Copy Link Print Information

Bepirovirsen sodium

(Synonyms: ISIS 505358 sodium)
Customer Review

Based on 1 Customer Validation

Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC).

For research use only. We do not sell to patients.

  • Purity: 97.10%
  • CAS No.: 2563929-84-8
  • Formula: C230H290N88Na19O115P19S19
  • Molecular Weight:7344 (free acid)
  • Storage:

    -20°C, sealed storage, away from moisture

    * In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

  • Bepirovirsen sodium Chemical Structure
    Bepirovirsen sodium Chemical Structure
CAS No.: 2563929-84-8
Size
Price
Stock
Quantity
Amount: USD 0.00
Please select quantity
or
or

* Please select Quantity before adding items.

To place orders, for customer services and technical support, please contact: MedChemExpress USA

Tel: 609-228-6898 E-mail: [email protected] [email protected]

Data Download
Other Forms of Bepirovirsen sodium:

To place orders, for customer services and technical support, please contact:

609-228-6898
[email protected] [email protected]
Find Your Local Distributor Your local distributor: Hycultec GmbHHycultec
  • Biological Activity
  • Chemical Information
  • Purity & Documentation
  • References
  • Help & FAQs
Top Publications Citing

Use of MCE Products
Keywords
100 mg

Get Quote In-stock

Please select quantity
Amount: USD 0.00
Sign in to MedChemExpress Sign In
Register
Sign in to MedChemExpress
Register New Account

At least 6 characters

Personalize your experience, you are currently not signed in. For a better experience, please create an online profile, you can:

Obtain points redemption prizes
Check out faster
Add multiple shipping locations
View orders
Assay Types
  • Bepirovirsen sodium Chemical Structure
    Bepirovirsen sodium Chemical Structure DNA, d(P-thio)([2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]rA-G-G-T-G-A-A-G-m5C-G-A-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rU-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC), sodium salt
    1/16
  • DNA, d(P-thio)([2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]rA-G-G-T-G-A-A-G-m5C-G-A-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rU-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC), sodium salt