Inactive ASO (in vivo) sodium
Based on 1 Customer Validation
Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications
For research use only. We do not sell to patients.
- Purity : 95.60%
- Molecular Weight:7132.7 (free acid)
-
Storage:
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Biological Activity
Description
Chemical Information
-
Appearance Solid
-
Molecular Weight 7132.7 (free acid)
-
Color White to off-white
-
SMILES
[CCTATAGGACTATCCAGGAA]
-
Shipping
Room temperature in continental US; may vary elsewhere.
-
Storage
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Solvent & Solubility
In Vitro:
H2O : 100 mg/mL (Need ultrasonic)
Protocols
-
RT-PCR
Reverse transcription technology uses RNA as a template to synthesize DNA. RT-PCR is simple, specific and sensitive, and can be used to detect gene expression levels and expression differences in cells; detect RNA virus content; clone cDNA sequences of specific genes.
-
RNA extraction experimental
By lysing cells, releasing RNA, and removing impurities such as proteins and DNA, high-purity RNA products are finally obtained. The commonly used traditional method is the guanidine isothiocyanate/phenol/chloroform method (Trizol), which is suitable for a variety of animal materials including animal tissues, microorganisms, cultured cells, etc., and most plant materials.
-
Real Time qPCR (Q-PCR)
Real-time quantitative PCR (qPCR) quantifies an amplifiable nucleic-acid target by monitoring fluorescence during PCR cycling rather than measuring product only after amplification. The increase in fluorescence tracks accumulation of PCR product, and the quantification cycle (Cq; historically also Ct/CP) is related to the initial amount of target: samples containing more starting target generally reach the defined fluorescence threshold in fewer cycles.
Purity & Documentation
-
Data Sheet (264 KB)
-
SDS (251 KB)
- English - EN (251 KB)
- Français - FR (251 KB)
- Deutsch - DE (251 KB)
- Norwegian - NO (251 KB)
- Español - ES (251 KB)
- Swedish - SV (251 KB)
- Italian - IT (251 KB)
- Korean - KR (251 KB)
- Portuguese - PT (251 KB)
-
Handling Instructions (2242 KB)
References
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)