Search Result
Results for "
RNA oligonucleotides
" in MedChemExpress (MCE) Product Catalog:
2
Biochemical Assay Reagents
Cat. No. |
Product Name |
Target |
Research Areas |
Chemical Structure |
-
- HY-160230
-
|
Toll-like Receptor (TLR)
|
Infection
|
ssRNA41 sodium is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. It derives from ssRNA40 by replacement of all U nucleotides with adenosine. ssRNA41 sodium is unable to induce the production of type IFNs, and therefore can be used as a negative control for ssRNA40 .
|
-
-
- HY-157091
-
|
Others
|
Others
|
Uridine, 5'-(P,P',P'',P''-tetrahydrogen imidotriphosphate) is a non-hydrolyzable nucleotide that can synthesize RNA oligonucleotides .
|
-
-
- HY-D1408
-
DMTr-4'-Methyluridine-CED-TBDMS phosphoramidite
|
DNA Stain
|
Cardiovascular Disease
|
DMTr-4'-Me-U-CED-TBDMS phosphoramidite (DMTr-4'-Methyluridine-CED-TBDMS phosphoramidite), a dye reagent for oligonucleotide labeling, can be used for the research of applications in RNA therapeutics, RNA aptamers, and ribozymes for elucidating RNA structure. DMTr-4'-Me-U-CED-TBDMS phosphoramidite represents a probe with wide utility for elucidation of RNA structure .
|
-
-
- HY-D1409
-
DMTr-4'-F-uridine-CED-TBDMS phosphoramidite
|
DNA Stain
|
Cardiovascular Disease
|
DMTr-4'-F-U-CED-TBDMS phosphoramidite (DMTr-4'-F-uridine-CED-TBDMS phosphoramidite), a dye reagent for oligonucleotide labeling, can be used for the research of applications in RNA therapeutics, RNA aptamers, and ribozymes for elucidating RNA structure. DMTr-4'-F-U-CED-TBDMS phosphoramidite represents a probe with wide utility for elucidation of RNA structure .
|
-
-
- HY-160231
-
|
Toll-like Receptor (TLR)
|
Inflammation/Immunology
|
ssRNA42 (sodium) is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. ssRNA42 (sodium) derives from ssRNA40 by replacement of all G nucleotides with adenosine. ssRNA42 activated human PBMCs to secrete IFN-α, TNF-a, IL- 12p40, and IL-6, but ssRNA42 failed to stimulated murine pDCs and PBMCs.
|
-
-
- HY-139099
-
Gp3G
|
Nucleoside Antimetabolite/Analog
DNA/RNA Synthesis
|
Cancer
|
Diguanosine 5′-triphosphate (Gp3G) is a dinucleoside triphosphates. Diguanosine 5′-triphosphate also is a virus-specific oligonucleotide. Diguanosine 5′-triphosphate is needed for the synthesis of RNA during the transcription process .
|
-
-
- HY-139099A
-
Gp3G lithium
|
DNA/RNA Synthesis
Nucleoside Antimetabolite/Analog
|
Cancer
|
Diguanosine 5′-triphosphate (Gp3G) lithium is a dinucleoside triphosphates. Diguanosine 5′-triphosphate lithium also is a virus-specific oligonucleotide. Diguanosine 5′-triphosphate lithium is needed for the synthesis of RNA during the transcription process .
|
-
-
- HY-D1411
-
DMTr-4'-CF3-5-Methyluridine-CED phosphoramidite
|
DNA Stain
|
Others
|
DMTr-4'-CF3-5-Me-U-CED phosphoramidite (DMTr-4'-CF3-5-Methyluridine-CED phosphoramidite), the modified oligodeoxynucleotide (ODN), is a dye reagent for oligonucleotide labeling, can be used for the research of applications in RNA research .
|
-
-
- HY-21997
-
|
DNA/RNA Synthesis
|
Others
|
Dmt-2'fluoro-da(bz) amidite, an uniformly modified 2'-deoxy-2'-fluoro phosphorothioate oligonucleotide, is a nuclease-resistant antisense compound with high affinity and specificity for RNA targets. Dmt-2'fluoro-da(bz) amidite is also an intermediate for 5’-DMT-3’-phosphoramidite synthesis .
|
-
-
- HY-D0093
-
EthD-1
|
DNA Stain
|
Others
|
Ethidium homodimer (EthD-1) is a high-affinity fluorescent nucleic acid dye commonly used to stain mammals, bacteria, yeast, and fungi. Ethidium homodimer binds to DNA or RNA, enhancing fluorescence more than 30 times. The Ethidium homodimer has a strong positive charge, so it cannot cross cell membranes and stain living cells; But the Ethidium homodimer can cross the disordered region of the dead cell membrane to reach the nucleus and embed the DNA double strand to produce red fluorescence. Therefore, Ethidium homodimer is a relatively sensitive nucleic acid stain that can accurately detect nucleic acids in solution or in decomposing cells. Ethidium homodimer binds DNA, Ex/Em=528/617 nm .
|
-
-
- HY-153324
-
|
Others
|
Others
|
PS220 (sodium) is an antisense RNA oligonucleotides. PS220 (sodium) can be used for research of treating muscular dystrophy .
|
-
-
- HY-147412A
-
QR-421a sodium
|
Others
|
Others
|
Ultevursen sodium is a single-stranded RNA based oligonucleotide that is designed to skip exon 13 in the RNA with the aim to stop vision loss in people that have retinitis pigmentosa due to a mutation in exon 13 of the USH2A gene (encoding usherin).
|
-
-
- HY-153836
-
|
Others
|
Others
|
Anivamersen is an RNA aptamer to reverse the anticoagulant effect of the parenteral factor IXa inhibitor pegnivacogin. REG1 is a novel anticoagulation system consisting of pegnivacogin, an RNA aptamer inhibitor of coagulation factor IXa, and anivamersen, a complementary sequence reversal oligonucleotide.
|
-
-
- HY-153836A
-
|
Others
|
Others
|
Anivamersen sodium is an RNA aptamer to reverse the anticoagulant effect of the parenteral factor IXa inhibitor pegnivacogin. REG1 is a novel anticoagulation system consisting of pegnivacogin, an RNA aptamer inhibitor of coagulation factor IXa, and anivamersen, a complementary sequence reversal oligonucleotide.
|
-
-
- HY-147217
-
ISIS 505358
|
HBV
|
Infection
|
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
|
-
-
- HY-147217A
-
ISIS 505358 sodium
|
HBV
|
Infection
|
Bepirovirsen sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
|
-
-
- HY-112980
-
|
DNA/RNA Synthesis
|
Inflammation/Immunology
|
Nusinersen is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
|
-
-
- HY-112980A
-
|
DNA/RNA Synthesis
|
Inflammation/Immunology
|
Nusinersen sodium is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
|
-
-
- HY-153496
-
QR 110
|
Others
|
Others
|
Sepofarsen (QR-110) is an RNA antisense oligonucleotide targeting to the p.Cys998X mutation (also known as the c.2991+1655A>G mutation) in the CEP290 gene.
|
-
-
- HY-153496A
-
QR 110 sodium
|
Others
|
Others
|
Sepofarsen (QR-110) sodium is an RNA antisense oligonucleotide targeting to the p.Cys998X mutation (also known as the c.2991+1655A>G mutation) in the CEP290 gene.
|
-
-
- HY-145998
-
m8Gm
|
Others
|
Others
|
2′-O-Methyl-8-methyl guanosine (m8Gm) is a Z-form RNA stabilizer. 2′-O-Methyl-8-methyl guanosine can markedly stabilize the Z-RNA at low salt conditions . m8Gm-contained oligonucleotides stabilize
the Z-DNA under low salt conditions .
|
-
-
- HY-145982
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
m7GpppCmpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppCmpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures .
|
-
-
- HY-145981
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
m7GpppCpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppCpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures .
|
-
-
- HY-145979
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
m7GpppUmpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppUmpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures .
|
-
-
- HY-145980
-
|
Nucleoside Antimetabolite/Analog
|
Others
|
m7GpppUpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppUpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures .
|
-
-
- HY-148828
-
|
iGluR
|
|
LSP-GR3 is a novel chemically-modified RNA oligonucleotides, called splice modulating oligomers (SMOs), which potently and specifically modulate GluR alternative splicing to GluR3-flip expression throughout the CNS.
|
-
-
- HY-148828A
-
|
iGluR
|
Neurological Disease
|
LSP-GR3 sodium is a novel chemically-modified RNA oligonucleotides, called splice modulating oligomers (SMOs), which potently and specifically modulate GluR alternative splicing to GluR3-flip expression throughout the CNS.
|
-
-
- HY-160229
-
|
Toll-like Receptor (TLR)
|
Infection
|
ssRNA40 (sodium) is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. ssRNA40 is a uridine-rich ssRNA derived from the HIV-1 long terminal repeat on activation of NK cells via TLR7/8 [1][2].
|
-
-
- HY-132608
-
ISIS-420915 sodium
|
Transthyretin (TTR)
|
Neurological Disease
|
Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
|
-
-
- HY-78574
-
|
Others
|
Others
|
N-Benzoylcytidine is a substrate for uracil-cytidine kinase 1 (UCK1) and UCK2. N-Benzoylcytidine can be used to synthesize 2-OH protective groups for solid-phase RNA synthesis, as well as synthetic oligonucleotides for UV induction and targeted gene silencing in zebrafish embryos .
|
-
-
- HY-148100
-
NOX-E36
|
Others
|
Inflammation/Immunology
Cancer
|
Emapticap pegol is a inhibitor of pro-inflammatory chemokine C-C motif-ligand 2 (CCL2). Emapticap pegol is a 40-nucleotide oligonucleotide aptamer, displays different Spiegelmers (L-RNA aptamer) isform in human (NOX-E36) and mouse (mNOX-E36) .
|
-
-
- HY-148100A
-
NOX-E36 sodium
|
Others
|
Cancer
|
Emapticap pegol sodium is a inhibitor of pro-inflammatory chemokine C-C motif-ligand 2 (CCL2). Emapticap pegol sodium is a 40-nucleotide oligonucleotide aptamer, displays different Spiegelmers (L-RNA aptamer) isform in human (NOX-E36) and mouse (mNOX-E36) .
|
-
-
- HY-B0956
-
Aminosidine sulfate
|
Antibiotic
Parasite
Bacterial
|
Infection
|
Paromomycin (Aminosidine) sulfate, a neomycin (HY-B0470) derivative, is a broad spectrum aminoglycoside antibiotic with amebicidal and bactericidal effects. Paromomycin sulfate prematures termination of translation of mRNA and inhibits protein synthesis by specifically binds to the RNA oligonucleotide at the A site of bacterial 30S ribosomes. Paromomycin sulfate can be used for the research of bacterial and parasitic infections .
|
-
-
- HY-138577
-
|
DNA/RNA Synthesis
Nucleoside Antimetabolite/Analog
|
Others
|
2'-F-Bz-dC Phosphoramidite can be used in the synthesis of oligoribonucleotide (such as DNA and RNA). 2'-F-Bz-dC Phosphoramidite also used for synthesis antiviral agent to inhibit the replication of virus. 2'-F-Bz-dC Phosphoramidite contains a phosphorothioate backbone, to synthesise antisense oligonucleotide analogs to induce apoptosis in cancer cells .
|
-
-
- HY-W570888
-
LNA-C(Bz)
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
2'-O,4'-C-Methylenecytidine (LNA-C(Bz)) is a bicyclic nucleoside analogue with fixed N-type conformation. 2'-O,4'-C-Methylenecytidine can be used to synthesize oligonucleotides. 2'-O,4'-C-Methylenecytidine forms duplexes with complementary DNA and RNA strands .
|
-
-
- HY-P0229
-
RNAse T1
|
DNA/RNA Synthesis
|
Others
|
Ribonulease T1, Aspergillus oryzae (Rnase T1), is commonly used in biochemical research. Ribonuclease T1 is an endonuclease that can specifically degrade single stranded RNA. Ribonuclease T1 can form nucleoside 2 ', 3 '-cyclic phosphoric acid intermediates to cut the phosphodiester bond between 3' -guanosine residues and adjacent nucleoside 5 '-OH groups to produce 3' -GMP terminal oligonucleotides .
|
-
-
- HY-147412
-
QR-421a
|
Others
|
Others
|
Ultevursen (QR-421a) is a single-stranded RNA based oligonucleotide that is designed to skip exon 13 in the RNA with the aim to stop vision loss in people that have retinitis pigmentosa due to a mutation in exon 13 of the USH2A gene (encoding usherin). Ultevursen sequence: (P-thio)[2′-O-(2-methoxyethyl)](A-G-m 5C-m 5U-m 5U-m 5C-G-G-A-G-A-A-A-m 5U-m 5U-m 5U-A-A-A-m 5U-m 5C) .
|
-
-
- HY-B0956R
-
|
Antibiotic
Parasite
Bacterial
|
Infection
|
Paromomycin (sulfate) (Standard) is the analytical standard of Paromomycin (sulfate). This product is intended for research and analytical applications. Paromomycin (Aminosidine) sulfate, a neomycin (HY-B0470) derivative, is a broad spectrum aminoglycoside antibiotic with amebicidal and bactericidal effects. Paromomycin sulfate prematures termination of translation of mRNA and inhibits protein synthesis by specifically binds to the RNA oligonucleotide at the A site of bacterial 30S ribosomes. Paromomycin sulfate can be used for the research of bacterial and parasitic infections .
|
-
-
- HY-W039442
-
|
Nucleoside Antimetabolite/Analog
|
Cancer
|
2′-Deoxy-2′-fluoroadenosine can be used for the synthesis of 2′-Deoxy-2′-fluoro-modified oligonucleotides hybridized with RNA. 2′-Deoxy-2′-fluoroadenosine can be cleaved efficiently by E. coli purine nucleoside phosphorylase (PNP) to the toxic agent 2-fluoroadenine (FAde). 2′-Deoxy-2′-fluoroadenosine shows excellent in vivo activity against tumors expressing E. coli PNP .
|
-
-
- HY-160222
-
|
HSV
STING
|
Infection
Inflammation/Immunology
|
HSV-60mer sodium is a 60 bp double-stranded oligonucleotide containing viral DNA motifs that derive from the herpes simplex virus 1 (HSV-1) genome . Transfected HSV-60 has been shown to potently induce IFN-β in a Toll-like receptor (TLR)-, DNA-dependent activator of IRFs (DAI)-, and RNA polymerase III (Pol III)-independent, but STING-, TBK1- and IFN regulatory factor 3 (IRF3)-dependent manner.
|
-
Cat. No. |
Product Name |
Type |
-
- HY-D0093
-
EthD-1
|
DNA Stain
|
Ethidium homodimer (EthD-1) is a high-affinity fluorescent nucleic acid dye commonly used to stain mammals, bacteria, yeast, and fungi. Ethidium homodimer binds to DNA or RNA, enhancing fluorescence more than 30 times. The Ethidium homodimer has a strong positive charge, so it cannot cross cell membranes and stain living cells; But the Ethidium homodimer can cross the disordered region of the dead cell membrane to reach the nucleus and embed the DNA double strand to produce red fluorescence. Therefore, Ethidium homodimer is a relatively sensitive nucleic acid stain that can accurately detect nucleic acids in solution or in decomposing cells. Ethidium homodimer binds DNA, Ex/Em=528/617 nm .
|
-
- HY-D1408
-
DMTr-4'-Methyluridine-CED-TBDMS phosphoramidite
|
Oligonucleotide Labeling
|
DMTr-4'-Me-U-CED-TBDMS phosphoramidite (DMTr-4'-Methyluridine-CED-TBDMS phosphoramidite), a dye reagent for oligonucleotide labeling, can be used for the research of applications in RNA therapeutics, RNA aptamers, and ribozymes for elucidating RNA structure. DMTr-4'-Me-U-CED-TBDMS phosphoramidite represents a probe with wide utility for elucidation of RNA structure .
|
-
- HY-D1409
-
DMTr-4'-F-uridine-CED-TBDMS phosphoramidite
|
Oligonucleotide Labeling
|
DMTr-4'-F-U-CED-TBDMS phosphoramidite (DMTr-4'-F-uridine-CED-TBDMS phosphoramidite), a dye reagent for oligonucleotide labeling, can be used for the research of applications in RNA therapeutics, RNA aptamers, and ribozymes for elucidating RNA structure. DMTr-4'-F-U-CED-TBDMS phosphoramidite represents a probe with wide utility for elucidation of RNA structure .
|
Cat. No. |
Product Name |
Type |
-
- HY-21997
-
|
Gene Sequencing and Synthesis
|
Dmt-2'fluoro-da(bz) amidite, an uniformly modified 2'-deoxy-2'-fluoro phosphorothioate oligonucleotide, is a nuclease-resistant antisense compound with high affinity and specificity for RNA targets. Dmt-2'fluoro-da(bz) amidite is also an intermediate for 5’-DMT-3’-phosphoramidite synthesis .
|
-
- HY-139099A
-
Gp3G lithium
|
Gene Sequencing and Synthesis
|
Diguanosine 5′-triphosphate (Gp3G) lithium is a dinucleoside triphosphates. Diguanosine 5′-triphosphate lithium also is a virus-specific oligonucleotide. Diguanosine 5′-triphosphate lithium is needed for the synthesis of RNA during the transcription process .
|
Cat. No. |
Product Name |
Category |
Target |
Chemical Structure |
Your information is safe with us. * Required Fields.
Inquiry Information
- Product Name:
- Cat. No.:
- Quantity:
- MCE Japan Authorized Agent: