country

Change Language

EN - English
FR - Français
DE - Deutsch
ES - Español
JA - 日本語
KO - 한국어

Country or Region:

United States

Product Name	Size / Unit Price	Qty

Total: USD 0.00 Checkout

Cat. No.: HY-153734

Copy Link Print Information

Inactive ASO (in vivo) sodium

Customer Review

Based on 1 Customer Validation

Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications

For research use only. We do not sell to patients.

Purity: 92.18%
Molecular Weight:7132.7 (free acid)

Storage:

-20°C, sealed storage, away from moisture

* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

Inactive ASO (in vivo) sodium Chemical Structure

Size

Price

Stock

Quantity

Amount: USD 0.00

* Please select Quantity before adding items.

Top Publications Citing

Use of MCE Products

Fluorescent Dye

Strong Fluorescence Signal / Multi-Disciplinary Applications / High Fluorescence Specificity

Biological Activity

Description

Chemical Information

Appearance Solid
Molecular Weight 7132.7 (free acid)
Color White to off-white
SMILES

[CCTATAGGACTATCCAGGAA]
Shipping

Room temperature in continental US; may vary elsewhere.
Storage

-20°C, sealed storage, away from moisture

* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

Solvent & Solubility

In Vitro:

H₂O : 100 mg/mL (Need ultrasonic)

View the Complete Stock Solution Preparation Table

Purity & Documentation

Select Batch:

Purity: 99.98%

Assay: 99.98%

ee.: 99.98%

Data Sheet (264 KB)
SDS (251 KB)
- English - EN (251 KB)
- Français - FR (251 KB)
- Deutsch - DE (251 KB)
- Norwegian - NO (251 KB)
- Español - ES (251 KB)
- Swedish - SV (251 KB)
- Italian - IT (251 KB)
- Korean - KR (251 KB)
- Portuguese - PT (251 KB)
COA (2659 KB)
Elemental Analysis Report (2659 KB)
HNMR (2659 KB)
CNMR (2659 KB)
RP-HPLC (2659 KB)
NP-HPLC (2659 KB)
MS (2659 KB)
LCMS (2659 KB)
IR (2659 KB)
GC (2659 KB)
OR (2659 KB)
SDS-PAGE (2659 KB)
SEC-HPLC (2659 KB)
Other Report (2659 KB)
Handling Instructions (2242 KB)

References

[1]. McCampbell A, Cole T, Wegener AJ, et al. Antisense oligonucleotides extend survival and reverse decrement in muscle response in ALS models. J Clin Invest. 2018;128(8):3558-3567. [Content Brief]

Calculators

Molarity Calculator

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass Mass

Concentration Concentration

Volume Volume

Molecular Weight Molecular Weight

Dilution Calculator

Concentration _(start) × Volume _(start) = Concentration _(final) × Volume _(final)

Concentration _(start) Concentration _(start)

Volume _(start) Volume _(start)

Concentration _(final) Concentration _(final)

Volume _(final) Volume _(final)

Help & FAQs

How should lyophilized recombinant proteins be reconstituted and stored?

1. Before opening the cap, centrifuge the vial at 13000 rpm for 20-30 seconds. This step will ensure that any lyophilized powder that may have adhered to the cap or walls is collected at the bottom of the vial, minimizing the risk of product loss.

Keywords

MOQ

Minimum order quantity

100 mg

Get Quote In-stock

Other size

Get Quote