1. Epigenetics
  2. MicroRNA
  3. hsa-miR-328-3p inhibitor

hsa-miR-328-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

For research use only. We do not sell to patients.

RNA, (ACGGAAGGGCAGAGAGGGCC) (full-length nucleotide 2'-methoxy modification)

hsa-miR-328-3p inhibitor Chemical Structure

Size Price Stock Quantity
5 nmol USD 110 Get quote 1-2 weeks 1-2 weeks
20 nmol USD 300 Get quote 1-2 weeks 1-2 weeks
Synthetic products have potential research and development risk.

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Customer Review

Based on 1 publication(s) in Google Scholar

Other Forms of hsa-miR-328-3p inhibitor:

Top Publications Citing Use of Products
  • Biological Activity

  • Purity & Documentation

  • Customer Review

Description

hsa-miR-328-3p inhibitors are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA inhibitors have full-length nucleotide 2'-methoxy modification. The miRNA inhibitors strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

In Vitro

1. miRNA Resuspension

1.1 Briefly centrifuge the tube to ensure that the dried miRNA is at the bottom of the tube.

1.2 Resuspend the miRNA using nuclease free water to generate 20 μM stock solution.

For 5 nmol miRNA: add 250 μL nuclease free water.

For 20 nmol miRNA: add 1000 μL nuclease free water.

1.3 Aliquot miRNAs into one or more tubes to limit the number of freeze-thaw cycles (<5).

1.4 Store at or below -20°C or -80°C in a non-frost-free freezer until use.

2. Prepare cells

2.1 Inoculate cells in advance for cell transfection.

Note: The viability and general health of cells prior to transfection significantly affect transfection result.

3. Transfection

3.1 Prepare transfection mix A and B.

For per well of a 6-well plate: A: 120 μL serum-free medium + 5 μL miRNA inhibitors; B: 121 μL serum-free medium + 4 μL PolyFast Transfection Reagent (HY-K1014).

For per well of a 24-well plate: A: 23.75 μL serum-free medium + 1.25 μL miRNA inhibitors; B: 24 μL serum-free medium + 1 μL PolyFast Transfection Reagent (HY-K1014).

For per well of a 96-well plate: A: 4.75 μL serum-free medium + 0.25 μL miRNA inhibitors; B: 4.8 μL serum-free medium + 0.2 μL PolyFast Transfection Reagent (HY-K1014).

Note: The recommended working concentration is 100nM for miRNA inhibitors. miRNA function can vary greatly, depending on the miRNA, the cell line, and the chosen analysis method. To determine the concentration that provides optimal results, optimization experiments using varying mimic/inhibitor concentrations should be performed. The optimized range suggests changing the miRNA concentration in the range of 20 to 500nM.

If other transfection reagents are used, the amount of transfection reagent needs to be adjusted according to the specific situation.

3.2 Mix the diluted PolyFast Transfection Reagent and miRNA gently. Incubate at room temperature for 15 minutes.

3.3 Remove culture medium from cells, wash with PBS.

3.4 Add transfection mix (A+B) to cells.

For per well of a 6-well plate: add 1750 μL fresh medium without Pen/Strep, then add 250 μL of the transfection mix (A+B) to the well, and mix well.

For per well of a 24-well plate: add 450 μL fresh medium without Pen/Strep, then add 50 μL of the transfection mix (A+B) to the well, and mix well.

For per well of a 96-well plate: add 90 μL fresh medium without Pen/Strep, then add 10 μL of the transfection mix (A+B) to the well, and mix well.

3.5 Incubate cells for 1–3 days at 37°C. Then, analyze transfected cells. The medium can be replaced with fresh serum-containing medium after 6 hours if necessary.

MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.

Molecular Weight

6866.63

miRBase Accession Number
Mature miRNA Sequence

CUGGCCCUCUCUGCCCUUCCGU

Stem-loop ID

hsa-mir-328

Stem-loop Sequence

UGGAGUGGGGGGGCAGGAGGGGCUCAGGGAGAAAGUGCAUACAGCCCCUGGCCCUCUCUGCCCUUCCGUCCCCUG

Species

Human, Mouse, Rat, Bovine, Callithrix jacchus, Cricetulus griseus, Dog, Goat, Horse, Pan paniscus, Pan troglodytes, Pig, Pongo pygmaeus, Tupaia chinensis

Appearance

Solid

Color

Colorless to off-white

Shipping

Room temperature in continental US; may vary elsewhere.

Storage

-20°C, sealed storage, away from moisture

*In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

Purity & Documentation
  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.

hsa-miR-328-3p inhibitor Related Classifications

  • Molarity Calculator

  • Dilution Calculator

The molarity calculator equation

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass   Concentration   Volume   Molecular Weight *
= × ×

The dilution calculator equation

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)
× = ×
C1   V1   C2   V2
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Your Recently Viewed Products:

Inquiry Online

Your information is safe with us. * Required Fields.

Product Name

 

Salutation

Applicant Name *

 

Email Address *

Phone Number *

 

Organization Name *

Department *

 

Requested quantity *

Country or Region *

     

Remarks

Bulk Inquiry

Inquiry Information

Product Name:
hsa-miR-328-3p inhibitor
Cat. No.:
HY-RI00686
Quantity:
MCE Japan Authorized Agent: