2563929-84-8
Chemical Structure
Bepirovirsen sodium
Synonym(s): ISIS 505358 sodium
- CAS No.: 2563929-84-8
- Formula:C230H290N88Na19O115P19S19
- Molecular Weight:7344 (free acid)
SMILES: [Bepirovirsen (sodium)]
Biological Activity: Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC)[1][2][3].
| Cat. No. | Product Name | Purity | Description | Pricing | |||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
Bepirovirsen sodium | 97.10% | Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC). | ||||||||||||||||||||
|
loading...
/
|
|||||||||||||||||||||||
References
- [1]. Yuen MF, et al. Safety, tolerability and antiviral activity of the antisense oligonucleotide bepirovirsen in patients with chronic hepatitis B: a phase 2 randomized controlled trial. Nat Med. 2021 Oct;27(10):1725-1734. [Content Brief]
- [2]. Yuen MF, et al. Efficacy and Safety of Bepirovirsen in Chronic Hepatitis B Infection. N Engl J Med. 2022 Nov 24;387(21):1957-1968. [Content Brief]
- [3]. Han K, et al. Preclinical and Phase 1 Assessment of Antisense Oligonucleotide Bepirovirsen in Hepatitis B Virus-Transgenic Mice and Healthy Human Volunteers: Support for Clinical Dose Selection and Evaluation of Safety, Tolerability, and Pharmacokinetics of Single and Multiple Doses. Clin Pharmacol Drug Dev. 2022 Oct;11(10):1191-1202. [Content Brief]