1. Search Result
Search Result
Results for "

( )-Zuonin A

" in MedChemExpress (MCE) Product Catalog:

9871

Inhibitors & Agonists

23

Fluorescent Dye

106

Biochemical Assay Reagents

181

Peptides

79

Inhibitory Antibodies

939

Natural
Products

2959

Recombinant Proteins

38

Isotope-Labeled Compounds

609

Antibodies

7

Click Chemistry

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-N7394A
    (-)-Zuonin A
    1 Publications Verification

    D-Epigalbacin

    JNK Cancer
    (-)-Zuonin A (D-Epigalbacin), a naturally occurring lignin, is a potent, selective JNKs inhibitor, with IC50s of 1.7 μM, 2.9 μM and 1.74 μM for JNK1, JNK2 and JNK3, respectively .
    (-)-<em>Zuonin</em> <em>A</em>
  • HY-132595

    QPI-1002

    Small Interfering RNA (siRNA) MDM-2/p53 Cancer
    Teprasiran (QPI-1002) is a small interfering RNA that temporarily inhibits p53-mediated cell death that underlies acute kidney injury (AKI) .
    Teprasiran
  • HY-N10943

    Others Others
    (+)-Zuonin A is a lignin. (+)-Zuonin A can be isolated from Aristolochia chilensis .
    (+)-<em>Zuonin</em> <em>A</em>
  • HY-P10319

    PKA Cardiovascular Disease Cancer
    RI-STAD-2 is a high-affinity interfering peptide that regulates the subunit RI of protein kinase A (PKA). RI-STAD-2 interferes with the binding of AKAPs and PKA-RI by simulating the interaction between AKAPs' α-helix domain and PKA-RI's dimerization/anchoration (D/D) domain, thereby affecting PKA activity and intracellular localization. RI-STAD-2 can be used to study the role of AKAPs interaction with PKA-RI in pathological processes such as cardiovascular disease and cancer .
    RI-STAD-2
  • HY-147412

    QR-421a

    Others Others
    Ultevursen (QR-421a) is a single-stranded RNA based oligonucleotide that is designed to skip exon 13 in the RNA with the aim to stop vision loss in people that have retinitis pigmentosa due to a mutation in exon 13 of the USH2A gene (encoding usherin). Ultevursen sequence: (P-thio)[2′-O-(2-methoxyethyl)](A-G-m 5C-m 5U-m 5U-m 5C-G-G-A-G-A-A-A-m 5U-m 5U-m 5U-A-A-A-m 5U-m 5C) .
    Ultevursen
  • HY-150751

    ODN A151

    Toll-like Receptor (TLR) AIM2 Inflammation/Immunology
    ODN TTAGGG (A151), inhibitory oligonucleotide (ODN), is a TLR9, AIM2 and cGAS antagonist. ODN TTAGGG is immunosuppressive and inhibits AIM2 inflammasome activation, as well as cGAS activation, by competing with DNA. ODN TTAGGG can be used in the study of lupus erythematosus and other related autoimmune diseases. ODN TTAGGG sequence: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3' .
    ODN TTAGGG
  • HY-157084

    ROS Kinase Bacterial Infection
    HS-291 is a HtpG inhibitor of Borrelia burgdorferi (Bb). HS-291 contains BX-2819 (high affinity for Bb HtpG), PEG linker, and Verteporfin (HY-B0146) (a photoactive toxin).HS-291 produces reactive oxygen species under light activation to oxidize HtpG and a discrete protein subset near chaperone proteins and can quickly and irreversibly inactivate Bb .
    HS-291
  • HY-111954

    Erinacine A

    Others Neurological Disease Cancer
    (+)-Erinacin A is an anticancer compound that can be isolated from the mushroom Hericium erinaceum. (+)-Erinacin A has the capacity to trigger cancer cell death dependent on the production of reactive oxygen species (ROS). (+)-Erinacin A has anticancer and neuroprotective activity .
    (+)-Erinacin <em>A</em>
  • HY-W039943

