2. Signaling Pathways
  3. Anti-infection
  4. HBV
  5. HBV Inhibitor

HBV Inhibitor

HBV Inhibitors (192):

Cat. No. Product Name Effect Purity
  • HY-B0150
    Nicotinamide
    		Inhibitor 99.87%
    Nicotinamide is a form of vitamin B3 or niacin. Nicotinamide Hydrochloride inhibits SIRT2 activity (IC50: 2 μM). Nicotinamide also inhibits SIRT1. Nicotinamide increases cellular NAD+, ATP, ROS levels. Nicotinamide inhibits tumor growth and improves survival. Nicotinamide also has anti-HBV activity.
  • HY-N0063
    Punicalagin
    		Inhibitor 99.97%
    Punicalagin is a polyphenol ingredient isolated from Pomegranate (Punica granatum L.) or the leaves of Terminalia catappa L.. Punicalagin is a reversible and non-competitive 3CLpro inhibitor and inhibits SARS-CoV-2 replication in vitro. Punicalagin is an anti-hepatitis B virus (HBV) agent and has antioxidant, anti-inflammatory, and anticancer effects. Punicalagin has the potential for the research of COVID-19.
  • HY-107454
    OSS_128167
    		Inhibitor 98.63%
    OSS_128167 is a potent selective sirtuin 6 (SIRT6) inhibitor with IC50s of 89 μM, 1578 μM and 751 μM for SIRT6, SIRT1 and SIRT2, respectively. OSS_128167 has anti-HBV activity that inhibits HBV transcription and replication. OSS_128167 has anti-cancer, anti-inflammation and anti-viral effects.
  • HY-B0250
    Lamivudine
    		Inhibitor 99.85%
    Lamivudine (BCH-189) is an orally active nucleoside reverse transcriptase inhibitor (NRTI). Lamivudine can inhibit HIV reverse transcriptase 1/2 and also the reverse transcriptase of hepatitis B virus. Lamivudine salicylate can penetrate the CNS.
  • HY-147217A
    Bepirovirsen sodium
    		Inhibitor 98.44%
    Bepirovirsen sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
  • HY-106233B
    Tiviciclovir hydrochloride
    		Inhibitor
    Tiviciclovir (AM188) hydrochloride is an antiviral guanosine analog and a hepatitis B virus inhibitor.
  • HY-P990015
    Tobevibart
    		Inhibitor
    Tobevibart is an IgG1-lambda, anti-HBV (hepatitis B virus) surface envelope protein human monoclonal antibody. Tobevibart shows antiviral activity.
  • HY-13910
    Tenofovir
    		Inhibitor 99.89%
    Tenofovir (GS 1278) is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B (HBV).
  • HY-W063968
    RO8191
    		Inhibitor ≥99.0%
    RO8191 (CDM-3008), an imidazonaphthyridine compound, is an orally active and potent interferon (IFN) receptor agonist. RO8191 directly binds to IFNα/β receptor 2 (IFNAR2) and activates IFN-stimulated genes (ISGs) expression and JAK/STAT phosphorylation. RO8191 shows antiviral activity against both HCV and EMCV with an IC50 of 200 nM for HCV replicon. RO8191 is a cccDNA modulator (CDM) through interferon-like activity and has anti-HBV activity.
  • HY-13782
    Tenofovir Disoproxil fumarate
    		Inhibitor 99.67%
    Tenofovir Disoproxil fumarate is a nucleotide reverse transcriptase inhibitor used to treat HIV and chronic Hepatitis B.
  • HY-15601
    Vesatolimod
    		Inhibitor 99.90%
    Vesatolimod (GS-9620) is a potent, selective and orally active agonist of Toll-Like Receptor (TLR7) with an EC50 of 291 nM.
  • HY-N0056
    Isochlorogenic acid A
    		Inhibitor 99.54%
    Isochlorogenic acid A (3,5-Dicaffeoylquinic acid) is a natural phenolic acid with anti-mutagenicity, anti-HBV, anti-HIV, anti-oxidant, anti-bacterial, and anti-inflammatoryy activities.
  • HY-13623A
    Entecavir monohydrate
    		Inhibitor 99.66%
    Entecavir monohydrate (BMS200475 monohydrate; SQ34676 monohydrate) is a potent and selective inhibitor of HBV, with an EC50 of 3.75 nM in HepG2 cell.
  • HY-N0820
    Catalpol
    		Inhibitor 99.98%
    Catalpol (Catalpinoside), an iridoid glycoside found in Rehmannia glutinosa. Catalpol has neuroprotective, hypoglycemic, anti-inflammatory, anti-cancer, anti-spasmodic, anti-oxidant effects and anti-HBV effects.
  • HY-117650A
    RG7834
    		Inhibitor 99.46%
    RG7834 (RO 7020322) is a highly selective and orally bioavailable HBV inhibitor, potently inhibits HBV antigens (both HBsAg and HBeAg) and HBV DNA, with IC50s of 2.8, 2.6, and 3.2 nM, respectively, in dHepaRG Cells.
  • HY-109137
    Selgantolimod
    		Inhibitor 98.23%
    Selgantolimod (GS-9688) is an orally active, potent and selective toll-like receptor 8 (TLR8) agonist for the treatment of hepatitis B virus (HBV) and human immunodeficiency virus (HIV) infection.
  • HY-N0680
    Thiamine hydrochloride
    		Inhibitor 99.99%
    Thiamine hydrochloride (Thiamine chloride hydrochloride) is an essential micronutrient needed as a cofactor for many central metabolic enzymes.
  • HY-B2116
    Osalmid
    		Inhibitor 99.85%
    Osalmid is a ribonucleotide reductase small subunit M2 (RRM2) targeting compound; suppresses ribonucleotide reductase activity with an IC50 of 8.23 μM.
  • HY-N0058
    4,5-Dicaffeoylquinic acid
    		Inhibitor 99.98%
    4,5-Dicaffeoylquinic acid (Isochlorogenic acid C) is an antioxidant, can be isolated from Gynura divaricata and Laggera alata. 4,5-Dicaffeoylquinic acid reduces islet cell apoptosis and improves pancreatic function in type 2 diabetic mice, and has obvious inhibitory activities against yeast α-glucosidase. 4,5-Dicaffeoylquinic acid inhibits prostate cancer cells through cell cycle arrest. 4,5-Dicaffeoylquinic acid also has anti-apoptotic, anti-injury and anti-hepatitis B virus effects.
  • HY-N0054
    Osthole
    		Inhibitor 99.95%
    Osthole (Osthol) is a natural antihistamine alternative. Osthole may be a potential inhibitor of histamine H1 receptor activity. Osthole also suppresses the secretion of HBV in cells.