercholesterolemia treatment and the prevention of atherosclerotic cardiovascular disease (ASCVD).

IONIS-FB-LRx sodium RG6299 sodium	Complement System	Others
IONIS-FB-LRx sodium is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx sodium effectively reduces circulating levels of CFB, and can be used for geographic atrophy (GA) research .

IONIS-FB-LRx RG6299	Complement System	Others
IONIS-FB-LRx is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). IONIS-FB-LRx effectively reduces circulating levels of CFB. IONIS-FB-LRx can be used for geographic atrophy (GA) research .

AZD8233 sodium	PCSK9	Metabolic Disease
AZD8233 sodium, a liver-targeting antisense oligonucleotide (ASO), inhibits subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 sodium increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.

AZD8233	PCSK9	Metabolic Disease
AZD8233, a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.

HY-W570885

2'-O-MOE-rC

DNA/RNA Synthesis Others

2'-O-MOE-rC is a 2'-O-MOE modified nucleoside. 2'-O-MOE-rC can be used for synthesis of DNA .

Rugonersen RG6091; RO7248824	E1/E2/E3 Enzyme	Others
Rugonersen (RG6091; RO7248824) is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .

UNC10217938A 1 Publications Verification	Others	Others
UNC10217938A is a 3-deazapteridine analog with strong oligonucleotide enhancing effects. UNC10217938A enhances oligonucleotides effects by modulating their intracellular trafficking and release from endosomes. UNC10217938A also enhances the effects of antisense and siRNA oligonucleotides .

Mipomersen sodium ISIS 301012	HCV	Metabolic Disease
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:

MedChemExpress Magic Cece

MedChemExpress: Contact Us; About Us; Headquarters; Distributors; Statement on False Report; Careers

Customer Support: Technical Support; Service; Ordering Information; Easy Return; Shipping Rates & Policies; Intellectual Property Promise

Resources: Free Sample; Resources; Molarity Calculator; Dilution Calculator; Terms & Conditions; Reconstitution Calculator; Specific Activity Calculator

Subscribe to our E-newsletter

Products are chemical reagents for research use only and are not intended for human use. We do not sell to patients.

Copyright © 2013-2024 MedChemExpress. All Rights Reserved.: Site Map Privacy Policy

Join with us