1. Search Result
Search Result
Results for "

ASO

" in MedChemExpress (MCE) Product Catalog:

44

Inhibitors & Agonists

1

Peptides

41

Oligonucleotides

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-108764
    Mipomersen sodium
    2 Publications Verification

    ISIS 301012

    Apolipoprotein HCV Metabolic Disease
    Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
    Mipomersen sodium
  • HY-148503

    Phosphoramidites Nucleoside Antimetabolite/Analog Others
    5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) is a nucleoside phosphoramidite monomer used to synthesize locked nucleic acid (LNA) analog oligonucleotides. It can be used as a building block of antisense oligonucleotides (ASOs) to target complementary RNA sequences. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) locks the furanose ring into an N-type conformation through 2',4'-constrained ethyl (cEt) modification, enhancing hybridization affinity and mismatch discrimination with RNA, while significantly improving the resistance of oligonucleotides to exonuclease digestion. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) mediates RNase H-dependent mRNA degradation or inhibits translation by forming a stable hybrid with RNA, thereby achieving gene expression regulation. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) is mainly used in the development of antisense drugs, gene function research and oligonucleotide synthesis related to disease treatment .
    5'-ODMT cEt N-Bz A Phosphoramidite (Amidite)
  • HY-136151
    UNC10217938A
    1 Publications Verification

    Nucleoside Antimetabolite/Analog Others
    UNC10217938A is a 3-deazapteridine analog with strong oligonucleotide enhancing effects. UNC10217938A enhances oligonucleotides effects by modulating their intracellular trafficking and release from endosomes. UNC10217938A also enhances the effects of antisense and siRNA oligonucleotides .
    UNC10217938A
  • HY-147410
    Ulefnersen
    1 Publications Verification

    ION-363

    DNA/RNA Synthesis Neurological Disease
    Ulefnersen (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
    Ulefnersen
  • HY-148130

    RG6091; RO7248824

    E1/E2/E3 Enzyme Others
    Rugonersen (RG6091; RO7248824) is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
    Rugonersen
  • HY-148687A

    PCSK9 Cardiovascular Disease
    SPC5001 sodium is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 sodium can be used for the research of hypercholesterolemia. SPC5001 sodium sequence: 5′-TGmCTACAAAACmCmCA-3′ .
    SPC5001 sodium
  • HY-132581
    Tadnersen
    1 Publications Verification

    BIIB078; IONIS-C9Rx

    Ras Others Neurological Disease
    Tadnersen (BIIB078), an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
    Tadnersen
  • HY-157261

    Biochemical Assay Reagents Endocrinology
    UNC2383 is an oligonucleotide enhancer compound. UNC2383 can enhance the efficacy of antisense oligonucleotides (ASOs) and splice-switching oligonucleotides (SSOs). UNC2383 can be used in research of diseases involving impaired oligonucleotide delivery, such as cystic fibrosis .
    UNC2383
  • HY-145725A

    ISIS 598769; IONIS 598769; BIIB 065; ISIS-DMPK-2.5Rx

    Ser/Thr Kinase Neurological Disease
    Baliforsen (ISIS 5987690) is an antisense oligonucleotide (ASO) that inhibits DMPK mRNA. Baliforsen binds within exon 9 of the human DMPK transcript to promote RNase H1-mediated degradation Baliforsen can be used for the research of myotonic dystrophy type 1 .
    Baliforsen
  • HY-148688

    DNA/RNA Synthesis Others
    ASO 556089 sodium is a 16 nucleotide length gapmer (3-10-3) that targets the human and mouse long non-coding RNA MALAT1, with the sequence: 5’-GmCATTmCTAATAGmCAGmC-3’ .
    ASO 556089 sodium
  • HY-P2742

    ASO, Cucurbit sp.

    Endogenous Metabolite Metabolic Disease
    Ascorbate oxidase, Cucurbit sp., also known as vitamin C oxidase, is a REDOX enzyme involved in the regulation of extracellular matrix. Ascorbate oxidase catalyzes the reaction of ascorbic acid and oxygen to produce dehydroascorbic acid .
    Ascorbate oxidase, Cucurbit sp.
  • HY-W048488

    DNA/RNA Synthesis Drug Intermediate Others
    2'-O-MOE-5-Me-rU is a dual chemically modified ribonucleoside, which is a key modifying unit in the development of RNA drug preparations (such as antisense oligonucleotides ASO, siRNA). Its core function is to significantly enhance the stability, target affinity and drugability of nucleic acid drugs.
    2'-O-MOE-5-Me-rU
  • HY-W570887

