1403787-62-1
Chemical Structure
Bepirovirsen
Synonym(s): ISIS 505358
- CAS No.: 1403787-62-1
- Formula:N/A
- Molecular Weight:7344.00
SMILES: [Bepirovirsen]
Biological Activity: Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].
| Cat. No. | Product Name | Purity | Description | Pricing | |||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
Bepirovirsen | 97.10% | Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC). | ||||||||||||||||||||
|
loading...
/
|
|||||||||||||||||||||||