2. Neuronal Signaling
  3. Tau Protein
  4. Tau ASO-12 (murine) (sodium)

TauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )

For research use only. We do not sell to patients.

5′ GCTTTTACTGACCATGCGAG 3′, sodium salt

Tau ASO-12 (murine) (sodium) Chemical Structure

Size Price Stock Quantity
1 mg USD 225 In-stock
5 mg USD 690 In-stock
10 mg USD 1202 In-stock
50 mg   Get quote  
100 mg   Get quote  

* Please select Quantity before adding items.

This product is a controlled substance and not for sale in your territory.

Customer Review

Based on 1 publication(s) in Google Scholar

Other Forms of Tau ASO-12 (murine) (sodium):

Tau ASO-12 (murine) (sodium) Related Antibodies

Top Publications Citing Use of Products

  • Biological Activity

  • Purity & Documentation

  • References

  • Customer Review

Description

TauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ [1])

Molecular Weight

7619.00

Appearance

Solid

Color

White to light yellow

SMILES

[Tau ASO-12 (murine)]
Shipping

Room temperature in continental US; may vary elsewhere.
Storage

4°C, sealed storage, away from moisture

*In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture)

Purity & Documentation
References
  • No file chosen (Maximum size is: 1024 Kb)
  • If you have published this work, please enter the PubMed ID.
  • Your name will appear on the site.

Tau ASO-12 (murine) (sodium) Related Classifications

  • Molarity Calculator

  • Dilution Calculator

The molarity calculator equation

Mass (g) = Concentration (mol/L) × Volume (L) × Molecular Weight (g/mol)

Mass   Concentration   Volume   Molecular Weight *
= × ×

The dilution calculator equation

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)

This equation is commonly abbreviated as: C1V1 = C2V2

Concentration (start) × Volume (start) = Concentration (final) × Volume (final)
× = ×
C1   V1   C2   V2
Help & FAQs
  • Do most proteins show cross-species activity?

    Species cross-reactivity must be investigated individually for each product. Many human cytokines will produce a nice response in mouse cell lines, and many mouse proteins will show activity on human cells. Other proteins may have a lower specific activity when used in the opposite species.

Keywords:

Tau ASO-12 (murine) (sodium)Tau ProteinInhibitorinhibitorinhibit

Your Recently Viewed Products:

Inquiry Online

Your information is safe with us. * Required Fields.

Product Name

  

Salutation

Applicant Name *

 

Email Address *

Phone Number *

 

Organization Name *

Department *

 

Requested quantity *

Country or Region *

      

Remarks

Bulk Inquiry

Inquiry Information

Product Name:
Tau ASO-12 (murine) (sodium)
Cat. No.:
HY-132582A
Quantity:
MCE Japan Authorized Agent:

Customer Review

Thank You for Your Feedback!

Request for HNMR Report

Please fill out this form to request the QC report. We will send it to your Email address shortly.

Your information is safe with us. * Required Fields.

Product Name

  

Lot #

Applicant Name *

 

Email Address *

Phone Number

 

Department *

Organization Name *

 

Country or Region *

Remarks

Request for HNMR Report

We have received your request and will respond to you as soon as possible.