2. Anti-infection
  3. HBV
  4. Bepirovirsen

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).

Para uso exclusivo en investigación. No vendemos a pacientes.

DNA, d(P-thio)([2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]rA-G-G-T-G-A-A-G-m5C-G-A-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rU-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC)

Bepirovirsen Estructura química

No. CAS : 1403787-62-1

Tamaño Precio Stock Cantidad
1 mg En stock
5 mg En stock
10 mg   Obtener un presupuesto  
50 mg   Obtener un presupuesto  

* Seleccione Cantidad antes de agregar artículos.

This product is a controlled substance and not for sale in your territory.

Revisión del cliente

Based on 1 Customer Validation

Other Forms of Bepirovirsen:

Bepirovirsen Related Antibodies

Top Publications Citing Use of Products

  • Actividad biológica

  • Pureza y Documentación

  • Referencias

  • Revisión del cliente

Descripciòn

Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].

In Vitro

Bepirovirsen (16-250 nM; 16 h) reduces hepatitis B virus (HBV) RNA, DNA, and viral proteins in HepG2.2.15 cells[1].

MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.

Bepirovirsen Related Antibodies
In Vivo

Bepirovirsen (22-50 mg/kg/week; s.c. twice weekly for week 1 and once weekly for weeks 2-4) reduces hepatic HBV RNA and DNA in HBV-transgenic mice[1].

MedChemExpress (MCE) has not independently confirmed the accuracy of these methods. They are for reference only.

Animal Model: Male HBV transgenic mice (Tg[HBV 1.3 genome]Chi32 against C57BL/6 background) aged 7-12 weeks and weight 18-25 g[1].
Dosage: 22, 50 mg/kg/week
Administration: Injected subcutaneously twice weekly for week 1 and once weekly for weeks 2-4
Result: Dose-dependently reduced hepatic levels of HBV DNA and HBV RNA in HBV transgenic mice.
Reduced levels of serum HBV DNA, serum HBsAg and serum HBeAg.
Ensayo clínico
Peso molecular

7344.00

No. CAS
Appearance

Solid

Color

White to off-white

Sequence

DNA, d(P-thio)([2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]rA-G-G-T-G-A-A-G-m5C-G-A-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rU-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC)
SMILES

[Bepirovirsen]
Envío

Room temperature in continental US; may vary elsewhere.
Almacenamiento

-20°C, sealed storage, away from moisture

*In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

Solvente y solubilidad
In Vitro: 

H2O : ≥ 20 mg/mL (2.72 mM)

*"≥" means soluble, but saturation unknown.

Preparing
Stock Solutions
Concentration Solvent Mass 1 mg 5 mg 10 mg
1 mM 0.1362 mL 0.6808 mL 1.3617 mL
5 mM --- --- ---
View the Complete Stock Solution Preparation Table

* Please refer to the solubility information to select the appropriate solvent. Once prepared, please aliquot and store the solution to prevent product inactivation from repeated freeze-thaw cycles.
Storage method and period of stock solution: -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture). When stored at -80°C, please use it within 6 months. When stored at -20°C, please use it within 1 month.

* Note: If you choose water as the stock solution, please dilute it to the working solution, then filter and sterilize it with a 0.22 μm filter before use.

  • Calculadora de molaridad

  • Calculadora de dilución

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass
=
Concentration
×
Volume
×
Molecular Weight *

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start)

C1

×
Volume (start)

V1

=
Concentration (final)

C2

×
Volume (final)

V2

In Vivo Dissolution Calculator
Please enter the basic information of animal experiments:

Dosage

mg/kg

Animal weight
(per animal)

g

Dosing volume
(per animal)

μL

Number of animals

Recommended: Prepare an additional quantity of animals to account for potential losses during experiments.
Calculation results:
Working solution concentration: mg/mL
This product has good water solubility, please refer to the measured solubility data in water/PBS/Saline for details.
The concentration of the stock solution you require exceeds the measured solubility. The following solution is for reference only.If necessary, please contact MedChemExpress (MCE).
Pureza y Documentación

Purity: 98.44%

SDS (252 KB)

COA (247 KB) LCMS (315 KB)

Instrucciones de manejo (2242 KB)
Referencias

Complete Stock Solution Preparation Table

* Please refer to the solubility information to select the appropriate solvent. Once prepared, please aliquot and store the solution to prevent product inactivation from repeated freeze-thaw cycles.
Storage method and period of stock solution: -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture). When stored at -80°C, please use it within 6 months. When stored at -20°C, please use it within 1 month.

Optional Solvent Concentration Solvent Mass 1 mg 5 mg 10 mg 25 mg
H2O 1 mM 0.1362 mL 0.6808 mL 1.3617 mL 3.4041 mL

* Note: If you choose water as the stock solution, please dilute it to the working solution, then filter and sterilize it with a 0.22 μm filter before use.

  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.

Bepirovirsen Related Classifications

Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Keywords:

Bepirovirsen1403787-62-1ISIS 505358ISIS505358ISIS-505358HBVHepatitis B viruschronic HBV infectionHBV messenger RNAsInhibitorinhibitorinhibit

Productos vistos recientemente:

Consulta en línea

Your information is safe with us. * Required Fields.

Nombre del producto

  

Requested Quantity *

Nombre del solicitante *

 

Saludo

Direcciòn del E-mail *

 

Número de teléfono *

Department

 

Nombre de la Organizaciòn *

City

Provincia

Country or Region *

      

Observaciones

Consulta para venta a granel

Inquiry Information

Nombre del producto:
Bepirovirsen
Cat. No.:
HY-147217
Cantidad:
MCE Japan Authorized Agent:

Revisión del cliente

Thank You for Your Feedback!

Request for HNMR Report

Please fill out this form to request the QC report. We will send it to your Email address shortly.

Your information is safe with us. * Required Fields.

Nombre del producto

  

Lot #

Nombre del solicitante *

 

Direcciòn del E-mail *

Número de teléfono

 

Department *

Nombre de la Organizaciòn *

 

Country or Region *

Observaciones

SAFETY DATA SHEET (SDS)

English - EN (252 KB) Français - FR (252 KB) Deutsch - DE (252 KB) Norwegian - NO (252 KB) Español - ES (252 KB) Swedish - SV (252 KB) Italian - IT (252 KB) Korean - KR (252 KB) Portuguese - PT (252 KB)

Request for HNMR Report

We have received your request and will respond to you as soon as possible.