1. Signaling Pathways
  2. Neuronal Signaling
  3. Tau Protein

Tau Protein

Tau is well established as a microtubule-associated protein in neurons. They have roles primarily in maintaining the stability of microtubules in axons and are abundant in the neurons of the central nervous system (CNS). However, under pathological conditions, aberrant assembly of tau into insoluble aggregates is accompanied by synaptic dysfunction and neural cell death in a range of neurodegenerative disorders, collectively referred to as tauopathies.

Cat. No. Product Name Effect Purity Chemical Structure
  • HY-134968A
    (R)-TTBK1-IN-1
    Inhibitor 98.93%
    (R)-TTBK1-IN-1 is a potent, selective and brain-penetrant tau tubulin kinase 1 (TTBK1) inhibitor. (R)-TTBK1-IN-1 is an enantiomer of TTBK1-IN-1 (HY-134968). (R)-TTBK1-IN-1 can be used in the research of alzheimer’s disease and related tauopathies. (R)-TTBK1-IN-1 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
    (R)-TTBK1-IN-1
  • HY-P1707A
    Tau protein (592-597), human TFA
    99.20%
    Tau protein (592-597), human TFA is a peptide fragment of human Tau protein. The dysfunction of Tau protein is involved in neurodegeneration and dementia.
    Tau protein (592-597), human TFA
  • HY-P0181
    Microtubule-associated protein tau (26-44)
    Microtubule-associated protein tau (26-44) is a synthetic peptide chain with an amine group attached to glutamine and an carboxyl group attached to lysine.
    Microtubule-associated protein tau (26-44)
  • HY-105022
    Sabeluzole
    Inhibitor 99.82%
    Sabeluzole (R 58735), a benzothiazol derivative, has antiischemic, antiepileptic, and cognitive-enhancing properties. Sabeluzole protects rat hippocampal neurons against NMDA- and glutamate-induced neurotoxicity via preventing tau expression. Sabeluzole enhances memory in rats, and prevents the amnesic effect of Chlordiazepoxide. Sabeluzole can be used fro research of Alzheimer's disease.
    Sabeluzole
  • HY-P2516
    Tau Peptide (275-305) (Repeat 2 domain)
    Tau Peptide (275-305) (Repeat 2 domain) is the Alzheimer's tau fragment R2, corresponding to the second repeat unit of the microtubule-binding domain, which is believed to be pivotal to the biochemical properties of full tau protein.
    Tau Peptide (275-305) (Repeat 2 domain)
  • HY-P4924
    Tau Peptide (244-274) (Repeat 1 Domain)
    Tau Peptide (244-274) (Repeat 1 Domain) is aTau fragment.
    Tau Peptide (244-274) (Repeat 1 Domain)
  • HY-P4927
    Tau Peptide (245-274) (Repeat 1 Domain)
    Tau Peptide (245-274) (Repeat 1 Domain) is aTau fragment.
    Tau Peptide (245-274) (Repeat 1 Domain)
  • HY-P4943
    Tau Peptide (273-284)
    Tau Peptide (273-284) is aTau fragment.
    Tau Peptide (273-284)
  • HY-P4960
    Tau Peptide (294-305) (human)
    Tau Peptide (294-305) (human) is aTau fragment.
    Tau Peptide (294-305) (human)
  • HY-P4972
    Tau Peptide (45-73) (Exon 2/Insert 1 Domain)
    Tau Peptide (45-73) (Exon 2/Insert 1 Domain) is aTau fragment.
    Tau Peptide (45-73) (Exon 2/Insert 1 Domain)
  • HY-P4933
    Tau Peptide (255-314) (Repeat 2 Domain) (human)
    Tau Peptide (255-314) (Repeat 2 Domain) (human) is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development.
    Tau Peptide (255-314) (Repeat 2 Domain) (human)
  • HY-153431
    TRV-1387
    Inhibitor
    TRV-1387 is a benzofurazan that inhibits the aggregation of tau and amyloid-β.
    TRV-1387
  • HY-149237
    hAChE-IN-2
    Inhibitor
    hAChE-IN-2 is a potent hAChE inhibitor, with an IC50 of 0.71 μM. hAChE-IN-2 can also inhibits tau-oligomerization, with an EC50 of 2.21 μM. hAChE-IN-2 exhibits neuroprotective activity.
    hAChE-IN-2
  • HY-132582A
    Tau ASO-12 (murine) (sodium)
    Inhibitor
    TauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
    Tau ASO-12 (murine) (sodium)
  • HY-P4966
    Tau Peptide (306-336) (Repeat 3 Domain)
    Tau Peptide (306-336) (Repeat 3 Domain) is aTau fragment.
    Tau Peptide (306-336) (Repeat 3 Domain)
  • HY-P3307
    Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2
    Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2 is serum stable, non-toxic to neuronal cells, and selectivity inhibits the fibrilization of tau over Aβ42.
    Ac-Val-Gln-aIle-Val-aTyr-Lys-NH2
  • HY-149272
    tau/Aβ40 aggregation-IN-1
    Inhibitor
    tau/Aβ40 aggregation-IN-1 (Compound 20) is a tau and 40 aggregation inhibitor with IC50s of 1.8 μM and 1.3 μM, respectively.
    tau/Aβ40 aggregation-IN-1
  • HY-149542
    GSK-3β inhibitor 15
    Inhibitor
    GSK-3β inhibitor 15 (Compound 54) is a GSK-3β inhibitor (IC50: 3.4 nM). GSK-3β inhibitor 15 inhibits Aβ1-42-induced GSK-3β and tau protein phosphorylation. GSK-3β inhibitor 15 inhibits LPS-induced iNOS expression. GSK-3β inhibitor 15 has neuroprotective effects on Aβ1-42-induced neurotoxicity. GSK-3β inhibitor 15 can be used for research of Alzheimer’s disease (AD).
    GSK-3β inhibitor 15
  • HY-149418
    BChE/HDAC6-IN-2
    Inhibitor
    BChE/HDAC6-IN-2 (compound 29a) is a dual inhibitor of BChE and HDAC6 with IC50s of 1.8 nM and 71.0 nM, respectively. BChE/HDAC6-IN-2 has prominently neuroprotective effects and reactive oxygen species (ROS) scavenging activity. BChE/HDAC6-IN-2 is also an effective chelator of metal ion (Fe2+ and Cu2+). BChE/HDAC6-IN-2 inhibits phosphorylation of tau, and exhibits moderate immunomodulatory effect.
    BChE/HDAC6-IN-2
  • HY-101185
    T808
    Chemical
    T808 is a tau-selective Alzheimer’s PET ligand. T808 is a type of imaging agent used in positron emission tomography (PET) scans. It is a radiotracer that is used to help visualize certain areas of the body, such as the brain, in order to diagnose and monitor various medical conditions.
    T808
Cat. No. Product Name / Synonyms Application Reactivity