Search Result

Pathways Recommended:	Cell Cycle/DNA Damage

Results for "

HBV DNA

" in MedChemExpress (MCE) Product Catalog:

By Targets:	DNA/RNA Synthesis (13) HBV (45) Apoptosis (4) HIV (3) NADPH Oxidase (1) Orthopoxvirus (1) Reactive Oxygen Species (3) Reverse Transcriptase (2)
By Research Areas:	Cancer (2) Infection (43) Inflammation/Immunology (3) Metabolic Disease (1) Neurological Disease (1)
Click Chemistry:	Alkynes (1)

Inhibitors & Agonists

Natural
Products

Isotope-Labeled Compounds

Click Chemistry

Targets Recommended: HBV DNA-PK DNA Methyltransferase DNA Stain DNA Alkylator/Crosslinker DNA/RNA Synthesis

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-149357

Yhhu6669	HBV	Infection
Yhhu6669 is an anti-HBV agent. Yhhu6669 inhibits HBV DNA. Yhhu6669 inhibits HBV replication by inducing the formation of DNA-free capsids. Yhhu6669 decreases HBV DNA and HBcAg in AAV/HBV-infected mice. Yhhu6669 has favorable PK properties .

HY-W676876

Oxynitidine	HBV	Infection
Oxynitidine is an *HBV* inhibitor (ID₅₀=30.8 µg/mL), which can effectively inhibit the DNA replication activity of HBV. Oxynitidine can be used in the study of viral infections .

HY-144319

SHR5133

HBV Infection

SHR5133 is a highly potent, orally active HBV capsid assembly modulator. SHR5133 displays HBV DNA reduction (EC₅₀=26.6 nM) .

SHR5133	HBV	Infection
SHR5133 is a highly potent, orally active HBV capsid assembly modulator. SHR5133 displays HBV DNA reduction (EC₅₀=26.6 nM) .

HY-144047

HBV-IN-16	HBV DNA/RNA Synthesis	Infection
HBV-IN-16 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-16 is a quinoline derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2019121357A1, compound 1) .

HY-144045

HBV-IN-14	HBV DNA/RNA Synthesis	Infection
HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5) .

HY-144046

HBV-IN-15	HBV DNA/RNA Synthesis	Infection
HBV-IN-15 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-15 is a flavone derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2020052774A1, compound 2) .

HY-N10404

Junceellolide C	HBV	Inflammation/Immunology
Junceellolide C is a transcription inhibitor of cccDNA. Junceellolide C inhibits *HBV* DNA replication and significantly decreases the level of supernatant *HBV* RNA with EC₅₀ values of 5.19, 3.52 μM respectively in HepAD38 cells. Junceellolide C is a potent anti-HBV agent .

HY-145059

HBV-IN-12	HBV	Infection
HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC₅₀ ≤0.05 μM). HBV-IN-12 shows anti-HBV DNA activity (0.001 μM＜EC₅₀ ≤0.02 μM). From patent WO2021204252A1, compound 15 .

HY-148781

HBV-IN-30	HBV	Infection
HBV-IN-30 (ex44), a flavone derivative, is a potent *covalently closed circular DNA* (cccDNA)** inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-30 has the potential for the research of HBV infection .

HY-148780

HBV-IN-29	HBV	Infection
HBV-IN-29 (ex8), a flavone derivative, is a potent *covalently closed circular DNA* (cccDNA)** inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-29 has the potential for the research of HBV infection .

HY-N12840

Logmalicid B

Others Metabolic Disease

Logmalicid B is an iridoid glycoside compound that can be isolated from Cornus officinalis and can be used in diabetes research .

Logmalicid B	Others	Metabolic Disease
Logmalicid B is an iridoid glycoside compound that can be isolated from Cornus officinalis and can be used in diabetes research .

HY-146395

HBV-IN-23	HBV DNA/RNA Synthesis Apoptosis	Infection Cancer
HBV-IN-23 (Compound 5k) is an inhibitor of HBV DNA replication with an IC₅₀ of 0.58 μM. HBV-IN-23 inhibits HBV DNA replication in both agent sensitive and resistant HBV strains. HBV-IN-23 shows anti-hepatocellular carcinoma cell (HCC) activities. HBV-IN-23 induces HepG2 cells apoptosis .

HY-156702

HBV-IN-38

HBV Infection

HBV-IN-38 (Example 193) is an HBV DNA inhibitor (EC₅₀≤100nM). HBV-IN-38 can be used to study viral infections .

HBV-IN-38	HBV	Infection
HBV-IN-38 (Example 193) is an *HBV* DNA inhibitor (EC₅₀≤100nM). HBV-IN-38 can be used to study viral infections .

HY-131343

HBV-IN-4	HBV DNA/RNA Synthesis	Infection
HBV-IN-4, a phthalazinone derivative, is a potent and orally active HBV DNA replication inhibitor with an IC₅₀ of 14 nM. HBV-IN-4 induces the formation of genome-free capsids and has potent anti-HBV potencies .

HY-148782

HBV-IN-31	HBV	Infection
HBV-IN-31 is a potent cccDNA (covalently closed circular DNA) inhibitor. HBV-IN-31 shows anti-HBV activity with an IC₅₀ value of 0.13 µM for HBsAg. HBV-IN-31 inhibits cell growth .

HY-148783

HBV-IN-32	HBV	Infection
HBV-IN-32 is a potent cccDNA (covalently closed circular DNA) inhibitor. HBV-IN-32 shows anti-HBV activity with an IC₅₀ value of 0.14 µM for HBsAg. HBV-IN-32 inhibits cell growth .

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all *HBV* messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-155547

HBV-IN-34	HBV	Infection
HBV-IN-34 (compound 17i) is a potent HBsAg production inhibitor. HBV-IN-34 exhibits excellent in vitro anti-HBV potency, with an EC₅₀ of 0.018 μM and 0.044 μM for HBV DNA and HBsAg, respectively .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium	HBV	Infection
Bepirovirsen sodium is an antisense oligonucleotide targeting all *HBV* messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-146011

HBV-IN-21	HBV DNA/RNA Synthesis	Infection
HBV-IN-21 (Compound II-8b) is an HBV DNA replication inhibitor with an IC₅₀ of 2.2 µM. HBV-IN-21 can interact HBV 4 capsid protein with good affinity (K_D = 60.0 μM) .

HY-146394

HBV-IN-22	HBV DNA/RNA Synthesis	Infection
HBV-IN-22 (Compound LC5f) is an inhibitor of HBV DNA replication with IC₅₀ values of 0.71 μM and 0.84 μM against wild-type and agent resistant HBV strains, respectively .

HY-117650A

RG7834 4 Publications Verification RO 7020322	HBV	Infection
RG7834 (RO 7020322) is a highly selective and orally bioavailable *HBV* inhibitor, potently inhibits HBV antigens (both HBsAg and HBeAg) and HBV DNA, with IC₅₀s of 2.8, 2.6, and 3.2 nM, respectively, in dHepaRG Cells .

HY-147863

HBV-IN-24	HBV	Infection Neurological Disease
HBV-IN-24 (compound (2ʹS, 6S)-1a) is a potent *HBV* inhibitor. HBV-IN-24 exhibits potent inhibition activity against HBV DNA, HBsAg, and HBeAg, with EC₅₀ values of 0.6, 0.6, and 4.6 nM, respectively. HBV-IN-24 shows excellent antiviral activity, could have improved neurotoxicity .

HY-145052

HBV-IN-9	HBV	Infection
HBV-IN-9 is a potent HBsAg (HBV Surface antigen) inhibitor (IC₅₀=10 nM) and HBV DNA production inhibitor (IC₅₀=0.15 nM in HepG2.2.15 cells) . From patent WO2018001952A1, example 20.

HY-100028

AT-130 1 Publications Verification	HBV DNA/RNA Synthesis	Infection Cancer
AT-130, a phenylpropenamide derivative, is a potent hepatitis B virus (HBV) replication non-nucleoside inhibitor. AT-130 inhibits the viral DNA synthesis with an EC₅₀ of 0.13 μM. AT-130 inhibits both wt and mutant HBVs. AT-130 has anti-HBV activity in hepatoma cells .

HY-157993

SAG-524	HBV	Infection
SAG-524 is a potent oral small molecule *HBV* viral replication inhibitor. SAG-524 decreased HBV-DNA and HbsAg levels in supernatant of HepG2.2.15 cells, IC₅₀ 0.92 and 1.4 nM, respectively .

HY-B1826

Adefovir 1 Publications Verification GS-0393; PMEA	HBV Reverse Transcriptase	Infection
Adefovir (GS-0393) is an adenosine monophosphate analog antiviral agent that after intracellular conversion to Adefovir diphosphate inhibits *HBV* DNA polymerase. Adefovir has an IC₅₀ of 0.7 μM against *HBV* in the HepG2.2.15 cell line. Adefovir has good antiviral activity against several viruses, including *HBV* and herpesviruses .

HY-126970

HBF-0259	HBV	Infection
HBF-0259 is a potent and selective inhibitor of hepatitis B virus (HBV) surface antigen (HBsAg) secretion, with an EC₅₀ of 1.5 μM in HepG2.2.15 cells. HBF-0259 has no effect on HBV DNA synthesis .

HY-B1826S2

Adefovir-d4 GS-0393-d₄; PMEA-d₄	HBV Reverse Transcriptase	Infection
Adefovir-d₄ is the deuterium labeled Adefovir. Adefovir (GS-0393) is an adenosine monophosphate analog antiviral agent that after intracellular conversion to Adefovir diphosphate inhibits HBV DNA polymerase. Adefovir has an IC50 of 0.7 μM against HBV in the HepG2.2.15 cell line. Adefovir has good antiviral activity against several viruses, including HBV and herpesviruses[1][2][3].

HY-123767

HEC72702	HBV	Infection
HEC72702 is a potent and orally active hepatitis B virus capsid inhibitor with an EC₅₀ values of 0.039 µM. HEC72702 dose-dependently reduced HBV DNA in both the plasma and livers .

HY-106235

LB80317	HBV DNA/RNA Synthesis	Infection
LB80317 is an active metabolite of LB80380 and suppresses the DNA synthesis of *HBV* with an EC₅₀ of 0.5 μM. LB80317 has antiviral effect and has the potential for chronic hepatitis B treatment .

HY-148560B

cis-ccc_R08	HBV	Infection
cis-ccc_R08 (compound 1) is a flavonoid derivative that can be used in the study of hepatitis B virus (HBV) infection. cis-ccc_R08 is a cccDNA (covalently closed circular DNA) inhibitor .

HY-19447A

Besifovir Dipivoxil maleate LB80380 maleate	HBV	Infection
Besifovir Dipivoxil maleate (LB80380 maleate) is an oral proagent of LB80317. Besifovir Dipivoxil maleate (LB80380 maleate) is effective in hepatitis B virus (HBV) DNA suppression for both treatment-naive and lamivudine-resistant chronic hepatitis B (CHB) patients in preliminary studies ^[2]

HY-124614

GLP-26 1 Publications Verification	HBV	Infection
GLP-26 is a *HBV* capsid assembly modulators (CAM), inhibits HBV DNA replication in Hep AD38 system (IC₅₀=3 nM), and reduces cccDNA by >90% at 1 μM. GLP-26 disrupts the encapsidation of pre-genomic RNA, causes nucleocapsid disassembly and reduces cccDNA pools . GLP-26 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

HY-101954

Inarigivir ORI-9020; SB-9000	HBV	Infection
Inarigivir (ORI-9020) is a dinucleotide antiviral drug that can significantly reduce liver *HBV* DNA in transgenic mice expressing hepatitis B virus. Inarigivir (ORI-9020) act as a RIG-I agonist to activate cellular innate immune responses .

HY-148201

Oleana-2,12-dien-28-oic acid	HBV	Infection
Oleana-2,12-dien-28-oic acid is an *HBV-DNA* inhibitor, HBsAg and HBeAg inhibitor. Oleana-2,12-dien-28-oic acid can be used in hepatitis B virus infection disease research .

HY-N3239

Mulberrofuran G	NADPH Oxidase HBV
Mulberrofuran G protects ischemic injury-induced cell death via inhibition of NOX4-mediated ROS generation and ER stress . Mulberrofuran G shows moderate inhibiting activity of *hepatitis B virus (HBV)* DNA replication with IC₅₀ of 3.99 μM .

HY-13859

Clevudine L-FMAU	HBV DNA/RNA Synthesis Orthopoxvirus	Infection
Clevudine (L-FMAU), a nucleoside analog of the unnatural L-configuration, has potent *anti-HBV* activity with long half-life, low toxicity. Clevudine is a non-competitive inhibitor that is not incorporated into the viral DNA but rather binds to the polymerase. Clevudine is active against cowpox virus respiratory infection in mice .

HY-101954A

Inarigivir ammonium ORI-9020 ammonium; SB-9000 ammonium	HBV	Infection Inflammation/Immunology
Inarigivir (ORI-9020) ammonium is a dinucleotide antiviral drug that can significantly reduce liver *HBV* DNA in transgenic mice expressing hepatitis B virus. Inarigivir (ORI-9020) ammonium acts as a RIG-I (Retinoic acid-inducible gene-I) agonist to activate cellular innate immune responses .

HY-116364

AZT triphosphate 3'-Azido-3'-deoxythymidine-5'-triphosphate	HIV DNA/RNA Synthesis HBV Reactive Oxygen Species Apoptosis	Infection
AZT triphosphate (3'-Azido-3'-deoxythymidine-5'-triphosphate) is a active triphosphate metabolite of Zidovudine (AZT). AZT triphosphate exhibits antiretroviral activity and inhibits replication of HIV. AZT triphosphate also inhibits the DNA polymerase of *HBV. AZT triphosphate activates the mitochondria-mediated apoptosis* pathway .

HY-109195

Vebicorvir 1 Publications Verification ABI-H0731	HBV	Infection Inflammation/Immunology
Vebicorvir (ABI-H0731) is a first-generation *hepatitis B virus (HBV) core protein* inhibitor. Vebicorvir (ABI-H0731) suppresses covalently closed circular DNA (cccDNA) formation in two de novo infection models with EC₅₀s from 1.84 μM to 7.3 μM .

HY-145060

HBV-IN-13

HBV Infection

HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor. From patent WO2021204252A1, compound 1_B .

HBV-IN-13	HBV	Infection
HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor. From patent WO2021204252A1, compound 1_B .

HY-145053

HBV-IN-10	HBV	Infection
HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC₅₀ ≤0.05 μM). From patent WO2021204258A1, compound 6 .

HY-145053A

(5S,8R)-HBV-IN-10	HBV	Infection
(5S,8R)-HBV-IN-10 is an enantiomer of compound 6 (WO2021204258A1). Compound 6 is a hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC₅₀ ≤0.05 μM). From patent WO2021204258A1, compound 6 .

HY-116364A

AZT triphosphate TEA 3'-Azido-3'-deoxythymidine-5'-triphosphate TEA	HIV DNA/RNA Synthesis HBV Reactive Oxygen Species Apoptosis	Infection
AZT triphosphate (3'-Azido-3'-deoxythymidine-5'-triphosphate) TEA is a active triphosphate metabolite of Zidovudine (AZT). AZT triphosphate TEA exhibits antiretroviral activity and inhibits replication of HIV. AZT triphosphate TEA also inhibits the DNA polymerase of *HBV. AZT triphosphate TEA activates the mitochondria-mediated apoptosis* pathway .

HY-116364B

AZT triphosphate tetraammonium 3'-Azido-3'-deoxythymidine-5'-triphosphate tetraammonium	HIV DNA/RNA Synthesis HBV Reactive Oxygen Species Apoptosis	Infection
AZT triphosphate (3'-Azido-3'-deoxythymidine-5'-triphosphate) tetraammonium is an active triphosphate metabolite of Zidovudine (AZT). AZT triphosphate tetraammonium exhibits antiretroviral activity and inhibits replication of HIV. AZT triphosphate tetraammonium also inhibits the DNA polymerase of *HBV. AZT triphosphate tetraammonium activates the mitochondria-mediated apoptosis* pathway .

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-N3239

Mulberrofuran G	Structural Classification Source classification Phenols Polyphenols Plants Moraceae Morus alba Linn.	NADPH Oxidase HBV
Mulberrofuran G protects ischemic injury-induced cell death via inhibition of NOX4-mediated ROS generation and ER stress . Mulberrofuran G shows moderate inhibiting activity of *hepatitis B virus (HBV)* DNA replication with IC₅₀ of 3.99 μM .

HY-W676876

Oxynitidine	Structural Classification Alkaloids Other Alkaloids Source classification Rutaceae Zanthoxylum nitidum (Roxb.) DC. Plants	HBV
Oxynitidine is an *HBV* inhibitor (ID₅₀=30.8 µg/mL), which can effectively inhibit the DNA replication activity of HBV. Oxynitidine can be used in the study of viral infections .

HY-N10404

Junceellolide C	Classification of Application Fields Animals Terpenoids Source classification Diterpenoids Inflammation/Immunology Disease Research Fields	HBV
Junceellolide C is a transcription inhibitor of cccDNA. Junceellolide C inhibits *HBV* DNA replication and significantly decreases the level of supernatant *HBV* RNA with EC₅₀ values of 5.19, 3.52 μM respectively in HepAD38 cells. Junceellolide C is a potent anti-HBV agent .

HY-N12840

Logmalicid B	Structural Classification Iridoids Cornaceae Cornus officinalis Sieb. et Zucc. Terpenoids Source classification Plants	Others
Logmalicid B is an iridoid glycoside compound that can be isolated from Cornus officinalis and can be used in diabetes research .

Cat. No.	Product Name	Chemical Structure

HY-B1826S2

Adefovir-d4
Adefovir-d₄ is the deuterium labeled Adefovir. Adefovir (GS-0393) is an adenosine monophosphate analog antiviral agent that after intracellular conversion to Adefovir diphosphate inhibits HBV DNA polymerase. Adefovir has an IC50 of 0.7 μM against HBV in the HepG2.2.15 cell line. Adefovir has good antiviral activity against several viruses, including HBV and herpesviruses[1][2][3].

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:

HBV DNA

Inhibitors & Agonists

NaturalProducts

Isotope-Labeled Compounds

Click Chemistry

Natural
Products