2. Signaling Pathways
  3. Neuronal Signaling
  4. Tau Protein

Tau Protein

Tau is well established as a microtubule-associated protein in neurons. They have roles primarily in maintaining the stability of microtubules in axons and are abundant in the neurons of the central nervous system (CNS). However, under pathological conditions, aberrant assembly of tau into insoluble aggregates is accompanied by synaptic dysfunction and neural cell death in a range of neurodegenerative disorders, collectively referred to as tauopathies.

Cat. No. Product Name Effect Purity Chemical Structure
  • HY-P4924
    Tau Peptide (244-274) (Repeat 1 Domain)
    Tau Peptide (244-274) (Repeat 1 Domain) is aTau fragment.
    Tau Peptide (244-274) (Repeat 1 Domain)
  • HY-P4927
    Tau Peptide (245-274) (Repeat 1 Domain)
    Tau Peptide (245-274) (Repeat 1 Domain) is aTau fragment.
    Tau Peptide (245-274) (Repeat 1 Domain)
  • HY-P4943
    Tau Peptide (273-284)
    Tau Peptide (273-284) is aTau fragment.
    Tau Peptide (273-284)
  • HY-P4960
    Tau Peptide (294-305) (human)
    Tau Peptide (294-305) (human) is aTau fragment.
    Tau Peptide (294-305) (human)
  • HY-P4972
    Tau Peptide (45-73) (Exon 2/Insert 1 Domain)
    Tau Peptide (45-73) (Exon 2/Insert 1 Domain) is aTau fragment.
    Tau Peptide (45-73) (Exon 2/Insert 1 Domain)
  • HY-P4933
    Tau Peptide (255-314) (Repeat 2 Domain) (human)
    Tau Peptide (255-314) (Repeat 2 Domain) (human) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development.
    Tau Peptide (255-314) (Repeat 2 Domain) (human)
  • HY-153431
    TRV-1387
    		Inhibitor
    TRV-1387 is a benzofurazan that inhibits the aggregation of tau and amyloid-β.
    TRV-1387
  • HY-149237
    hAChE-IN-2
    		Inhibitor
    hAChE-IN-2 is a potent hAChE inhibitor, with an IC50 of 0.71 μM. hAChE-IN-2 can also inhibits tau-oligomerization, with an EC50 of 2.21 μM. hAChE-IN-2 exhibits neuroprotective activity.
    hAChE-IN-2
  • HY-132582A
    Tau ASO-12 (murine) (sodium)
    		Inhibitor
    TauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
    Tau ASO-12 (murine) (sodium)
  • HY-P4966
    Tau Peptide (306-336) (Repeat 3 Domain)
    Tau Peptide (306-336) (Repeat 3 Domain) is aTau fragment.
    Tau Peptide (306-336) (Repeat 3 Domain)
  • HY-P3307
    Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2
    Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2 is serum stable, non-toxic to neuronal cells, and selectivity inhibits the fibrilization of tau over Aβ42.
    Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2
  • HY-149272
    tau/Aβ40 aggregation-IN-1
    		Inhibitor
    tau/Aβ40 aggregation-IN-1 (Compound 20) is a tau and Aβ40 aggregation inhibitor with IC50s of 1.8 μM and 1.3 μM, respectively.
    tau/Aβ40 aggregation-IN-1
  • HY-149542
    GSK-3β inhibitor 15
    		Inhibitor
    GSK-3β inhibitor 15 (Compound 54) is a GSK-3β inhibitor (IC50: 3.4 nM). GSK-3β inhibitor 15 inhibits Aβ1-42-induced GSK-3β and tau protein phosphorylation. GSK-3β inhibitor 15 inhibits LPS-induced iNOS expression. GSK-3β inhibitor 15 has neuroprotective effects on Aβ1-42-induced neurotoxicity. GSK-3β inhibitor 15 can be used for research of Alzheimer’s disease (AD).
    GSK-3β inhibitor 15
  • HY-149418
    BChE/HDAC6-IN-2
    		Inhibitor
    BChE/HDAC6-IN-2 (compound 29a) is a dual inhibitor of BChE and HDAC6 with IC50s of 1.8 nM and 71.0 nM, respectively. BChE/HDAC6-IN-2 has prominently neuroprotective effects and reactive oxygen species (ROS) scavenging activity. BChE/HDAC6-IN-2 is also an effective chelator of metal ion (Fe2+ and Cu2+). BChE/HDAC6-IN-2 inhibits phosphorylation of tau, and exhibits moderate immunomodulatory effect.
    BChE/HDAC6-IN-2
  • HY-P4969
    Tau Peptide (379-408)
    Tau Peptide (379-408) is aTau fragment.
    Tau Peptide (379-408)
  • HY-P4822
    Acetyl-PHF5 amide
    Acetyl-PHF5 amide is an amyloidogenic protein tau peptide. Acetyl-PHF5 amide can polymerization into filamentous structures.
    Acetyl-PHF5 amide
  • HY-162020
    SB1617
    		Inhibitor
    SB1617 is a neuroinflammation-modulating agent, and has neuroprotective effect by reducing pathogenic tau levels through microglia-mediated anti-inflammatory activity.
    SB1617
  • HY-116753
    (-)Clausenamide
    		Inhibitor
    (-)Clausenamide is an active alkaloid isolated from the leaves of Clausena lansium (Lour.) Skeels, and improves cognitive function in both normal physiological and pathological conditions. (-)Clausenamide inhibits β-amyloid (Aβ) toxicity, blocking neurofibrillary tangle formation by inhibiting the phosphorylation of tau protein. (-)Clausenamide exerts a significant neuroprotective activity against Aβ25-35. (-)Clausenamide can be used for researching Alzheimer's disease (AD).
    (-)Clausenamide
  • HY-147321
    3'-DMTr-dG(iBu)
    3'-DMTr-dG(iBu) is a nucleoside for the synthesis of nucleic acid, such as antiviral agents used in the research of viral infection (HBV, HDV), and oligonucleotides against Alzheimer’s disease and other tauopathies.
    3'-DMTr-dG(iBu)
  • HY-149233
    hAChE-IN-1
    		Inhibitor
    hAChE-IN-1 (Compound 24) is a potent hAChE inhibitor with an IC50 of 1.09 μM. hAChE-IN-1 inhibits tau-oligomerization with an EC50 of 2.71 μM in cellular tau FRET assay.
    hAChE-IN-1
Cat. No. Product Name / Synonyms Application Reactivity