Copy Link Print Information

Tau ASO-12 (murine) sodium

Customer Review

Based on 1 Customer Validation

TauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )

For research use only. We do not sell to patients.

  • Purity: 97.18%
  • Molecular Weight:7619.00
  • Storage:

    4°C, sealed storage, away from moisture

    * In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

  • Tau ASO-12 (murine) sodium Chemical Structure
    Tau ASO-12 (murine) sodium Chemical Structure
Size
Price
Stock
Quantity
Amount: USD 0.00
Please select quantity
or
or

* Please select Quantity before adding items.

To place orders, for customer services and technical support, please contact: MedChemExpress USA

Tel: 609-228-6898 E-mail: [email protected] [email protected]

Data Download
Other Forms of Tau ASO-12 (murine) sodium:

To place orders, for customer services and technical support, please contact:

609-228-6898
[email protected] [email protected]
Find Your Local Distributor Your local distributor: Hycultec GmbHHycultec
  • Biological Activity
  • Chemical Information
  • Purity & Documentation
  • References
  • Help & FAQs
Top Publications Citing

Use of MCE Products
Keywords
MOQ
Minimum order quantity
100 mg

Get Quote In-stock

Other size
Get Quote
Please select quantity
Amount: USD 0.00
Sign in to MedChemExpress Sign In
Register
Sign in to MedChemExpress
Register New Account

At least 6 characters

Personalize your experience, you are currently not signed in. For a better experience, please create an online profile, you can:

Obtain points redemption prizes
Check out faster
Add multiple shipping locations
View orders
Assay Types
  • Tau ASO-12 (murine) sodium Chemical Structure
    Tau ASO-12 (murine) sodium Chemical Structure 5′ GCTTTTACTGACCATGCGAG 3′, sodium salt
    1/16
  • 5′ GCTTTTACTGACCATGCGAG 3′, sodium salt