1. Search Result
Search Result
Pathways Recommended: Anti-infection
Results for "

chronic infection

" in MedChemExpress (MCE) Product Catalog:

35

Inhibitors & Agonists

3

Screening Libraries

1

Peptides

2

Inhibitory Antibodies

2

Natural
Products

3

Isotope-Labeled Compounds

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-121513

    2'-Deoxy-L-cytidine; L-dC

    HBV Infection
    Torcitabine (2'-Deoxy-L-cytidine) is an antiviral agent. Torcitabine has the potential for chronic hepatitis B virus infection treatment .
    Torcitabine
  • HY-117411A

    KW-136 dihydrochloride

    HCV HCV Protease Infection
    Coblopasvir (KW-136) dihydrochloride is a pangenotypic non-structural protein 5A (NS5A) inhibitor. Coblopasvir dihydrochloride can be used for research of chronic hepatitis C virus infection .
    Coblopasvir dihydrochloride
  • HY-145713

    HBV Infection
    HBV-IN-19 inhibits hepatitis B virus (HBV) infection. Inhibiting HBsAg secretion and/or production is a strategy for the treatment of HBV infection, including chronic HBV infection .
    HBV-IN-19
  • HY-145713A

    HBV Infection
    HBV-IN-19 TFA inhibits hepatitis B virus (HBV) infection. Inhibiting HBsAg secretion and/or production is a strategy for the treatment of HBV infection, including chronic HBV infection .
    HBV-IN-19 TFA
  • HY-117411

    KW-136

    HCV HCV Protease Infection Inflammation/Immunology
    Coblopasvir (KW-136) is a pangenotypic non-structural protein 5A (NS5A) inhibitor. Coblopasvir can be used for research of chronic hepatitis C virus infection .
    Coblopasvir
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-147217A

    ISIS 505358 sodium

    HBV Infection
    Bepirovirsen sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-A0062
    Telithromycin
    5 Publications Verification

    HMR3647; RU66647

    Bacterial Antibiotic Infection Inflammation/Immunology
    Telithromycin (HMR3647) is a novel ketolide antibiotic that structurally resembles macrolides. Telithromycin belongs to the ketolide family that is characterized by a keto group at position 3 of the macrolide ring and is active against bacteria causing community-acquired pneumonia, acute exacerbation of chronic bronchitis, and acute sinusitis. Telithromycin also has similar immunomodulatory effects as macrolides. Telithromycin can be used for the research of respiratory infections including bronchial asthma .
    Telithromycin
  • HY-150217

    ODN 10101

    Toll-like Receptor (TLR) HCV Infection Inflammation/Immunology
    CpG ODN 10101, a synthetic oligodeoxynucleotide (ODN),  is a toll-like receptor 9 (TLR9) agonist. CpG ODN 10101 is a potent inducer of cytokine/chemokine expression ex vivo when used in combination with HH2(VQLRIRVAVIRA-NH2). CpG ODN 10101 induces IFN- secretion from dendritic cells (DCs) and stimulates B-cells.CpG ODN 10101 has antiviral and immunomodulatory properties that can influence chronic infection with HCV .
    CpG ODN 10101
  • HY-B1235
    Acetohydroxamic acid
    1 Publications Verification

    N-Hydroxyacetamide

    Bacterial Infection
    Acetohydroxamic acid (AHA) is a potent irreversible bacterial and plant urease inhibitor that can be used to study chronic urinary tract infections.
    Acetohydroxamic acid
  • HY-P99954

    Bacterial Infection
    Rivabazumab pegol is a PcrV protein antibody that can be used to study the phase II pegylated Fab of chronic Pseudomonas aeruginosa infection .
    Rivabazumab pegol
  • HY-B0277A

    ara-AMP; ara-A 5'-monophosphate

    HBV Antibiotic Infection
    Vidarabine phosphate (Ara-AMP), an antiviral agent, inhibits chronic HBV infection . Vidarabine phosphate also against herpes simplex and varicella zoster viruses .
    Vidarabine phosphate
  • HY-147358A

    Emitasvir; DAG-181

    HCV Infection
    Yimitasvir (Emitasvir) is an orally active hepatitis C virus (HCV) nonstructural protein 5A (NS5A) inhibitor. Yimitasvir can be used for research of chronic HCV infection .
    Yimitasvir
  • HY-147358

    Emitasvir diphosphate; DAG-181 diphosphate

    HCV Infection
    Yimitasvir (Emitasvir) diphosphate is an orally active hepatitis C virus (HCV) nonstructural protein 5A (NS5A) inhibitor and can be used for research of chronic hepatitis C virus infection .
    Yimitasvir diphosphate
  • HY-147358C

    (1R,4S)-Emitasvir diphosphate; (1R,4S)-DAG-181 diphosphate

    HCV Infection
    Yimitasvir (Emitasvir) diphosphate is an orally active hepatitis C virus (HCV) nonstructural protein 5A (NS5A) inhibitor and can be used for research of chronic hepatitis C virus infection .
    (1R,4S)-Yimitasvir diphosphate
  • HY-N0172S

    3,4-Dihydroxycinnamic acid-13C3

    Bacterial Fungal Infection
    Caffeic acid- 13C3 is an 13C labeled caffeic acid. Caffeic acid is a phytonutrient belonging to the flavonoids. Caffeic acid and its derivatives, are potential antimicrobial agents, chronic infection induced by microbes such as bacteria, fungi, and viruses[1].
    Caffeic acid-13C3
  • HY-151164

    Bacterial Infection
    LasR-IN-2 is a LasR inhibitor that forms H-bonding with TRY-56 residue. LasR-IN-2 can be used in the research of bacterial infection, neutropenia, severe burns and chronic lung disease in cystic fibrosis (CF) .
    LasR-IN-2
  • HY-N8168

    HBV Infection
    LPRP-Et-97543 is a potent anti-HBV agent. LPRP-Et-97543 reduces Core, S, and preS but not X promoter activities. LPRP-Et-97543 can be used for acute and chronic HBV infections research .
    LPRP-Et-97543
  • HY-17452

    ME 1206

    Beta-lactamase Bacterial Infection Inflammation/Immunology
    Cefditoren sodium (ME 1206) is a broad-spectrum, third-generation, oral cephalosporin antibacterial with enhanced stability against many common β lactamases. Cefditoren sodium has activity against Gram-negative organisms and Gram-positive organisms. Cefditoren sodium can be used in the research of infection diseases such as acute exacerbations of chronic bronchitis, community-acquired pneumonia (CAP), streptococcal pharyngitis/tonsillitis, or uncomplicated skin and skin structure infections .
    Cefditoren sodium
  • HY-116229

    SB-265805; LB20304

    Antibiotic Bacterial Infection
    Gemifloxacin, a fluoroquinolone, is a potent and orally active antipneumococcal agent. Gemifloxacin shows bactericidal activity against highly quinolone-resistant pneumococci.Gemifloxacin can be used for the research of respiratory infections, such as community-acquired pneumonia (CAP) and acute exacerbation of chronic bronchitis (AECB) .
    Gemifloxacin
  • HY-B1002
    Oxolinic acid
    3 Publications Verification

    Bacterial Antibiotic DNA/RNA Synthesis Infection
    Oxolinic acid is an antibiotic against both Gram-negative and Gram-positive bacteria. Oxolinic acid can be used for the research of acute and chronic urinary tract infections. Oxolinic acid is a DNA/RNA synthesis inhibitor. Oxolinic acid acts a dopamine uptake inhibitor and stimulants locomotor effect in mice .
    Oxolinic acid
  • HY-17452A

    Cefditoren pivoxyl; Cefditoren pivaloyloxymethyl ester; ME 1207

    Beta-lactamase Bacterial Antibiotic Infection Inflammation/Immunology
    Cefditoren Pivoxil (ME 1207) is a broad-spectrum, third-generation, oral cephalosporin antibacterial with enhanced stability against many common β lactamases. Cefditoren Pivoxil has activity against Gram-negative organisms and Gram-positive organisms. Cefditoren Pivoxil can be used in the research of infection diseases such as acute exacerbations of chronic bronchitis, community-acquired pneumonia (CAP), streptococcal pharyngitis/tonsillitis, or uncomplicated skin and skin structure infections .
    Cefditoren (Pivoxil)
  • HY-B0024
    Prulifloxacin
    1 Publications Verification

    NM441

    Bacterial Antibiotic Infection
    Prulifloxacin (NM441) is an orally active fluoroquinolone antibiotic with a broad spectrum of activity against Gram-positive and -negative bacteria. Prulifloxacin is a proagent of a thiazeto-quinoline carboxylic acid derivative Ulifloxacin (NM394). Prulifloxacin has the potential for lower urinary tract infections and exacerbations of chronic bronchitis .
    Prulifloxacin
  • HY-B1002S

    Bacterial Antibiotic DNA/RNA Synthesis Infection
    Oxolinic acid-d5 is the deuterium labeled Oxolinic acid. Oxolinic acid is an antibiotic against both Gram-negative and Gram-positive bacteria. Oxolinic acid can be used for the research of acute and chronic urinary tract infections. Oxolinic acid is a DNA/RNA synthesis inhibitor. Oxolinic acid acts a dopamine uptake inhibitor and stimulants locomotor effect in mice[1][2][3].
    Oxolinic acid-d5
  • HY-B1002R

    Bacterial Antibiotic DNA/RNA Synthesis Infection
    Oxolinic acid (Standard) is the analytical standard of Oxolinic acid. This product is intended for research and analytical applications. Oxolinic acid is an antibiotic against both Gram-negative and Gram-positive bacteria. Oxolinic acid can be used for the research of acute and chronic urinary tract infections. Oxolinic acid is a DNA/RNA synthesis inhibitor. Oxolinic acid acts a dopamine uptake inhibitor and stimulants locomotor effect in mice .
    Oxolinic acid (Standard)
  • HY-13337

    INX-08189

    HCV Infection
    BMS-986094 (INX-08189) is a potent inhibitor of hepatitis C virus (HCV) replication, with an EC50 of 35 nM at 24 h in Huh-7 cells. BMS-986094 is a phosphoramidate proagent of 6-O-methyl-2’-C-methyl guanosine. BMS-986094 can be used for the research of chronic HCV infection .
    BMS-986094
  • HY-149308

    Macrophage migration inhibitory factor (MIF) Infection
    MKA031 (compound 6y) is a non-competitive MIF inhibitor with an IC50 value of 1.7 μM. MKA031 (compound 6y) interferes with MIF/AIF interaction, MIF nuclear translocation, and N-methyl-N'-nitro-N-nitrosoguanidine (MNNG)-induced dependent cell death. MKA031 can be used in the study of chronic hepatitis C virus infection .
    MKA031
  • HY-15256

    BI 201335

    HCV Protease Infection
    Faldaprevir (BI 201335) is a potent, orally active and selective noncovalent inhibitor of NS3/4A protease of HCV (hepatitis C virus) genotypes 1a and 1b, with Ki values of 2.6 and 2.0 nM, respectively. Faldaprevir inhibits HCV RNA replication, with EC50 values of 6.5 and 3.1 nM, respectively. Faldaprevir has potent antiviral activity against chronic HCV infection .
    Faldaprevir
  • HY-P990029

    PD-1/PD-L1 Infection Cancer
    Eciskafusp alfa is a programmed cell death 1 (PDCD1, best known as PD-1) cis-targeted IL2v immunocytokine. Eciskafusp alfa preferentially targets antigen-specific stem-like PD-1+ TCF-1+ CD8+ T cells and differentiates them towards a novel population of better effectors. Eciskafusp alfa can be used for the research of cancer and chronic infections .
    Eciskafusp alfa
  • HY-124623

    Parasite Infection
    DNDI-8219 (compound 58) is a potent selective and orally active trypanocidal agent, possessing inhibitory activity against Trypanosoma cruzi (T. cruzi) with an IC50 of 0.4 μM. DNDI-8219 has low cytotoxicity (L6 cells IC50 > 100 μM). DNDI-8219 can effectively cure chronic T. cruzi infection and markedly reduce parasite burdens in mouse model. DNDI-8219 has good solubility, metabolic stability and safety.
    DNDI-8219
  • HY-163124

    HBV Infection
    HBV-IN-43 (compound 5832) is a potent inhibitor of HBV .
    HBV-IN-43
  • HY-151134

    HBV Infection
    HBV-IN-25 is a good potency, orally active novel HBV cccDNA reducer. HBV-IN-25 has anti-HBeAg potency and anti-HBV activity with IC50 values of 0.58 μM and 1.15 μM, respectively. HBV-IN-25 has good aqueous solubility (LYSA>452 μg/mL) and good PK property with no cellular toxicity .
    HBV-IN-25
  • HY-B1588S

    Amyloid-β HIV 11β-HSD Infection Neurological Disease Inflammation/Immunology
    Carbenoxolone-d4 is deuterium labeled Carbenoxolone. Carbenoxolone, a semi-synthetic derivative of glycyrrhetinic acid, has previously been used for the management of dyspepsia and peptic ulcer because of its anti-inflammatory properties[3]. Carbenoxolone, a general hemichannel and gap junction inhibitor, has the therapeutic potential of carbenoxolone in the research of chronic liver disease[2]. Carbenoxolone is a suitable candidate for the inhibition of Aβ42 aggregation and the therapeutic potential of Cbx against AD[1]. Carbenoxolone is small molecule Pannexin1 (Panx1,is an ATP release channel) inhibitor, attenuate Panx1 channel activity through modulation of the first extracellular loop[4].Carbenoxolone is an 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) inhibitor that converts inactive glucocorticoid into an active form. Carbenoxolone has antiviral activity against DENV infection targeting the virus itself[6].
    Carbenoxolone-d4
  • HY-117626

    AAK1 Cyclin G-associated Kinase (GAK) SARS-CoV Infection Neurological Disease Inflammation/Immunology
    LP-935509 is an orally active, potent, selective, ATP-competitive and brain-penetrant inhibitor of adaptor protein-2 associated kinase 1 (AAK1) with an IC50 of 3.3 nM and a Ki of 0.9 nM, respectively. LP-935509 is also a potent inhibitor of BIKE (IC50=14 nM) and a modest inhibitor of GAK (IC50=320 nM). LP-935509 shows antinociceptive activity. LP-935509 can be used for neuropathic pain and SARS-CoV-2 research .
    LP-935509
  • HY-W352344

    HBV Infection
    2'-Deoxy-L-adenosine is an orally active synthon for modified oligodeoxyribonucleotides. 2'-Deoxy-L-adenosine is a potent, specific and selective inhibitor of the replication of hepatitis B virus (HBV) as well as the closely related duck and woodchuck hepatitis viruses (WHV) .
    2'-Deoxy-L-adenosine

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: