Human iPSC/ESC Cardiomyocyte Induction Differentiation Kit

MCE Human iPSC/ESC Cardiomyocyte Induction Differentiation Kit is based on the classical GiWi system. By precisely modulating the Wnt/β-catenin signaling pathway in a temporally controlled manner (sequential activation and inhibition), the kit enables highly efficient directed differentiation of human pluripotent stem cells into cardiomyocytes. It is suitable for cardiac disease modeling, drug cardiotoxicity assessment, and mechanistic studies.

  • Storage :

    -20°C, 2 years.

Description & Advantages

MCE Human iPSC/ESC Cardiomyocyte Induction Differentiation Kit is based on the classical GiWi system. By precisely modulating the Wnt/β-catenin signaling pathway in a temporally controlled manner (sequential activation and inhibition), the kit enables highly efficient directed differentiation of human pluripotent stem cells into cardiomyocytes. This system recapitulates key stages of cardiac development:

 Wnt activation phase (≈ 2 d): Induces specification of the cardiogenic lateral plate mesoderm and promotes progenitor cell expansion.

 Wnt inhibition phase (≈ 4 d): Drives cardiomyocyte progenitors toward contractile cardiomyocyte lineages.

 Maturation phase (≈ 8 d): Combined with metabolic selection (glucose-free, high-lactate culture), promotes sarcomere assembly, electrophysiological maturation, and metabolic remodeling (e.g., the MYH6-to-MYH7 expression shift).

Through this workflow, synchronized spontaneously beating, high-purity (cTnT+), and electrophysiologically mature induced cardiomyocytes (iCMs) can be obtained within 14-15 d.

 

The kit provides a chemically defined medium system covering all five essential stages of differentiation, supporting initiation from a 24-well plate scale and allowing maintenance of cultures up to day 20. This system offers high reproducibility and robust functional performance, making it suitable for cardiac disease modeling, drug cardiotoxicity assessment, and mechanistic studies.

Protocol

Reagents and Consumables Required

DMEM/F-12 (HY-K3002), DPBS (HY-K3008), Basement Membrane Matrix IPSC-qualified (HY-K6006), CEPT Cocktail Plus (1000×) (HY-K6021), Human PSC Maintenance Medium (HY-K6501), Human PSC Embryoid Body (EB) Induction Medium (HY-K6503), and 24-well TC-treated plates.

PSC Culture

Thaw ESCs (<60 passages) or iPSCs (<50 passages) according to the cell line and passage twice to obtain P3 cells. H9 and some iPSC lines have relatively limited mesoderm differentiation capacity; H1, H7, or iPSC lines with validated mesoderm performance are preferred.

Passaging Prior to Induction

1. Initiation criteria: P3 colonies should have smooth, well-defined borders, a normal nuclear-to-cytoplasmic ratio (nuclei occupying approximately 60% of the cell area), compact cell-cell contacts, and a negative mycoplasma test.

2. Prepare 12 mL Human PSC EB Induction Medium with 12 μL CEPT Cocktail Plus (1000×) and equilibrate to room temperature.

3. Select one well of a 6-well plate, wash twice with DPBS, add 1 mL ECM Gentle Dissociation Solution, and incubate at 37°C for 6-8 min.

4. Add 1 mL HBSS or DMEM/F-12 to stop dissociation, gently triturate twice, transfer to a 15 mL tube, and centrifuge at 120 × g for 5 min.

5. Resuspend in 12 mL CEPT-containing EB Induction Medium and seed into a pre-warmed matrix-coated 24-well plate at 500 μL per well.

6. After 24 h, replace with 500 μL Human PSC Maintenance Medium per well and then change medium daily until confluence is >90%.

Lateral Plate Mesoderm Pulse Activation and Expansion

1. Start when cell confluence exceeds 90%.

2. D0: Wash twice with pre-warmed HBSS or DMEM/F-12, add 500 μL Mesoderm Induction Medium per well, and perform a 24 h pulse induction.

3. D1 (24 h): Exactly 24 h later, remove medium, wash twice, add 1 mL Mesoderm Expansion Medium per well, and continue for another 24 h. The activation/expansion phase lasts 48 h in total.

Cardiogenic Mesoderm Activation and Cardiomyocyte Progenitor Specification

1. qPCR validation: After mesoderm activation/expansion, digest cells from three wells and assess Brachyury (T) and PDGFRα using the primer pairs below:

Marker Forward primer (5'→3') Reverse primer (5'→3')
Brachyury (T) TATGAGCCTCGAATCCACATAGT CCTCGTTCTGATAAGCAGTCAC
PDGFRα AGCACCTTCGTTCTGACCTG TATTCTCCCGTGTCTAGCCCA

Mesoderm induction is considered successful when Brachyury and PDGFRα mRNA, calculated by ΔΔCt and normalized to β-Actin, reach approximately 120-1500-fold above the internal reference. For qPCR, use SYBR Green chemistry with 100 ng cDNA per reaction, a 60°C annealing temperature, 40 cycles, an NTC, and melt-curve analysis.

2. Wash cells twice with pre-warmed HBSS/DMEM/F-12 after confirming high marker expression.

3. Cardiogenic mesoderm activation: Add 500 μL pre-warmed Cardiac Mesoderm Induction Medium per well. Perform complete daily medium changes, with a gentle wash before replacement, for 4 d.

4. After the 4 d induction, wash twice with pre-warmed HBSS/DMEM/F-12.

5. Cardiomyocyte progenitor specification: Add 1 mL Cardiac Progenitor Cell Differentiation Medium per well and perform complete daily medium changes for 4 d. Together with the prior stage, this forms an 8 d cardiac-lineage specification program.

6. Morphology: Typical features include dark brown/black cell clusters, black ridge-like striations, nuclear condensation, smaller nuclei, and expanded intercellular spaces.

iCM Maturation and Replating

1. Prepare 6 mL Cardiac Progenitor Cell Differentiation Medium + 6 mL Induced Cardiomyocytes (iCMs) Maturation Medium + 12 μL CEPT Cocktail Plus (1000×).

2. Wash cells twice with HBSS or DMEM/F-12 and add 500 μL/well of the mixed medium for 24 h metabolic adaptation.

3. After 24 h, replace with 1 mL/well Induced Cardiomyocytes (iCMs) Maturation Medium and continue for 3 d. Synchronized spontaneous contractions generally appear as maturation progresses.

4. Mature contracting iCMs may be replated 2-3 times. Prewarm ECM-coated confocal dishes/coverslips at 37°C for 12 h and prepare complete cardiomyocyte dissociation solution by mixing Reagent A and Reagent B at 1 : 1.

5. Wash once with DPBS, add 500 μL complete dissociation solution per well, and incubate at 37°C for 12-15 min until cell gaps enlarge and cell bodies retract.

6. Centrifuge at 150 × g for 3 min, resuspend in cardiomyocyte progenitor differentiation medium containing CEPT Cocktail Plus, and seed. Keep final seeding and medium-replacement volume at ≤500 μL per dish/well.

7. After 24 h, switch to Cardiac Progenitor Cell Differentiation Medium without CEPT and culture for another 2 d before immunofluorescence analysis such as TNNT2/NKX2-5/SMA/TBX5/COL4.

Storage

-20°C, 2 years.

Attention

1. This product is sterile and should be handled using aseptic techniques. It is recommended to aliquot and store to avoid contamination.

2. This product is for R&D use only, not for drug, household, or other uses.

3. For your safety and health, please wear a lab coat and disposable gloves to operate.

Components

Components HY-K6303-1 Kit
Mesoderm Induction Medium 30 mL
Mesoderm Expansion Medium 30 mL
Cardiac Mesoderm Induction Medium 50 mL
Cardiac Progenitor Cell Differentiation Medium 100 mL
Induced Cardiomyocytes (iCMs) Maturation Medium 100 mL

Documentation

MOQ
Minimum order quantity
100 mg

Get Quote In-stock

Other size
Get Quote
Please select quantity
Amount: USD 0.00