Tau Protein Inhibitor

Tau Protein Inhibitors (26):

Cat. No.	Product Name	Effect	Purity

HY-134968

TTBK1-IN-1	Inhibitor	99.53%
TTBK1-IN-1 is a potent, selective and brain-penetrant tau tubulin kinase 1 (TTBK1) inhibitor with an IC₅₀ of 2.7 nM. TTBK1-IN-1 can be used for the research of alzheimer’s disease and related tauopathies. TTBK1-IN-1 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

HY-P99399

Semorinemab	Inhibitor	99.90%
Semorinemab (RG 6100) is an anti-Tau humanized IgG4 monoclonal antibody, targets the N-terminal portion of the Tau protein (amino acid residues 6-23). Semorinemab binds with human Tau with a K_d value of 3.8 nM. Semorinemab can be used for the research of Alzheimer's Disease.

HY-156585

CNS-11	Inhibitor	98.88%
CNS-11 is a compoud that disaggregates tau fibrils. CNS-11 can be used for Alzheimer's disease (AD) research.

HY-161328

MAO-B-IN-31	Inhibitor
MAO-B-IN-31 (Compound 30) is an effective and selective inhibitor of monoamine oxidase B (monoamine oxidase B). The IC₅₀ value is 41 nM. MAO-B-IN-31 also inhibits α-syn and tau aggregation. MAO-B-IN-31 has neuroprotective activity.

HY-162020

SB1617	Inhibitor
SB1617 is a neuroinflammation-modulating agent, and has neuroprotective effect by reducing pathogenic tau levels through microglia-mediated anti-inflammatory activity.

HY-132582

IONIS-MAPTRx	Inhibitor
IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease.

HY-154851

GSK-3 inhibitor 3	Inhibitor	98.72%
GSK-3 inhibitor 3 is a selective, orally active and brain-penetrant inhibitor of GSK-3, with IC₅₀s of 0.35 nM and 0.25 nM for GSK-3α and GSK-3β, respectively. GSK-3 inhibitor 3 lowers levels of tau protein phosphorylation at S396 in a triple-transgenic mouse Alzheimer’s disease model, with IC₅₀ of 10 nM. GSK-3 inhibitor 3 can be used for neurological disease research.

HY-P99471

Bepranemab	Inhibitor	99.79%
Bepranemab (UCB 0107) is a humanized, full-length IgG4 monoclonal antibody that binds to a central tau epitope (amino acids 235-250). Bepranemab can be used for Alzheimer’s disease (AD) research.

HY-P99648

Gosuranemab	Inhibitor
Gosuranemab (BMS-986168) is a humanised IgG4 anti-tau monoclonal antibody. Gosuranemab binds to human N-terminal tau residues 15-22. Gosuranemab has the potential for the research of alzheimer’s disease (AD).

HY-134968A

(R)-TTBK1-IN-1	Inhibitor	98.93%
(R)-TTBK1-IN-1 is a potent, selective and brain-penetrant tau tubulin kinase 1 (TTBK1) inhibitor. (R)-TTBK1-IN-1 is an enantiomer of TTBK1-IN-1 (HY-134968). (R)-TTBK1-IN-1 can be used in the research of alzheimer’s disease and related tauopathies. (R)-TTBK1-IN-1 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

HY-105022

Sabeluzole	Inhibitor
Sabeluzole (R 58735), a benzothiazol derivative, has antiischemic, antiepileptic, and cognitive-enhancing properties. Sabeluzole protects rat hippocampal neurons against NMDA- and glutamate-induced neurotoxicity via preventing tau expression. Sabeluzole enhances memory in rats, and prevents the amnesic effect of Chlordiazepoxide. Sabeluzole can be used fro research of Alzheimer's disease.

HY-153431

TRV-1387	Inhibitor
TRV-1387 is a benzofurazan that inhibits the aggregation of tau and amyloid-β.

HY-149237

hAChE-IN-2	Inhibitor
hAChE-IN-2 is a potent hAChE inhibitor, with an IC₅₀ of 0.71 μM. hAChE-IN-2 can also inhibits tau-oligomerization, with an EC₅₀ of 2.21 μM. hAChE-IN-2 exhibits neuroprotective activity.

HY-132582A

Tau ASO-12 (murine) (sodium)	Inhibitor
Tau^ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau^ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )

HY-149272

tau/Aβ40 aggregation-IN-1	Inhibitor
tau/Aβ40 aggregation-IN-1 (Compound 20) is a tau and Aβ₄₀ aggregation inhibitor with IC₅₀s of 1.8 μM and 1.3 μM, respectively.

HY-149542

GSK-3β inhibitor 15	Inhibitor
GSK-3β inhibitor 15 (Compound 54) is a GSK-3β inhibitor (IC₅₀: 3.4 nM). GSK-3β inhibitor 15 inhibits Aβ_1-42-induced GSK-3β and tau protein phosphorylation. GSK-3β inhibitor 15 inhibits LPS-induced iNOS expression. GSK-3β inhibitor 15 has neuroprotective effects on Aβ_1-42-induced neurotoxicity. GSK-3β inhibitor 15 can be used for research of Alzheimer’s disease (AD).

HY-149418

BChE/HDAC6-IN-2	Inhibitor
BChE/HDAC6-IN-2 (compound 29a) is a dual inhibitor of BChE and HDAC6 with IC50s of 1.8 nM and 71.0 nM, respectively. BChE/HDAC6-IN-2 has prominently neuroprotective effects and reactive oxygen species (ROS) scavenging activity. BChE/HDAC6-IN-2 is also an effective chelator of metal ion (Fe2+ and Cu2+). BChE/HDAC6-IN-2 inhibits phosphorylation of tau, and exhibits moderate immunomodulatory effect.

HY-116753

(-)Clausenamide	Inhibitor
(-)Clausenamide is an active alkaloid isolated from the leaves of Clausena lansium (Lour.) Skeels, and improves cognitive function in both normal physiological and pathological conditions. (-)Clausenamide inhibits β-amyloid (Aβ) toxicity, blocking neurofibrillary tangle formation by inhibiting the phosphorylation of tau protein. (-)Clausenamide exerts a significant neuroprotective activity against Aβ_25-35. (-)Clausenamide can be used for researching Alzheimer's disease (AD).

HY-149233

hAChE-IN-1	Inhibitor
hAChE-IN-1 (Compound 24) is a potent hAChE inhibitor with an IC₅₀ of 1.09 μM. hAChE-IN-1 inhibits tau-oligomerization with an EC₅₀ of 2.71 μM in cellular tau FRET assay.

HY-13486

TAU-IN-1	Inhibitor
TAU-IN-1 (compound 051) is a TAU protein inhibitor with an EC₅₀ value of 325 nM. TAU-IN-1 can be used in the study of neurodegenerative diseases.

Name
Email *

	Sorry, but the email address you supplied was invalid.