Inactive ASO (in vivo) sodium

Cat. No.: HY-153734 Purity: 92.18%: FAQs
Data Sheet SDS COA Handling Instructions

Molarity Calculator

Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications

For research use only. We do not sell to patients.

CCTATAGGACTATCCAGGAA

Inactive ASO (in vivo) sodium Chemical Structure

Size	Price	Stock	Quantity
1 mg	USD 198	In-stock	Estimated Time of Arrival: December 31
5 mg	USD 588	In-stock	Estimated Time of Arrival: December 31
10 mg	USD 945	In-stock	Estimated Time of Arrival: December 31
50 mg		Get quote
100 mg		Get quote

or Bulk Inquiry

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Customer Review

Based on 1 publication(s) in Google Scholar

Featured Recommendations

•Related Screening Libraries:

•Related Small Molecules:

•Related Proteins:

Biological Activity
Purity & Documentation
References
Customer Review

Description	Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications
Appearance	Solid
Color	White to off-white
SMILES	[CCTATAGGACTATCCAGGAA]
Shipping	Room temperature in continental US; may vary elsewhere.
Storage	-20°C, sealed storage, away from moisture *In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Purity & Documentation	Purity: 92.18% Select Batch: Data Sheet (262 KB) SDS (251 KB) COA (241 KB) LCMS (307 KB) Handling Instructions (2659 KB)
References	[1]. McCampbell A, Cole T, Wegener AJ, et al. Antisense oligonucleotides extend survival and reverse decrement in muscle response in ALS models. J Clin Invest. 2018;128(8):3558-3567. [Content Brief]

Molarity Calculator
Dilution Calculator

The molarity calculator equation

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

The dilution calculator equation

Concentration _(start) × Volume _(start) = Concentration _(final) × Volume _(final)

This equation is commonly abbreviated as: C₁V₁ = C₂V₂

Help & FAQs

Do most proteins show cross-species activity?
Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Keywords:

Inactive ASO (in vivo)OthersInhibitorinhibitorinhibit

Your Recently Viewed Products:

Product Name

Salutation

Applicant Name *

Email Address *

Phone Number *

Organization Name *

Department *

Requested quantity *

Country or Region *

Remarks

Product Name			Lot #
Applicant Name *			Email Address *
Phone Number			Department *
Organization Name *			Country or Region *
Remarks

Name
Email *

	Sorry, but the email address you supplied was invalid.

Inactive ASO (in vivo) sodium

Customer Review