    Phosphoramidites DNA/RNA Synthesis Others
    LNA-A(Bz) amidite can be used for synthesis of ASOs (antisense oligonucleotides) .
    LNA-A(Bz) amidite
  • HY-134005

    FXI-ASO; BAY2306001; IONIS-FXIRx

    Factor XI Cardiovascular Disease
    ISIS 416858, a single-stranded antisense oligodeoxynucleotide, is a potent and selective inhibitor of FXI mRNA expression.
    ISIS 416858
  • HY-148370A

    IONIS-FB-LRx sodium; RG6299 sodium; ISIS 696844 sodium

    Complement System Others
    Sefaxersen sodium is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). Sefaxersen sodium effectively reduces circulating levels of CFB, and can be used for geographic atrophy (GA) research .
    Sefaxersen sodium
  • HY-148370

    IONIS-FB-LRx; RG6299; ISIS 696844

    Complement System Others
    Sefaxersen (IONIS-FB-LRx) is a specific antisense oligonucleotide (ASO) targeting complement factor B (CFB). Sefaxersen effectively reduces circulating levels of CFB. Sefaxersen can be used for geographic atrophy (GA) research .
    Sefaxersen
  • HY-W570885

    Phosphoramidites DNA/RNA Synthesis Others
    2'-O-MOE-rC is a 2'-O-MOE modified nucleoside. 2'-O-MOE-rC can be used for synthesis of DNA .
    2'-O-MOE-rC
  • HY-158827A

    PCSK9 Metabolic Disease
    AZD8233 sodium, a liver-targeting antisense oligonucleotide (ASO), inhibits subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 sodium increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
    AZD8233 sodium
  • HY-132582A

    Tau Protein Cancer
    Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
    Tau ASO-12 (murine) sodium
  • HY-137501

    Liposome Others
    306-O12B-3 is a lipidoid that can efficiently deliver ASO both in vitro and in vivo. 306-O12B-3 is used to transport small molecule drugs across the blood-brain barrier (BBB) .
    306-O12B-3
  • HY-147410A
    Ulefnersen sodium
    1 Publications Verification

    ION-363 sodium

    DNA/RNA Synthesis Neurological Disease
    Ulefnersen sodium (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen sodium can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen sodium can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
    Ulefnersen sodium
  • HY-132581E

    Scrambled BIIB078; Scrambled IONIS-C9Rx

    Ras Neurological Disease
    Scrambled Tadnersen is the Negative Control of Tadnersen sodium (HY-132581A). Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
    Scrambled Tadnersen
  • HY-132581A
    Tadnersen sodium
    1 Publications Verification

    BIIB078 sodium; IONIS-C9Rx sodium

    Ras Neurological Disease
    Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
    Tadnersen sodium
  • HY-159695A

    ISIS 426115 sodium

    Glucocorticoid Receptor Metabolic Disease
    IONIS-GCCRRx (ISIS 426115) sodium, a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .
    IONIS-GCCRRx sodium
  • HY-148130A

    RG6091 sodium; RO7248824 sodium

    E1/E2/E3 Enzyme Others
    Rugonersen sodium is a locked-nucleic acid (LNA)- modified antisense oligonucleotides (ASOs), and results in reduction of ubiquitin-protein ligase E3A (UBE3A) silencing. Angelman syndrome (AS) sodium is a severe neurodevelopmental disorder caused by the loss of neuronal E3 ligase UBE3A, Rugonersen has been used for AS reasearch .
    Rugonersen sodium
  • HY-148687

    PCSK9 Cardiovascular Disease
    SPC5001 is a locked nucleic acid (LNA)-modifed antisense oligonucleotide (ASO) complementary to human PCSK9 (proprotein convertase subtilisin/kexin type 9) mRNA. SPC5001 can be used for the research of hypercholesterolemia. SPC5001 sequence: 5′-TGmCTACAAAACmCmCA-3′ .
    SPC5001
  • HY-177615A

    GTX-102 sodium

    E1/E2/E3 Enzyme Others
    Apazunersen sodium is an antisense oligonucleotide (ASO) that targets and inhibits expression of the UBE3A antisense transcript (UBE3A-AS) to prevent silencing of the paternally inherited allele of the UBE3A gene and reactivate expression of the deficient
    Apazunersen sodium
  • HY-177615

    GTX-102

    E1/E2/E3 Enzyme Others
    Apazunersen is an antisense oligonucleotide (ASO) that targets and inhibits expression of the UBE3A antisense transcript (UBE3A-AS) to prevent silencing of the paternally inherited allele of the UBE3A gene and reactivate expression of the deficient protei
    Apazunersen
  • HY-177616

    RX-0201

    Akt Cancer
    Archexin is an antisense oligonucleotide (ASO) against Akt1. It is used for the study of metastatic renal cancer.
    Archexin
  • HY-159695

    ISIS 426115

    Glucocorticoid Receptor Metabolic Disease
    IONIS-GCCRRx (ISIS 426115), a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .
    IONIS-GCCRRx
  • HY-122740

    Bacterial Infection
    Retro-1 is a toxin inhibitor. Retro-1 blocks the retrograde transport of STxB to the trans-Golgi network/Golgi. Retro-1 inhibits the cytotoxic effects of Ricin, bacterial toxins Stx1 and Stx2. Retro-1 can also substantially enhance the effectiveness of antisense and splice switching oligonucleotides .
    Retro-1
  • HY-132581C

    Scrambled BIIB078 sodium; Scrambled IONIS-C9Rx sodium

    Ras Neurological Disease
    Scrambled Tadnersen sodium is the Negative Control of Tadnersen sodium (HY-132581A). Tadnersen sodium, an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
    Scrambled Tadnersen sodium
  • HY-158825

    CIVI007 sodium

    PCSK9 Metabolic Disease
    Cepadacursen sodium is a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. Cepadacursen sodium can be used for hypercholesterolemia research and the prevention of atherosclerotic cardiovascular disease (ASCVD).
    Cepadacursen sodium
  • HY-158827

    PCSK9 Metabolic Disease
    AZD8233, a liver-targeting antisense oligonucleotide (ASO), inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) protein synthesis. AZD8233 increases the available LDL receptors by reducing PCSK9 levels, thereby clearing LDL from the blood and decreasing LDL-C levels.
    AZD8233
  • HY-177616A

    RX-0201 sodium

    Akt Cancer
    Archexin sodium is an antisense oligonucleotide (ASO) against Akt1. It is used for the study of metastatic renal cancer.
    Archexin sodium
  • HY-148688D

    Fluorescent Dye Others
    FAM labled ASO 556089 sodiumis a FAM labled ASO 556089 sodium.
    FAM labled ASO 556089 sodium
  • HY-148688E

    Fluorescent Dye Others
    Cy3 labled ASO 556089 sodium is a Cy3 labled ASO 556089 sodium.
    Cy3 labled ASO 556089 sodium
  • HY-148688C

    DNA/RNA Synthesis Others
    ASO 556089 sodium scrambled negative control is the sequence scrambled negative control of ASO 556089 sodium.
    ASO 556089 sodium scrambled negative control
  • HY-148688H

    DNA/RNA Synthesis Others
    ASO 556089 (with PS modification) sodium is the PS-modified version of ASO 556089 (HY-148688). ASO 556089 sodium is a 16 nucleotide length gapmer (3-10-3) that targets the human and mouse long non-coding RNA MALAT1, with the sequence: 5’-GmCATTmCTAATAGmCAGmC-3’ .
    ASO 556089 (with PS modification) sodium
  • HY-132582H

    Fluorescent Dye Cancer
    FAM labled Tau ASO-12 (murine) sodiumis a FAM labled Tau ASO-12 (murine) sodium.
    FAM labled Tau ASO-12 (murine) sodium
  • HY-132582I

    Fluorescent Dye Cancer
    Cy3 labled Tau ASO-12 (murine) sodium is a Cy3 labled Tau ASO-12 (murine) sodium.
    Cy3 labled Tau ASO-12 (murine) sodium
  • HY-132582E

    Tau Protein Cancer
    Tau ASO-12 (murine) sodium scrambled negative control is the sequence scrambled negative control of Tau ASO-12 (murine) sodium.
    Tau ASO-12 (murine) sodium scrambled negative control
  • HY-158830B

    Fluorescent Dye Cancer
    FAM labled MDM4-targeting ASO sodiumis a FAM labled MDM4-targeting ASO sodium.
    FAM labled MDM4-targeting ASO sodium
  • HY-158830C

    Fluorescent Dye Cancer
    Cy3 labled MDM4-targeting ASO sodium is a Cy3 labled MDM4-targeting ASO sodium.
    Cy3 labled MDM4-targeting ASO sodium

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: