Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
47 Results for "
HBV+DNA
" in MedChemExpress (MCE) Product Catalog:
Products (47)
47 Results for "HBV+DNA" in MCE Product Catalog:
10
10 Publications Verification
Synonyms: RO 7020322; (S)-RO0321
RG7834 (RO 7020322) is a highly selective and orally bioavailable HBV inhibitor, potently inhibits HBV antigens (both HBsAg and HBeAg) and HBV DNA, with IC50s of 2.8, 2.6, and 3.2 nM, respectively, in dHepaRG Cells .
2
Target:
Research Areas:
Adefovir (GS-0393) is an adenosine monophosphate analog antiviral agent that after intracellular conversion to Adefovir diphosphate inhibits HBV DNA polymerase. Adefovir has an IC50 of 0.7 μM against HBV in the HepG2.2.15 cell line. Adefovir has good antiviral activity against several viruses, including HBV and herpesviruses .
2
2 Cited Publications
GLP-26 is a HBV capsid assembly modulators (CAM), inhibits HBV DNA replication in Hep AD38 system (IC50=3 nM), and reduces cccDNA by >90% at 1 μM.
GLP-26 disrupts the encapsidation of pre-genomic RNA, causes nucleocapsid disassembly and reduces cccDNA pools . GLP-26 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
2
2 Cited Publications
Cat. No.: HY-N8107
CAS No.: 34446-06-5
1
1 Cited Publications
Target:
Research Areas:
HBV-IN-4, a phthalazinone derivative, is a potent and orally active HBV DNA replication inhibitor with an IC50 of 14 nM. HBV-IN-4 induces the formation of genome-free capsids and has potent anti-HBV potencies .
Synonyms: FIAU; DRG-0098; NSC 678514
Research Areas:
Fialuridine (FIAU), a nucleoside analog, is a HSV-1 and HSV-2 inhibitor with Kis of 0.14 μM and 0.95 μM, respectively. Fialuridine shows anti-orthopoxvirus and anti-hepatitis B virus (HBV) activities. Fialuridine inhibits duck HBV DNA replication with IC50 values of 0.075 μM and 156 μM in human hepatoma cells and in chicken liver cells, respectively .
Synonyms: ISIS 505358
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Synonyms: ISIS 505358 sodium
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
Cat. No.: HY-177022
CAS No.: 2495324-66-6
ALG-001075, a capsid assembly modulator (CAM), is an orally active HBV inhibitor. ALG-001075 effectively blocks not only HBV DNA production but also extracellular HBsAg/HBeAg and intracellular HBV RNA in primary human hepatocytes. ALG-001075 shows pronounced reductions of circulating HBV DNA in the AAV-HBV mouse model. ALG-001075 can be used for the study of Chronic hepatitis B (CHB) .
Target:
Research Areas:
Antazoline hydrochloride is a histamine H1 receptor antagonist with anticholinergic and antiviral properties. Antazoline hydrochloride can prevent histamine from acting on target cells through a reversible competition effect on histamine receptor sites of these cells. Antazoline hydrochloride can exert an antiallegic effect and prevent the occurrence of physiological reactions from the effect of blocking as well as inhibiting H1 receptor. Antazoline hydrochloride can effectively reduce HBV DNA in the extracellular supernatant in a dose-dependent manner, with EC50 of 2.910 μmol/L in HepAD38 cells. Antazoline hydrochloride also has a significant inhibitory effect on HBV DNA in the extracellular supernatant of Huh7 cells (EC50 = 2.349 μmol/L). Antazoline hydrochloride has anti-arrhythmic effect in acute myocardial infarctions. Antazoline hydrochloride can be studied in research for cardiovascular diseases, and HBV .
SAG-524 is a potent oral small molecule HBV viral replication inhibitor. SAG-524 decreased HBV-DNA and HbsAg levels in supernatant of HepG2.2.15 cells, IC50 0.92 and 1.4 nM, respectively .
Cat. No.: HY-169993
CAS No.: 2495324-72-4
Synonyms: ALG-000184
Target:
Research Areas:
Pevifoscorvir sodium is an orally active inhibitor of hepatitis B virus (HBV), and it is also a prodrug of ALG-001075 (HY-177022). Pevifoscorvir sodium can inhibit the production of HBV DNA in liver cells. Pevifoscorvir sodium can be used in the research of chronic hepatitis B .
Cat. No.: HY-101954
CAS No.: 475650-36-3
Synonyms: ORI-9020; SB-9000
Inarigivir (ORI-9020) is a dinucleotide antiviral drug that can significantly reduce liver HBV DNA in transgenic mice expressing hepatitis B virus. Inarigivir (ORI-9020) act as a RIG-I agonist to activate cellular innate immune responses .
Synonyms: ORI-9020 ammonium; SB-9000 ammonium
Target:
Research Areas:
Inarigivir (ORI-9020) ammonium is a dinucleotide antiviral drug that can significantly reduce liver HBV DNA in transgenic mice expressing hepatitis B virus. Inarigivir (ORI-9020) ammonium acts as a RIG-I (Retinoic acid-inducible gene-I) agonist to activate cellular innate immune responses .
Target:
Research Areas:
Antazoline (Phenazoline) is a histamine H1 receptor antagonist with anticholinergic and antiviral properties. Antazoline can prevent histamine from acting on target cells through a reversible competition effect on histamine receptor sites of these cells. Antazoline can exert an antiallegic effect and prevent the occurrence of physiological reactions from the effect of blocking as well as inhibiting H1 receptor. Antazoline can effectively reduce HBV DNA in the extracellular supernatant in a dose-dependent manner, with EC50 of 2.910 μmol/L in HepAD38 cells. Antazoline also has a significant inhibitory effect on HBV DNA in the extracellular supernatant of Huh7 cells (EC50 = 2.349 μmol/L). Antazoline has anti-arrhythmic effect in acute myocardial infarctions. Antazoline can be studied in research for cardiovascular diseases, and HBV .
Cat. No.: HY-146394
CAS No.: 2338573-94-5
Target:
Research Areas:
HBV-IN-22 (Compound LC5f) is an inhibitor of HBV DNA replication with IC50 values of 0.71 μM and 0.84 μM against wild-type and agent resistant HBV strains, respectively .
Cat. No.: HY-P99608
CAS No.: 569658-80-6
Cat. No.: HY-19447A
CAS No.: 1039623-01-2
Synonyms: LB80380 maleate
Besifovir Dipivoxil maleate (LB80380 maleate) is an oral proagent of LB80317. Besifovir Dipivoxil maleate (LB80380 maleate) is effective in hepatitis B virus (HBV) DNA suppression for both treatment-naive and lamivudine-resistant chronic hepatitis B (CHB) patients in preliminary studies [2]
HBF-0259 is a potent and selective inhibitor of hepatitis B virus (HBV) surface antigen (HBsAg) secretion, with an EC50 of 1.5 μM in HepG2.2.15 cells. HBF-0259 has no effect on HBV DNA synthesis .
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
