Search Result
Results for "
Methoxyethyl
" in MedChemExpress (MCE) Product Catalog:
2
Biochemical Assay Reagents
2
Isotope-Labeled Compounds
Cat. No. |
Product Name |
Target |
Research Areas |
Chemical Structure |
-
- HY-W048496
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
2'-O-(2-Methoxyethyl)-cytidine is a synthetic oligonucleotide conversed from uridine. 2'-O-(2-Methoxyethyl)-uridine has the potential for chemotherapeutic agents development .
|
-
-
- HY-W048495
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
2'-O-(2-Methoxyethyl)-uridine is a synthetic oligonucleotide conversed from uridine. 2'-O-(2-Methoxyethyl)-uridine has the potential for chemotherapeutic agents development .
|
-
-
- HY-23789
-
2'-O-MOE-rG
|
Nucleoside Antimetabolite/Analog
|
Others
|
2′-O-(2-Methoxyethyl)guanosine (2'-O-MOE-rG), a 2′-O-methoxyethyl-modified nucleoside, can be produced by enzymatic conversion (adenosine deaminase) from 2′-O-(2-methoxyethyl)-2,6-diaminopurine riboside. 2′-O-(2-Methoxyethyl)guanosine neither effectively phosphorylated by cytosolic nucleoside kinases, nor are they incorporated into cellular DNA or RNA .
|
-
-
- HY-W013849S
-
-
-
- HY-154285
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
3’-O-(2-Methoxyethyl) uridine is a uridine analog. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents .
|
-
-
- HY-152577
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
3’-O-(2-Methoxyethyl) inosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152516
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
2’-O-(2-Methoxyethyl) inosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154434
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
3’-O-(2-Methoxyethyl)-5-methyluridine is a thymidine analog. Analogs of this series have insertional activity towards replicated DNA. They can be used to label cells and track DNA synthesis .
|
-
-
- HY-152480
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
3’-O-(2-Methoxyethyl)-5-methylcytidine is a cytidine analog. Cytidine analogs have a mechanism of inhibiting DNA methyltransferases (such as Zebularine, HY-13420), and have potential anti-metabolic and anti-tumor activities .
|
-
-
- HY-W048491
-
|
DNA/RNA Synthesis
|
Others
|
2′-O-(2-Methoxyethyl)adenosine is a compound can be used in the synthesis of oligonucleotides .
|
-
-
- HY-152482
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
3’-O-(2-Methoxyethyl)-2-thiouridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152549
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
2’-O-(2-Methoxyethyl)-2-aminoadenosine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-N1871
-
|
Others
|
Inflammation/Immunology
|
4-(2-Hydroxy-1-methoxyethyl)-1,2-benzenediol is a phenylethanoid isolated from the stem bark of Syringa reticulate (Bl.) Hara (Oleaceae) with expectorant and antiasthmatic activity .
|
-
-
- HY-152646
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
3’-O-(2-Methoxyethyl)-2-aminoadenosine is an adenosine analog. Adenosine analogs mostly act as smooth muscle vasodilators and have also been shown to inhibit cancer progression. Its popular products are adenosine phosphate, Acadesine (HY-13417), Clofarabine (HY-A0005), Fludarabine phosphate (HY-B0028) and Vidarabine (HY-B0277) .
|
-
-
- HY-152568
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N7-Methyl-2’-O-(2-methoxyethyl) guanosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152567
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N1-Methyl-2’-O-(2-methoxyethyl) guanosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152569
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N1-Methyl-2’-O-(2-methoxyethyl) adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152570
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N6-Methyl-2’-O-(2-methoxyethyl) adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152575
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N6-Methyl-3’-O-(2-methoxyethyl) adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152587
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N1-Methyl-3’-O-(2-methoxyethyl) inosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152571
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N1-Methyl-2’-O-(2-methoxyethyl) inosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152573
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N1-Methyl-3’-O-(2-methoxyethyl) adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154173
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
3’-O-(t-Butyldimethylsilyl)-2’-O-(2-methoxyethyl) uridine is a uridine analog. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents .
|
-
-
- HY-154240
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
2-Amino-2’,3’-bis-O-(2-methoxyethyl) adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154385
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
4’,5’-Didehydro-2’-O-(2-methoxyethyl)-5-methyluridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154290
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N3,5-Dimethyl-2’-O-(2-methoxyethyl) uridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154449
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N4-Benzoyl-3’-O-(2-methoxyethyl)-5-methylcytidine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-42084
-
p-Hydroxyphenethyl methyl ether
|
Biochemical Assay Reagents
|
Others
|
4-(2-Methoxyethyl)phenol is a biochemical reagent that can be used as a biological material or organic compound for life science related research.
|
-
-
- HY-152382
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
3’-O-(2-Methoxyethyl)cytidine is a cytidine analog. Cytidine analogs have a mechanism of inhibiting DNA methyltransferases (such as Zebularine, HY-13420), and have potential anti-metabolic and anti-tumor activities .
|
-
-
- HY-154386
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)-5-methyluridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc . 5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)-5-methyluridine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. Strain-promoted alkyne-azide cycloaddition (SPAAC) can also occur with molecules containing DBCO or BCN groups.
|
-
-
- HY-154543
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
5’-O-(4,4’-Dimethoxytrityl)-3’-O-(2-methoxyethyl) uridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154552
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
2’-O-Acetyl-5’-O-benzoyl-3’-O-(2-methoxyethyl) uridine is a uridine analog. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents .
|
-
-
- HY-154384
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
5’-Deoxy-5’-iodo-2’-O-(2-methoxyethyl)-5-methyluridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154365
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
5’-O-(4,4’-Dimethoxy trityl)-2’-O-(2-methoxyethyl) inosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154260
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N6-Benzoyl-3'-O-DMT-2'-O-(2-methoxyethyl) adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154441
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N4-Benzoyl-3'-O-DMT-2'-O-(2-methoxyethyl)-5-methylcytidine is a cytidine analog. Cytidine analogs have a mechanism of inhibiting DNA methyltransferases (such as Zebularine, HY-13420), and have potential anti-metabolic and anti-tumor activities .
|
-
-
- HY-154450
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N4-Benzoyl-5’-O-DMT-3’-O-(2-methoxyethyl)-5-methylcytidine is a cytidine analog. Cytidine analogs have a mechanism of inhibiting DNA methyltransferases (such as Zebularine, HY-13420), and have potential anti-metabolic and anti-tumor activities .
|
-
-
- HY-152525
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
5-(Azidomethyl)-2’-O-(2-methoxyethyl)uridine is a thymidine analogue. Analogs of this series have insertional activity towards replicated DNA. They can be used to label cells and track DNA synthesis . 5-(Azidomethyl)-2’-O-(2-methoxyethyl)uridine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. Strain-promoted alkyne-azide cycloaddition (SPAAC) can also occur with molecules containing DBCO or BCN groups.
|
-
-
- HY-154228
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
3’-O-(4,4’-Dimethoxy trityl)-2’-O-(2-methoxyethyl)-5-methyluridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154353
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
5’-O-(4,4’-Dimethoxytrityl)-2’-O-(2-methoxyethyl) adenosine is an adenosine analog. Adenosine analogs mostly act as smooth muscle vasodilators and have also been shown to inhibit cancer progression. Its popular products are adenosine phosphate, Acadesine (HY-13417), Clofarabine (HY-A0005), Fludarabine phosphate (HY-B0028) and Vidarabine (HY-B0277) .
|
-
-
- HY-152493
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
3’-O-(2-Methoxyethyl)guanosine is a guanosine analogue. Some guanosine analogs have immunostimulatory activity. In some animal models, they also induce type I interferons, producing antiviral effects. Studies have shown that the functional activity of guanosine analogs is dependent on the activation of Toll-like receptor 7 (TLR7) .
|
-
-
- HY-152498
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
3’-O-(2-Methoxyethyl)adenosine is an adenosine analogue. Adenosine analogs mostly act as smooth muscle vasodilators and have also been shown to inhibit cancer progression. The popular products in this series are adenosine phosphate, Acadesine (HY-13417), Clofarabine (HY-A0005), Fludarabine phosphate (HY-B0028) and Vidarabine (HY-B0277) .
|
-
-
- HY-152444
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
5-Hydroxymethyl-2’-O-(2-methoxyethyl)uridine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152363
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
N3-Methyl-2’-O-(2-methoxyethyl)uridine is a uridine analogue. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents .
|
-
-
- HY-154121
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
2’-O-(2-Methoxyethyl)guanosine 5’-triphosphate (ammonium) is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154382
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
4’,5’-Didehydro-2’-O-(2-methoxyethyl)uridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-152503
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
N6-Benzoyl-3’-O-(2-methoxyethyl)adenosine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154024
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N4-Benzoyl-2’-O-(2-methoxyethyl)cytidine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-23790
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N6-Benzoyl-2'-O-(2-methoxyethyl)adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
-
- HY-154383
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)uridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc . 5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)uridine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. Strain-promoted alkyne-azide cycloaddition (SPAAC) can also occur with molecules containing DBCO or BCN groups.
|
-
- HY-154381
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
5’-Deoxy-5’-iodo-2’-O-(2-methoxyethyl)uridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-154547
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N2-iso-Butyroyl-3’-O-(methoxyethyl)guanosine is a guanosine analog. Some guanosine analogs have immunostimulatory activity. In some animal models, they also induce type I interferons, producing antiviral effects. Studies have shown that the functional activity of guanosine analogs is dependent on the activation of Toll-like receptor 7 (TLR7) .
|
-
- HY-W073825
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N2-iso-Butyryl-2'-O-(2-methoxyethyl)guanosine is a guanosine analog. Some guanosine analogs have immunostimulatory activity. In some animal models, they also induce type I interferons, producing antiviral effects. Studies have shown that the functional activity of guanosine analogs is dependent on the activation of Toll-like receptor 7 (TLR7) .
|
-
- HY-154175
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
1-[6-(Diethoxyphosphinyl)-2-O-(2-methoxyethyl)-β-D-ribo-hexofuranosyl]uracil is a uridine analog. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents .
|
-
- HY-154229
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
3’-O-DMT-N2-isobutyryl-2’-O-(2-methoxyethyl)guanosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-13040
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N-Benzoyl-5'-O-dmtr-2'-O-(2-methoxyethyl)-adenosine is an adenosine analog. Adenosine analogs mostly act as smooth muscle vasodilators and have also been shown to inhibit cancer progression. Its popular products are adenosine phosphate, Acadesine (HY-13417), Clofarabine (HY-A0005), Fludarabine phosphate (HY-B0028) and Vidarabine (HY-B0277) .
|
-
- HY-154548
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
N2-iso-Butyroyl-5’-O-DMT-3’-O-(methoxyethyl)guanosine is a guanosine analog. Some guanosine analogs have immunostimulatory activity. In some animal models, they also induce type I interferons, producing antiviral effects. Studies have shown that the functional activity of guanosine analogs is dependent on the activation of Toll-like receptor 7 (TLR7) .
|
-
- HY-154060
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
N6-Benzoyl-5'-O-(4,4'-dimethoxytrityl)-3'-O-(2-methoxyethyl)adenosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .
|
-
- HY-147412
-
QR-421a
|
Others
|
Others
|
Ultevursen (QR-421a) is a single-stranded RNA based oligonucleotide that is designed to skip exon 13 in the RNA with the aim to stop vision loss in people that have retinitis pigmentosa due to a mutation in exon 13 of the USH2A gene (encoding usherin). Ultevursen sequence: (P-thio)[2′-O-(2-methoxyethyl)](A-G-m 5C-m 5U-m 5U-m 5C-G-G-A-G-A-A-A-m 5U-m 5U-m 5U-A-A-A-m 5U-m 5C) .
|
-
- HY-145726
-
|
TNF Receptor
|
Inflammation/Immunology
|
ISIS 104838 is an antisense oligonucleotide agent that reduces the production of tumor necrosis factor (TNF-alpha), a substance that contributes to joint pain and swelling in rheumatoid arthritis.
|
-
- HY-145727
-
|
Others
|
Endocrinology
|
Volanesorsen is an antisense oligonucleotide thay targes Apolipoprotein C-III (APOC3)
mRNA. Volanesorsen is used for the study of familial chylomicronemia syndrome.
|
-
- HY-147217
-
ISIS 505358
|
HBV
|
Infection
|
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
|
-
- HY-108764
-
ISIS 301012
|
HCV
|
Metabolic Disease
|
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
|
-
- HY-132581
-
BIIB078; IONIS-C9Rx
|
Others
|
Neurological Disease
|
Tadnersen (BIIB078), an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
|
-
- HY-147410
-
ION-363
|
Others
|
Neurological Disease
|
Ulefnersen is a RNA-binding protein fused-in sarcoma (FUS) synthesis reducer . Ulefnersen can be used in Amyotrophic Lateral Sclerosis (ALS) research .
|
-
- HY-132580
-
BIIB067; ISIS-SOD1Rx
|
DNA/RNA Synthesis
|
Neurological Disease
|
Tofersen (BIIB067) is an antisense oligonucleotide that mediates RNase H-dependent degradation of superoxide dismutase 1 (SOD1) mRNA to reduce the synthesis of SOD1 protein. Tofersen can be used for the research of amyotrophic lateral sclerosis (ALS) .
|
-
- HY-147267
-
ISIS-757456
|
Others
|
Endocrinology
|
Evazarsen is an angiotensinogen synthesis inhibitor and possesses antihypertensive properties .
|
-
- HY-143230
-
OGX-011
|
Apoptosis
|
Cancer
|
Custirsen is a highly specific antisense oligonucleotide that inhibits the production of clusterin , an antiapoptotic protein that is upregulated in response to chemotherapy and that confers treatment resistance.
|
-
- HY-145722
-
OGX-427 sodium
|
HSP
|
Cancer
|
Apatorsen (sodium) is an antisense oligonucleotide designed to bind to Hsp27 mRNA, resulting in the inhibition of the production of Hsp27 protein.
|
-
- HY-145722A
-
OGX-427
|
HSP
|
Cancer
|
Apatorsen is an antisense oligonucleotide designed to bind to Hsp27 mRNA, resulting in the inhibition of the production of Hsp27 protein.
|
-
- HY-151123
-
AKCEA-APO(a)-LRx; ISIS 681257; TQJ230
|
Others
|
Cardiovascular Disease
|
Pelacarsen (AKCEA-APO(a)-LRx) is a liver-specific antisense oligonucleotide against apolipoprotein(a) that reduces lipoprotein(a) up to 80% with good tolerability .
|
-
- HY-148089
-
|
Transthyretin (TTR)
|
Neurological Disease
|
Eplontersen is a triantennary N-acetyl galactosamine (GalNAc3-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases .
|
-
- HY-N12840
-
|
Others
|
Metabolic Disease
|
Logmalicid B is an iridoid glycoside compound that can be isolated from Cornus officinalis and can be used in diabetes research .
|
-
- HY-132600
-
Temavirsen
|
MicroRNA
HCV
|
Infection
|
RG-101 is a hepatocyte targeted N-acetylgalactosamine conjugated oligonucleotide that antagonises miR-122. miR-122 is an important host factor for hepatitis C virus (HCV) replication .
|
-
- HY-145725A
-
IONIS 598769; BIIB 065; ISIS-DMPK-2.5Rx
|
Others
|
Others
|
Baliforsen is an antisense oligonucleotide (16 nucleotides) designed to target myotonic dystrophy protein kinase (DMPK) mRNA and research myotonic dystrophy.
|
-
- HY-132579A
-
RG6042 sodium; IONIS-HTTRx sodium
|
Huntingtin
|
Neurological Disease
|
Tominersen sodium is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen sodium can be used for the research of Huntington’s disease (HD) .
|
-
- HY-145725
-
IONIS 598769 sodium
|
Others
|
Others
|
Baliforsen (sodium) is an antisense oligonucleotide (16 nucleotides) designed to target myotonic dystrophy protein kinase (DMPK) mRNA and research myotonic dystrophy.
|
-
- HY-W570885
-
|
DNA/RNA Synthesis
|
Others
|
2'-O-MOE-rC is a 2'-O-MOE modified nucleoside. 2'-O-MOE-rC can be used for synthesis of DNA .
|
-
- HY-132579
-
RG6042; IONIS-HTTRx
|
Huntingtin
|
Neurological Disease
|
Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD) .
|
-
- HY-150236
-
|
Huntingtin
|
Neurological Disease
|
FITC-labeled Tominersen (sodium) is the Tominersen labeled with FITC. Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD).
|
-
- HY-147406
-
-
- HY-112980
-
|
DNA/RNA Synthesis
|
Inflammation/Immunology
|
Nusinersen is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
|
-
- HY-W336012S
-
-
- HY-132608
-
ISIS-420915 sodium
|
Transthyretin (TTR)
|
Neurological Disease
|
Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
|
-
- HY-P3066
-
d(CH2)5Tyr(Et)VAVP
|
Vasopressin Receptor
|
Metabolic Disease
|
SKF 100398 (d(CH2)5Tyr(Et)VAVP), an arginine vasopressin (AVP) analogue, is a specific antagonist of the antidiuretic effect of exogenous and endogenous AVP .
|
-
Cat. No. |
Product Name |
Type |
-
- HY-150236
-
|
Dyes
|
FITC-labeled Tominersen (sodium) is the Tominersen labeled with FITC. Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD).
|
Cat. No. |
Product Name |
Type |
-
- HY-23789
-
2'-O-MOE-rG
|
Biochemical Assay Reagents
|
2′-O-(2-Methoxyethyl)guanosine (2'-O-MOE-rG), a 2′-O-methoxyethyl-modified nucleoside, can be produced by enzymatic conversion (adenosine deaminase) from 2′-O-(2-methoxyethyl)-2,6-diaminopurine riboside. 2′-O-(2-Methoxyethyl)guanosine neither effectively phosphorylated by cytosolic nucleoside kinases, nor are they incorporated into cellular DNA or RNA .
|
-
- HY-42084
-
p-Hydroxyphenethyl methyl ether
|
Biochemical Assay Reagents
|
4-(2-Methoxyethyl)phenol is a biochemical reagent that can be used as a biological material or organic compound for life science related research.
|
Cat. No. |
Product Name |
Target |
Research Area |
-
- HY-P3066
-
d(CH2)5Tyr(Et)VAVP
|
Vasopressin Receptor
|
Metabolic Disease
|
SKF 100398 (d(CH2)5Tyr(Et)VAVP), an arginine vasopressin (AVP) analogue, is a specific antagonist of the antidiuretic effect of exogenous and endogenous AVP .
|
-
- HY-P4756
-
|
Peptides
|
Others
|
N-(2-Carbamoyl-ethyl)-Val-Leu-anilide is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .
|
Cat. No. |
Product Name |
Category |
Target |
Chemical Structure |
Cat. No. |
Product Name |
Chemical Structure |
-
- HY-W013849S
-
|
Bis(2-methoxyethyl) phthalate-3,4,5,6-d4 is the deuterium labeled Bis(2-methoxyethyl) phthalate[1].
|
-
-
- HY-W336012S
-
|
Metoprolol EP impurity O-d7 (hydrochloride) is the deuterium labeled 3,3'-(Isopropylazanediyl)bis(1-(4-(2-methoxyethyl)phenoxy)propan-2-ol)[1].
|
-
Cat. No. |
Product Name |
|
Classification |
-
- HY-154386
-
|
|
Azide
|
5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)-5-methyluridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc . 5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)-5-methyluridine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. Strain-promoted alkyne-azide cycloaddition (SPAAC) can also occur with molecules containing DBCO or BCN groups.
|
-
- HY-152525
-
|
|
Azide
|
5-(Azidomethyl)-2’-O-(2-methoxyethyl)uridine is a thymidine analogue. Analogs of this series have insertional activity towards replicated DNA. They can be used to label cells and track DNA synthesis . 5-(Azidomethyl)-2’-O-(2-methoxyethyl)uridine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. Strain-promoted alkyne-azide cycloaddition (SPAAC) can also occur with molecules containing DBCO or BCN groups.
|
-
- HY-154383
-
|
|
Azide
|
5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)uridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc . 5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)uridine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. Strain-promoted alkyne-azide cycloaddition (SPAAC) can also occur with molecules containing DBCO or BCN groups.
|
Your information is safe with us. * Required Fields.
Inquiry Information
- Product Name:
- Cat. No.:
- Quantity:
- MCE Japan Authorized Agent: