1. Signaling Pathways
  2. Neuronal Signaling
  3. Tau Protein
  4. Tau Protein Inhibitor

Tau Protein Inhibitor

Tau Protein Inhibitors (35):

Cat. No. Product Name Effect Purity
  • HY-N1472
    Levistolide A
    Inhibitor 99.26%
    Levistolide A is an apoptosis inducer and a PEDV virus inhibitor. Levistolide A can induce apoptosis in colon cancer cells and suppress the replication of porcine epidemic diarrhea virus (PEDV) by promoting ROS generation. Levistolide A activates peroxisome proliferator-activated receptor γ (PPARγ) in N2a/APP695swe cells and reduces excessive phosphorylation of tau through the GSK3α/β pathway, improving symptoms in Alzheimer’s mice. Levistolide A improves kidney damage in 5/6 nephrectomy (Nx) mice by inhibiting the RAS,TGF-β1/Smad, and MAPK pathways.
  • HY-134968
    TTBK1-IN-1
    Inhibitor 99.53%
    TTBK1-IN-1 is a potent, selective and brain-penetrant tau tubulin kinase 1 (TTBK1) inhibitor with an IC50 of 2.7 nM. TTBK1-IN-1 can be used for the research of alzheimer’s disease and related tauopathies. TTBK1-IN-1 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
  • HY-P99399
    Semorinemab
    Inhibitor 99.90%
    Semorinemab (RG 6100) is an anti-Tau humanized IgG4 monoclonal antibody, targets the N-terminal portion of the Tau protein (amino acid residues 6-23). Semorinemab binds with human Tau with a Kd value of 3.8 nM. Semorinemab can be used for the research of Alzheimer's Disease.
  • HY-132582C
    IONIS-MAPTRx sodium
    Inhibitor
    IONIS-MAPTRx sodium is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx sodium has the potential for the research of Alzheimer Disease.
  • HY-162812
    H3R antagonist 4
    Inhibitor
    H3R antagonist 4 (compound 11L) was a dual inhibitor of cholinesterase and histamine receptor (H3R), with corresponding IC50 of 7.04 μM (eeAChE), 9.73 μM (hAChE)(reversible) and 1.09 nM (H3R) , respectively. H3R antagonist 4 inhibited the aggregation of Aβ1-42 induced by itself and Cu2+ (95.48% and 88.63%) , and degraded the Aβ1-42 fibrils induced by itself and Cu2+ (80.16% and 89.30%) . H3R antagonist 4 chelate biometals such as Cu2+, Zn2+, Al3+, and Fe2+. H3R antagonist 4 significantly reduced tau protein hyperphosphorylation induced by Aβ1-42 and inhibited RSL-3-induced apoptosis and ferroptosis in PC12 cells. H3R antagonist 4 had the best blood-brain barrier permeability and intestinal absorption in hCMEC/D3 and hPepT1-MDCK cells.H3R antagonist 4 ameliorates learning and memory impairment in a mouse model of Alzheimer's disease induced by scopolamine (HY-N0296) .
  • HY-P99163
    Tilavonemab
    Inhibitor
    Tilavonemab (ABBV-8E12) is a humanized anti-tau antibody that targets the extracellular form of pathological tau protein aggregates by binding to the N-terminal 25-30 amino acid residues of tau protein. Tilavonemab blocks the ability of human and mouse neurons to take up tau aggregates, reduces the loss of brain volume, slows the progression of tau pathology, and improves cognitive abilities in transgenic mice expressing mutant human tau. Tilavonemab is used in Alzheimer's disease research.
  • HY-P99471
    Bepranemab
    Inhibitor 99.79%
    Bepranemab (UCB 0107) is a humanized, full-length IgG4 monoclonal antibody that binds to a central tau epitope (amino acids 235-250). Bepranemab can be used for Alzheimer’s disease (AD) research.
  • HY-132582
    IONIS-MAPTRx
    Inhibitor
    IONIS-MAPTRx (BIIB080) is the first Tau-lowering antisense oligonucleotide (ASO). IONIS-MAPTRx has the potential for the research of Alzheimer Disease.
  • HY-156585
    CNS-11
    Inhibitor 98.88%
    CNS-11 is a compoud that disaggregates tau fibrils. CNS-11 can be used for Alzheimer's disease (AD) research.
  • HY-154851
    GSK-3 inhibitor 3
    Inhibitor 98.72%
    GSK-3 inhibitor 3 is a selective, orally active and brain-penetrant inhibitor of GSK-3, with IC50s of 0.35 nM and 0.25 nM for GSK-3α and GSK-3β, respectively. GSK-3 inhibitor 3 lowers levels of tau protein phosphorylation at S396 in a triple-transgenic mouse Alzheimer’s disease model, with IC50 of 10 nM. GSK-3 inhibitor 3 can be used for neurological disease research.
  • HY-P99648
    Gosuranemab
    Inhibitor
    Gosuranemab (BMS-986168) is a humanised IgG4 anti-tau monoclonal antibody. Gosuranemab binds to human N-terminal tau residues 15-22. Gosuranemab has the potential for the research of alzheimer’s disease (AD).
  • HY-132582A
    Tau ASO-12 (murine) (sodium)
    Inhibitor
    TauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
  • HY-19738
    NQTrp
    Inhibitor 98.15%
    NQTrp, an aromatic naphthoquinone-tryptophan hybrid molecule, an inhibitor of the aggregation of the tau protein with generic anti-amyloidogenic effects. NQTrp inhibits the in vitro aggregation of hexapeptide (41GCWMLY46 within the N-terminus of γD-crystallin) as well as full-length γD-crystallin.
  • HY-134968A
    (R)-TTBK1-IN-1
    Inhibitor 98.93%
    (R)-TTBK1-IN-1 is a potent, selective and brain-penetrant tau tubulin kinase 1 (TTBK1) inhibitor. (R)-TTBK1-IN-1 is an enantiomer of TTBK1-IN-1 (HY-134968). (R)-TTBK1-IN-1 can be used in the research of alzheimer’s disease and related tauopathies. (R)-TTBK1-IN-1 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
  • HY-105022
    Sabeluzole
    Inhibitor 99.82%
    Sabeluzole (R 58735), a benzothiazol derivative, has antiischemic, antiepileptic, and cognitive-enhancing properties. Sabeluzole protects rat hippocampal neurons against NMDA- and glutamate-induced neurotoxicity via preventing tau expression. Sabeluzole enhances memory in rats, and prevents the amnesic effect of Chlordiazepoxide. Sabeluzole can be used fro research of Alzheimer's disease.
  • HY-P9995
    Posdinemab
    Inhibitor
    Posdinemab is a humanized IgG1κ antibody, targeting to microtubule-associated protein tau (MAPT).
  • HY-153431
    TRV-1387
    Inhibitor
    TRV-1387 is a benzofurazan that inhibits the aggregation of tau and amyloid-β.
  • HY-149237
    hAChE-IN-2
    Inhibitor
    hAChE-IN-2 is a potent hAChE inhibitor, with an IC50 of 0.71 μM. hAChE-IN-2 can also inhibits tau-oligomerization, with an EC50 of 2.21 μM. hAChE-IN-2 exhibits neuroprotective activity.
  • HY-161328
    MAO-B-IN-31
    Inhibitor
    MAO-B-IN-31 (Compound 30) is an effective and selective inhibitor of monoamine oxidase B (monoamine oxidase B). The IC50 value is 41 nM. MAO-B-IN-31 also inhibits α-syn and tau aggregation. MAO-B-IN-31 has neuroprotective activity.
  • HY-162750
    ZJCK-6-46
    Inhibitor
    ZJCK-6-46 (32) is a potential and orally activeDYRK1A inhibitor (IC50 = 0.68 nM) with high BBB permeability (CNS+). ZJCK-6-46 (32) reduces tau phosphorylation. ZJCK-6-46 (32) ameliorates cognitive dysfunction by obviously reducing the expression of phosphorylated tau and neuronal loss in vivo.