    Molecular Glues Cancer
    Acetyl-cyclosporin A aldehyde is an acetylated Cyclosporin A (HY-B0579) derivative with a reducing aldehyde group. Cyclosporin A is a potent calmodulin inhibitor and cyclophilin binder that can target the nuclear translocation of NF-AT and cause mitochondrial damage.
    Acetyl-cyclosporin <em>A</em> aldehyde
  • HY-134428

    Endogenous Metabolite Metabolic Disease
    Arachidonoyl coenzyme A lithium is an unsaturated fatty acyl coenzyme A, formed by the condensation of the thiol group of coenzyme A with the carboxyl group of arachidonic acid .
    Arachidonoyl coenzyme <em>A</em> lithium
  • HY-156133

    Others Others
    Dihydrospinosyn A aglycone (compound 2) is a derivative of spinosyn A aglycone with a hydrolyzed C9- and C17-glycosidic bond.
    Dihydrospinosyn <em>A</em> aglycone
  • HY-134424

    Endogenous Metabolite Metabolic Disease
    Propionyl coenzyme A lithium, a coenzyme A derivative of propionic acid, is an important metabolic intermediate formed by the thioester bond between coenzyme A and propionic acid. The breakdown and production of Propionyl coenzyme A lithim is important for the metabolism of organisms .
    Propionyl coenzyme <em>A</em> lithium
  • HY-N3226

    NO Synthase Inflammation/Immunology
    Myricananin A is a colorless needle that has inhibitory effect on iNOS .
    Myricananin <em>A</em>
  • HY-132596

    SYL1001

    Small Interfering RNA (siRNA) TRP Channel Neurological Disease
    Tivanisiran (SYL1001) is a siRNA used for the study of dry eye disease. Tivanisiran was designed to silence transient receptor potential vanilloid 1 (TRPV1) .
    Tivanisiran
  • HY-132609

    Small Interfering RNA (siRNA) Transthyretin (TTR) Neurological Disease
    Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis .
    Patisiran sodium
  • HY-132602

    MRG-201

    MicroRNA Inflammation/Immunology
    Remlarsen (MRG-201), a miR-29b mimic, acts a miR-29b agonist. Remlarsen has the potential for preventiong formation of a fibrotic scar or cutaneous fibrosis .
    Remlarsen
  • HY-117175

    (+)-Pandamarilactonine A

    Others Others
    Pandamarilactonine A converted from Norpandamarilactonine-A of (S)-prolinol .
    Pandamarilactonine <em>A</em>
  • HY-150724

    1018 ISS

    Toll-like Receptor (TLR) Inflammation/Immunology
    ODN 1018 (1018 ISS), an oligodeoxynucleotide, is a TLR-9 agonist. ODN 1018 is also a synthetic immunostimulatory sequence that can be used as vaccine adjuvant. Sequence: 5′-TGACTGTGAACGTTCGAGATGA-3′ .
    ODN 1018
  • HY-N8488

    Others Others
    Anhydro-6-epiophiobolin A, an analog of Ophiobolin A, is a potent inhibitor of photosynthesis (I50s of 6.1 and 1 mM for photosynthesis in Chlorella and Spinach, respectively) .
    Anhydro-6-epiophiobolin <em>A</em>
  • HY-N10509

    A-Trisaccharide

    Others Others
    Blood-group A trisaccharide (A-Trisaccharide) is a oligosaccharide present in the urine of blood group A secretors .
    Blood-group <em>A</em> trisaccharide
  • HY-148100

    NOX-E36

    Others Inflammation/Immunology Cancer
    Emapticap pegol is a inhibitor of pro-inflammatory chemokine C-C motif-ligand 2 (CCL2). Emapticap pegol is a 40-nucleotide oligonucleotide aptamer, displays different Spiegelmers (L-RNA aptamer) isform in human (NOX-E36) and mouse (mNOX-E36) .
    Emapticap pegol
  • HY-N8488A

    Others Others
    Anhydroophiobolin A is a potent inhibitor of photosynthesis with IC50s of 77 and 14 mM in the photosynthesis of chlorella and spinach, respectively. Anhydroophiobolin A is an analog of Ophiobolin A .
    Anhydroophiobolin <em>A</em>
  • HY-D1544

    Fluorescent Dye Others
    Uniblue A sodium is a reactive protein stain that can be used in the covalent pre-gel staining of the protein (Ex=594 nM) .
    Uniblue <em>A</em> sodium
  • HY-P5732

    Bacterial Infection
    Tryglysin A is an antimicrobial peptide inhibits the growth of other streptococci .
    Tryglysin <em>A</em>
  • HY-N3776

    Others Others
    Dorsmanin A is a prenylated flavonoid from the twigs of Dorstenia mannii .
    Dorsmanin <em>A</em>
  • HY-145720

    ALN-CC5

    Small Interfering RNA (siRNA) Complement System Others
    Cemdisiran is an N-acetylgalactosamine (GalNAc) conjugated siRNA for the research of complement-mediated diseases by suppressing liver production of complement 5 (C5) protein.
    Cemdisiran
  • HY-145728

    ISIS-2302

    Integrin Inflammation/Immunology
    Alicaforsen is a 20-base antisense oligonucleotide inhibiting ICAM-1 production, which is an important adhesion molecule involved in leukocyte migration and trafficking to the site of inflammation.
    Alicaforsen
  • HY-112980

    DNA/RNA Synthesis Inflammation/Immunology
    Nusinersen is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
    Nusinersen
  • HY-150750

    Toll-like Receptor (TLR) Apoptosis Inflammation/Immunology Cancer
    ODN M362, a class C oligodeoxynucleotide, is a TLR-9 agonist and can be used as a vaccine adjuvant. ODN M362 induces cancer cell apoptosis .
    ODN M362
  • HY-132587

    ALN-AT3SC; SAR439774

    Small Interfering RNA (siRNA) Factor Xa Others
    Fitusiran (ALN-AT3SC), an small interfering RNA, specifically targets antithrombin (AT) messenger RNA to lower production of AT in the liver. Fitusiran increases thrombin generation and has the potential for the research of the hemophilia .
    Fitusiran
  • HY-E70259

    Endogenous Metabolite Metabolic Disease
    18:2 (n6) Coenzyme A triammonium is a Coenzyme A. 18:2 (n6) Coenzyme A triammonium can be used to determine the effects of lysophospholipid acyltransferase activities in adipocyte differentiation .
    18:2 (n6) Coenzyme <em>A</em> triammonium
  • HY-148130

    RG6091; RO7248824

    E1/E2/E3 Enzyme Others
    Rugonersen (RG6091; RO7248824) is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
    Rugonersen
  • HY-143230

    OGX-011

    Apoptosis Cancer
    Custirsen is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.
    Custirsen
  • HY-145726

    TNF Receptor Inflammation/Immunology
    ISIS 104838 is an antisense oligonucleotide agent that reduces the production of tumor necrosis factor (TNF-alpha), a substance that contributes to joint pain and swelling in rheumatoid arthritis.
    ISIS 104838
  • HY-142118

    AP 12009

    TGF-beta/Smad Cancer
    Trabedersen (AP 12009) is an antisense oligodeoxynucleotide that specifically inhibits TGF-β2 (TGF-beta/Smad). Trabedersen can be used for the study of malignant brain tumors and other solid tumors overexpressing TGF-β2, such as those of the skin, pancreas and colon .
    Trabedersen
  • HY-146245

    CpG 1826

    Toll-like Receptor (TLR) Apoptosis Inflammation/Immunology Cancer
    ODN 1826 (CpG 1826), a class B CpG ODN (oligodeoxynucleotide), is a TLR9 agonist. ODN 1826 promotes Apoptosis. ODN 1826 is an excellent immune stimulator with antitumor activity. ODN 1826 has protective effects on the heart. ODN 1826 sequence: 5’-tccatgacgttcctgacgtt-3’ .
    ODN 1826
  • HY-150729

    Others Inflammation/Immunology
    ODN 1982 is a unmethylated oligodeoxyribonucleotide (ODN) with no CpG motif, can be used to prepare DNA vaccines. ODN 1982 inhibits R-848 signaling. ODN 1982 sequence: 5’-tccaggacttctctcaggtt-3’ .
    ODN 1982
  • HY-150726

