Inactive ASO (in vivo) sodium
Based on 1 Customer Validation
Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications
For research use only. We do not sell to patients.
- Purity: 95.60%
- Molecular Weight:7132.7 (free acid)
-
Storage:
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Biological Activity
Description
Chemical Information
-
Appearance Solid
-
Molecular Weight 7132.7 (free acid)
-
Color White to off-white
-
SMILES
[CCTATAGGACTATCCAGGAA]
-
Shipping
Room temperature in continental US; may vary elsewhere.
-
Storage
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Solvent & Solubility
In Vitro:
H2O : 100 mg/mL (Need ultrasonic)
Purity & Documentation
-
Data Sheet (264 KB)
-
SDS (251 KB)
- English - EN (251 KB)
- Français - FR (251 KB)
- Deutsch - DE (251 KB)
- Norwegian - NO (251 KB)
- Español - ES (251 KB)
- Swedish - SV (251 KB)
- Italian - IT (251 KB)
- Korean - KR (251 KB)
- Portuguese - PT (251 KB)
-
Handling Instructions (2242 KB)
References
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)