Bepirovirsen sodium
Based on 1 Customer Validation
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC).
For research use only. We do not sell to patients.
- Purity : 97.10%
- CAS No.: 2563929-84-8
- Formula: C230H290N88Na19O115P19S19
- Molecular Weight:7344 (free acid)
-
Storage:
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Biological Activity
Description
In Vitro
In Vivo
MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.
-
Animal Model:HBV-transgenic mice[3]
-
Dosage:22 and 50 mg/kg
-
Administration:s.c., twice weekly for week 1 and once weekly for weeks 2-4
-
Result:Dose-dependently reduced hepatic expression of HBV RNA in HBV transgenic mice and reduced levels of all cytoplasmic hepatitis B core antigen in HBV-transgenic mice.
Chemical Information
-
CAS No. 2563929-84-8
-
Appearance Solid
-
Molecular Weight 7344 (free acid)
-
Formula C230H290N88Na19O115P19S19
-
Color White to off-white
-
SMILES
[Bepirovirsen (sodium)]
-
Synonyms
ISIS 505358 sodium
-
Shipping
Room temperature in continental US; may vary elsewhere.
-
Storage
-20°C, sealed storage, away from moisture
* In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)
Protocols
-
Research Protocol for Infectious Diseases
Infectious-disease experiments test how pathogens interact with host barriers, innate immune receptors, inflammatory signaling, pathogen replication, and tissue injury; pattern-recognition receptors such as TLRs, RIG-I-like receptors, NOD-like receptors, and inflammasomes detect microbial molecules and activate NF-κB, interferon, and cytokine responses. The central hypothesis is that infection severity reflects the balance between pathogen burden and host response: protective inflammation restricts pathogen growth, whereas excessive or mislocalized inflammation contributes to tissue damage and disease phenotype. Unresolved questions include which host pathways are protective versus pathogenic, why some infection models fail to translate to human disease, and which combined readouts best predict clinically relevant infection outcomes.
Purity & Documentation
-
Data Sheet (268 KB)
-
SDS (252 KB)
- English - EN (252 KB)
- Français - FR (252 KB)
- Deutsch - DE (252 KB)
- Norwegian - NO (252 KB)
- Español - ES (252 KB)
- Swedish - SV (252 KB)
- Italian - IT (252 KB)
- Korean - KR (252 KB)
- Portuguese - PT (252 KB)
-
Handling Instructions (2242 KB)
References
[1]. Yuen MF, et al. Safety, tolerability and antiviral activity of the antisense oligonucleotide bepirovirsen in patients with chronic hepatitis B: a phase 2 randomized controlled trial. Nat Med. 2021 Oct;27(10):1725-1734. [Content Brief]
[2]. Yuen MF, et al. Efficacy and Safety of Bepirovirsen in Chronic Hepatitis B Infection. N Engl J Med. 2022 Nov 24;387(21):1957-1968. [Content Brief]
[3]. Han K, et al. Preclinical and Phase 1 Assessment of Antisense Oligonucleotide Bepirovirsen in Hepatitis B Virus-Transgenic Mice and Healthy Human Volunteers: Support for Clinical Dose Selection and Evaluation of Safety, Tolerability, and Pharmacokinetics of Single and Multiple Doses. Clin Pharmacol Drug Dev. 2022 Oct;11(10):1191-1202. [Content Brief]
Calculators
Concentration (start) × Volume (start) = Concentration (final) × Volume (final)