    Toll-like Receptor (TLR) Inflammation/Immunology
    ODN 1668, a class B CpG ODN (oligodeoxynucleotide), is a TLR-9 agonist. ODN 1668 is an immunostimulatory sequence and can be used as vaccine adjuvant. Sequence: 5'-tccatgacgttcctgatgct-3’ .
    ODN 1668
  • HY-141474

    Biochemical Assay Reagents Others
    Glutaryl coenzyme A lithium is a Glutaryl coenzyme A derivative. Glutaryl coenzyme A is an important endogenous metabolites. Glutaryl coenzyme A lithium can be used in HMG-CoA or Glutaryl-CoA related experiment.
    Glutaryl coenzyme <em>A</em> lithium
  • HY-132593

    WVE-120101

    Huntingtin Neurological Disease
    Rovanersen (WVE-120101) is an antisense oligonucleotide that specifically targets mutated mRNA copies of the huntington (HTT) gene without affecting healthy mRNA of HTT gene, thereby preventing the production of faulty Huntingtin protein. Rovanersen can be used for huntington’s disease research .
    Rovanersen
  • HY-150214

    Others Cancer
    ODN MT01 was designed based on human mitochondrial DNA sequences, which is an inhibitory ODN that promotes osteocyte differentiation. ODN MT01 could promote osteoblast maturation and activation in rats, reduce rat alveolar bone absorption caused by periodontitis, regulate the expression levels of osteogenesis-related factors.
    ODN MT01
  • HY-150748

    Toll-like Receptor (TLR) Inflammation/Immunology Cancer
    ODN D-SL01, a class B CpG ODN (oligodeoxynucleotide), is a TLR9 agonist. ODN D-SL01 has strong immunostimulatory activity in a variety of vertebrate species and has anticancer activity. ODN D-SL01 sequence: 5'- T-C-G-C-G-A-C-G-T-T-C-G-C-C-C-G-A-C-G-T-T-C-G-G-T-A-3' .
    ODN D-SL01
  • HY-118593

    Madumycin II; Antibiotic A 2315A

    Antibiotic Infection
    A2315A (Madumycin II) is an alanine-containing streptogramin A antibiotic. A2315A is a potent peptidyl transferase center (PTC) inhibitor. A2315A inhibits the ribosome prior to the first cycle of peptide bond formation .
    <em>A</em>2315<em>A</em>
  • HY-132591

    ALN-PCSsc

    Small Interfering RNA (siRNA) Ser/Thr Protease Cardiovascular Disease
    Inclisiran (ALN-PCSsc) is a double-stranded small interfering RNA (siRNA) molecule that inhibits the transcription of PCSK-9. Inclisiran can be used for hyperlipidemia and cardiovascular disease (CVD) research .
    Inclisiran
  • HY-P1957

    Parasite Infection
    Dihydrocyclosporin A is a derivative of Cyclosporine A (HY-B0579). Dihydrocyclosporin A significantly inhibites promastigotes and intracellular amastigotes. Dihydrocyclosporin A is highly cytotoxic .
    Dihydrocyclosporin <em>A</em>
  • HY-N6595

    Others Others
    Lucidone A is a lanostanoid isolated from the fruiting bodies of G. resinaceum. lucidone A showed inhibitory effects against the increase of ALT and AST levels in HepG2 cells induced by H2O2 compared to a control group in the range of their maximum non-toxic concentration (MNTC) .
    Lucidone <em>A</em>
  • HY-132610

    ALN-AS1

    Small Interfering RNA (siRNA) Neurological Disease
    Givosiran (ALN-AS1) is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid and porphobilinogen levels. Givosiran can be used for the research of acute intermittent porphyria .
    Givosiran
  • HY-147278

    Small Interfering RNA (siRNA) Ser/Thr Protease Others
    Manusiran is a potent TMPRSS6 (transmembrane protease serine 6) synthesis reducer .
    Manusiran
  • HY-148089

    Transthyretin (TTR) Neurological Disease
    Eplontersen is a triantennary N-acetyl galactosamine (GalNAc3-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases .
    Eplontersen
  • HY-147217

    ISIS 505358

    HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: