1. Signaling Pathways
  2. Anti-infection
  3. HBV

HBV

Hepatitis B virus

HBV (Hepatitis B virus), abbreviated HBV, is a species of the genus Orthohepadnavirus, which is likewise a part of the Hepadnaviridae family of viruses. HBV causes the disease hepatitis B. The hepatitis B virus is classified as the type species of the Orthohepadnavirus, which contains three other species: the Ground squirrel hepatitis virus, Woodchuck hepatitis virus, and theWoolly monkey hepatitis B virus. The genus is classified as part of the Hepadnaviridae family. HBV is divided into four major serotypes (adr, adw, ayr, ayw) based on antigenic epitopes present on its envelope proteins, and into eight genotypes (A–H) according to overall nucleotide sequence variation of the genome. The genotypes have a distinct geographical distribution and are used in tracing the evolution and transmission of the virus. Differences between genotypes affect the disease severity, course and likelihood of complications, and response to treatment and possibly vaccination.

HBV Related Products (144):

Cat. No. Product Name Effect Purity
  • HY-15142
    Doxorubicin hydrochloride
    Activator 99.58%
    Doxorubicin (Hydroxydaunorubicin) hydrochloride, a cytotoxic anthracycline antibiotic, is an anti-cancer chemotherapy agent. Doxorubicin hydrochloride is a potent human DNA topoisomerase I and topoisomerase II inhibitor with IC50s of 0.8 μM and 2.67 μM, respectively. Doxorubicin hydrochloride reduces basal phosphorylation of AMPK and its downstream target acetyl-CoA carboxylase. Doxorubicin hydrochloride induces apoptosis and autophagy.
  • HY-107454
    OSS_128167
    Inhibitor 98.06%
    OSS_128167 is a potent selective sirtuin 6 (SIRT6) inhibitor with IC50s of 89 μM, 1578 μM and 751 μM for SIRT6, SIRT1 and SIRT2, respectively. OSS_128167 has anti-HBV activity that inhibits HBV transcription and replication. OSS_128167 has anti-acncer, anti-inflammation and anti-viral effects.
  • HY-B0250
    Lamivudine
    Inhibitor 99.85%
    Lamivudine (BCH-189) is an orally active nucleoside reverse transcriptase inhibitor (NRTI). Lamivudine can inhibit HIV reverse transcriptase 1/2 and also the reverse transcriptase of hepatitis B virus. Lamivudine salicylate can penetrate the CNS.
  • HY-N0063
    Punicalagin
    Inhibitor 99.97%
    Punicalagin is a polyphenol ingredient isolated from Pomegranate (Punica granatum L.) or the leaves of Terminalia catappa L.. Punicalagin is a reversible and non-competitive 3CLpro inhibitor and inhibits SARS-CoV-2 replication in vitro. Punicalagin is an anti-hepatitis B virus (HBV) agent and has antioxidant, anti-inflammatory, and anticancer effects. Punicalagin has the potential for the research of COVID-19.
  • HY-117650A
    RG7834
    Inhibitor 99.46%
    RG7834 (RO 7020322) is a highly selective and orally bioavailable HBV inhibitor, potently inhibits HBV antigens (both HBsAg and HBeAg) and HBV DNA, with IC50s of 2.8, 2.6, and 3.2 nM, respectively, in dHepaRG Cells.
  • HY-147217
    Bepirovirsen
    Inhibitor
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
  • HY-B0277A
    Vidarabine phosphate
    Inhibitor
    Vidarabine phosphate (Ara-AMP), an antiviral agent, inhibits chronic HBV infection. Vidarabine phosphate also against herpes simplex and varicella zoster viruses.
  • HY-P3465
    Bulevirtide
    Inhibitor
    Bulevirtide (Myrcludex B) is a NTCP inhibitor, a linear lipopeptide of 47 amino acids. Bulevirtide inhibits HBV and HDV entry into liver cells, blocks HBV infection in hepatocytes, and participates in HBV transcriptional suppression. Bulevirtide can be used in HDV infection and compensated cirrhosis research.
  • HY-15601
    Vesatolimod
    Inhibitor 99.90%
    Vesatolimod (GS-9620) is a potent, selective and orally active agonist of Toll-Like Receptor (TLR7) with an EC50 of 291 nM.
  • HY-N0054
    Osthole
    Inhibitor 99.95%
    Osthole (Osthol) is a natural antihistamine alternative. Osthole may be a potential inhibitor of histamine H1 receptor activity. Osthole also suppresses the secretion of HBV in cells.
  • HY-13910
    Tenofovir
    Inhibitor 99.89%
    Tenofovir (GS 1278) is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B (HBV).
  • HY-13782
    Tenofovir Disoproxil fumarate
    Inhibitor 99.50%
    Tenofovir Disoproxil fumarate is a nucleotide reverse transcriptase inhibitor used to treat HIV and chronic Hepatitis B.
  • HY-13623A
    Entecavir monohydrate
    Inhibitor 98.80%
    Entecavir monohydrate (BMS200475 monohydrate; SQ34676 monohydrate) is a potent and selective inhibitor of HBV, with an EC50 of 3.75 nM in HepG2 cell.
  • HY-N0820
    Catalpol
    Inhibitor 98.04%
    Catalpol (Catalpinoside), an iridoid glycoside found in Rehmannia glutinosa. Catalpol has neuroprotective, hypoglycemic, anti-inflammatory, anti-cancer, anti-spasmodic, anti-oxidant effects and anti-HBV effects.
  • HY-109137
    Selgantolimod
    Inhibitor 99.17%
    Selgantolimod (GS-9688) is an orally active, potent and selective toll-like receptor 8 (TLR8) agonist for the treatment of hepatitis B virus (HBV) and human immunodeficiency virus (HIV) infection.
  • HY-W063968
    RO8191
    Inhibitor ≥99.0%
    RO8191 (CDM-3008), an imidazonaphthyridine compound, is an orally active and potent interferon (IFN) receptor agonist. RO8191 directly binds to IFNα/β receptor 2 (IFNAR2) and activates IFN-stimulated genes (ISGs) expression and JAK/STAT phosphorylation. RO8191 shows antiviral activity against both HCV and EMCV with an IC50 of 200 nM for HCV replicon. RO8191 is a cccDNA modulator (CDM) through interferon-like activity and has anti-HBV activity.
  • HY-N0680
    Thiamine hydrochloride
    Inhibitor 99.99%
    Thiamine hydrochloride (Thiamine chloride hydrochloride) is an essential micronutrient needed as a cofactor for many central metabolic enzymes.
  • HY-B2116
    Osalmid
    Inhibitor 99.85%
    Osalmid is a ribonucleotide reductase small subunit M2 (RRM2) targeting compound; suppresses ribonucleotide reductase activity with an IC50 of 8.23 μM.
  • HY-N0058
    4,5-Dicaffeoylquinic acid
    Inhibitor 99.98%
    4,5-Dicaffeoylquinic acid (Isochlorogenic acid C) is an antioxidant, can be isolated from Gynura divaricata and Laggera alata. 4,5-Dicaffeoylquinic acid reduces islet cell apoptosis and improves pancreatic function in type 2 diabetic mice, and has obvious inhibitory activities against yeast α-glucosidase. 4,5-Dicaffeoylquinic acid inhibits prostate cancer cells through cell cycle arrest. 4,5-Dicaffeoylquinic acid also has anti-apoptotic, anti-injury and anti-hepatitis B virus effects.
  • HY-108917
    Morphothiadin
    Inhibitor 99.84%
    Morphothiadin is a potent inhibitor on the replication of both wild-type and adefovir-resistant HBV with an IC50 of 12 nM.