2. Signaling Pathways
  3. Neuronal Signaling
  4. Tau Protein

Tau Protein

Tau is well established as a microtubule-associated protein in neurons. They have roles primarily in maintaining the stability of microtubules in axons and are abundant in the neurons of the central nervous system (CNS). However, under pathological conditions, aberrant assembly of tau into insoluble aggregates is accompanied by synaptic dysfunction and neural cell death in a range of neurodegenerative disorders, collectively referred to as tauopathies.

Cat. No. Product Name Effect Purity
  • HY-101184
    T807
    		99.06%
    T807 a novel tau positron emission tomography (PET) tracer.
  • HY-P1675A
    Acetyl-PHF6 amide TFA
    Acetyl-PHF6 amide TFA (AcPHF6 TFA) is a tau derived hexapeptide.
  • HY-144681
    LY3372689
    		98.74%
    LY3372689 (Formulaic Ia) is an orally active O-GlcNAcase (OGA) enzyme inhibitor. LY3372689 can be used for tauopathies research, including Alzheimer’s disease.
  • HY-101183
    THK5351
    		98.94%
    THK5351 can be radiolabeled and used as a radiotracer for in vivo imaging of tau pathology in the brain.
  • HY-139307
    MG-2119
    		99.60%
    MG-2119 is a potent monomeric tau and α-syn aggregation inhibitor. MG-2119 is a potential agent for neurological disorders research.
  • HY-P99399
    Semorinemab
    		Inhibitor
    Semorinemab (RG 6100) is an anti-Tau humanized IgG4 monoclonal antibody, targets the N-terminal portion of the Tau protein (amino acid residues 6-23). Semorinemab binds with human Tau with a Kd value of 3.8 nM. Semorinemab can be used for the research of Alzheimer's Disease.
  • HY-P99471
    Bepranemab
    		Inhibitor
    Bepranemab (UCB 0107) is a humanized, full-length IgG4 monoclonal antibody that binds to a central tau epitope (amino acids 235-250). Bepranemab can be used for Alzheimer’s disease (AD) research.
  • HY-134968A
    (R)-TTBK1-IN-1
    		Inhibitor
    (R)-TTBK1-IN-1 is a potent, selective and brain-penetrant tau tubulin kinase 1 (TTBK1) inhibitor. (R)-TTBK1-IN-1 is an enantiomer of TTBK1-IN-1 (HY-134968). (R)-TTBK1-IN-1 can be used in the research of alzheimer’s disease and related tauopathies.
  • HY-134968
    TTBK1-IN-1
    		Inhibitor 99.53%
    TTBK1-IN-1 is a potent, selective and brain-penetrant tau tubulin kinase 1 (TTBK1) inhibitor with an IC50 of 2.7 nM. TTBK1-IN-1 can be used for the research of alzheimer’s disease and related tauopathies.
  • HY-141660
    BSc3094
    		98.68%
    BSc3094 is a Tau aggregation inhibitor. BSc3094 can be used for the research of Alzheimer's disease (AD).
  • HY-132582
    IONIS-MAPTRx
    		Inhibitor
    IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease. ( MCE IONIS-MAPTRx for murine use: TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
  • HY-P1707A
    Tau protein (592-597), human TFA
    Tau protein (592-597), human TFA is a peptide fragment of human Tau protein. The dysfunction of Tau protein is involved in neurodegeneration and dementia.
  • HY-P0181
    Microtubule-associated protein tau (26-44)
    Microtubule-associated protein tau (26-44) is a synthetic peptide chain with an amine group attached to glutamine and an carboxyl group attached to lysine.
  • HY-P2516
    Tau Peptide (275-305) (Repeat 2 domain)
    Tau Peptide (275-305) (Repeat 2 domain) is the Alzheimer's tau fragment R2, corresponding to the second repeat unit of the microtubule-binding domain, which is believed to be pivotal to the biochemical properties of full tau protein.
  • HY-P3307
    Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2
    Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2 is serum stable, non-toxic to neuronal cells, and selectivity inhibits the fibrilization of tau over Aβ42.
  • HY-149272
    tau/Aβ40 aggregation-IN-1
    		Inhibitor
    tau/Aβ40 aggregation-IN-1 (Compound 20) is a tau and Aβ40 aggregation inhibitor with IC50s of 1.8 μM and 1.3 μM, respectively.
  • HY-P99648
    Gosuranemab
    		Inhibitor
    Gosuranemab (BMS-986168) is a humanised IgG4 anti-tau monoclonal antibody. Gosuranemab binds to human N-terminal tau residues 15-22. Gosuranemab has the potential for the research of alzheimer’s disease (AD).
  • HY-101185
    T808
    		Chemical
    T808 is a tau-selective Alzheimer’s PET ligand. T808 is a type of imaging agent used in positron emission tomography (PET) scans. It is a radiotracer that is used to help visualize certain areas of the body, such as the brain, in order to diagnose and monitor various medical conditions.
  • HY-P4822
    Acetyl-PHF5 amide
    Acetyl-PHF5 amide is an amyloidogenic protein tau peptide. Acetyl-PHF5 amide can polymerization into filamentous structures.
  • HY-19738
    NQTrp
    		Inhibitor 98.15%
    NQTrp, an aromatic naphthoquinone-tryptophan hybrid molecule, an inhibitor of the aggregation of the tau protein with generic anti-amyloidogenic effects. NQTrp inhibits the in vitro aggregation of hexapeptide (41GCWMLY46 within the N-terminus of γD-crystallin) as well as full-length γD-crystallin.
Cat. No. Product Name / Synonyms Application Reactivity