Bepirovirsen

(Synonyms: ISIS 505358)
Customer Review

Based on 1 Customer Validation

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

For research use only. We do not sell to patients.

  • Purity : 97.10%
  • CAS No.: 1403787-62-1
  • Molecular Weight:7344.00
  • Storage:

    -20°C, sealed storage, away from moisture

    * In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

  • Biological Activity
  • Chemical Information
  • Solvent & Solubility
  • Protocols
  • Purity & Documentation
  • References
  • Help & FAQs
MOQ
Minimum order quantity
100 mg

Get Quote In-stock

Other size
Get Quote
Please select quantity
Amount: USD 0.00