2. Search Result
Search Result
Results for "

HBV+DNA

" in MedChemExpress (MCE) Product Catalog:

46

Inhibitors & Agonists

1

Inhibitory Antibodies

3

Natural
Products

1

Isotope-Labeled Compounds

1

Click Chemistry

2

Oligonucleotides

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-118122
    Fialuridine

    FIAU; DRG-0098; NSC 678514

    		 HSV HBV DNA/RNA Synthesis Orthopoxvirus Nucleoside Antimetabolite/Analog Infection
    Fialuridine (FIAU), a nucleoside analog, is a HSV-1 and HSV-2 inhibitor with Kis of 0.14 μM and 0.95 μM, respectively. Fialuridine shows anti-orthopoxvirus and anti-hepatitis B virus (HBV) activities. Fialuridine inhibits duck HBV DNA replication with IC50 values of 0.075 μM and 156 μM in human hepatoma cells and in chicken liver cells, respectively .
    Fialuridine
  • HY-117650A
    RG7834
    Maximum Cited Publications
    9 Publications Verification

    RO 7020322; (S)-RO0321

    		 HBV Infection
    RG7834 (RO 7020322) is a highly selective and orally bioavailable HBV inhibitor, potently inhibits HBV antigens (both HBsAg and HBeAg) and HBV DNA, with IC50s of 2.8, 2.6, and 3.2 nM, respectively, in dHepaRG Cells .
    RG7834
  • HY-147217
    Bepirovirsen

    ISIS 505358

    		 HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-147217A
    Bepirovirsen sodium

    ISIS 505358 sodium

    		 HBV Infection
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-N0444
    Rubiadin

    		Reactive Oxygen Species (ROS) Inflammation/Immunology
    Rubiadin is an orally active polyketide-derived compound and free radical scavenger that inhibits the activation of the NF-κB pathway. Rubiadin inhibits osteoclast formation, bone resorption, lipid peroxidation, HBV DNA replication and cancer cell proliferation; reduces pro-inflammatory cytokine levels; induces cancer cell apoptosis; and possesses antifungal, antimalarial, antibacterial and anticonvulsant activities. Rubiadin can be used in the research of osteoporosis, acute inflammation, chronic inflammation, carbon tetrachloride-induced liver injury, Alzheimer's disease, breast cancer, iron overload disorders, hepatitis B virus infection, colon cancer, liver cancer, T-lymphocytic leukemia, cervical cancer, diabetic nephropathy, epileptic seizures, fungal infections, malaria and bacterial infections .
    Rubiadin
  • HY-177022
    ALG-001075

    		HBV Infection
    ALG-001075, a capsid assembly modulator (CAM), is an orally active HBV inhibitor. ALG-001075 effectively blocks not only HBV DNA production but also extracellular HBsAg/HBeAg and intracellular HBV RNA in primary human hepatocytes. ALG-001075 shows pronounced reductions of circulating HBV DNA in the AAV-HBV mouse model. ALG-001075 can be used for the study of Chronic hepatitis B (CHB) .
    ALG-001075
  • HY-B1067
    Antazoline hydrochloride

    Phenazoline hydrochloride

    		 Histamine Receptor HBV Neurological Disease Endocrinology
    Antazoline hydrochloride is a histamine H1 receptor antagonist with anticholinergic and antiviral properties. Antazoline hydrochloride can prevent histamine from acting on target cells through a reversible competition effect on histamine receptor sites of these cells. Antazoline hydrochloride can exert an antiallegic effect and prevent the occurrence of physiological reactions from the effect of blocking as well as inhibiting H1 receptor. Antazoline hydrochloride can effectively reduce HBV DNA in the extracellular supernatant in a dose-dependent manner, with EC50 of 2.910 μmol/L in HepAD38 cells. Antazoline hydrochloride also has a significant inhibitory effect on HBV DNA in the extracellular supernatant of Huh7 cells (EC50 = 2.349 μmol/L). Antazoline hydrochloride has anti-arrhythmic effect in acute myocardial infarctions. Antazoline hydrochloride can be studied in research for cardiovascular diseases, and HBV .
    Antazoline hydrochloride
  • HY-B1826
    Adefovir
    2 Publications Verification

    GS-0393; PMEA

    		 HBV Reverse Transcriptase Infection
    Adefovir (GS-0393) is an adenosine monophosphate analog antiviral agent that after intracellular conversion to Adefovir diphosphate inhibits HBV DNA polymerase. Adefovir has an IC50 of 0.7 μM against HBV in the HepG2.2.15 cell line. Adefovir has good antiviral activity against several viruses, including HBV and herpesviruses .
    Adefovir
  • HY-157993
    SAG-524

    		HBV Infection
    SAG-524 is a potent oral small molecule HBV viral replication inhibitor. SAG-524 decreased HBV-DNA and HbsAg levels in supernatant of HepG2.2.15 cells, IC50 0.92 and 1.4 nM, respectively .
    SAG-524
  • HY-169993
    ALG-000184

    		HBV DNA/RNA Synthesis Drug Intermediate Infection
    ALG-000184 is an orally effective inhibitor of hepatitis B virus (HBV), and it is also a prodrug of ALG-001075 (HY-177022). ALG-000184 can inhibit the production of HBV DNA in liver cells. ALG-000184 can be used in the research of chronic hepatitis B .
    ALG-000184
  • HY-124614
    GLP-26
    2 Publications Verification

    		 HBV Infection
    GLP-26 is a HBV capsid assembly modulators (CAM), inhibits HBV DNA replication in Hep AD38 system (IC50=3 nM), and reduces cccDNA by >90% at 1 μM. GLP-26 disrupts the encapsidation of pre-genomic RNA, causes nucleocapsid disassembly and reduces cccDNA pools . GLP-26 is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.
    GLP-26
  • HY-101954
    Inarigivir

    ORI-9020; SB-9000

    		 HBV Infection
    Inarigivir (ORI-9020) is a dinucleotide antiviral drug that can significantly reduce liver HBV DNA in transgenic mice expressing hepatitis B virus. Inarigivir (ORI-9020) act as a RIG-I agonist to activate cellular innate immune responses .
    Inarigivir
  • HY-101954A
    Inarigivir ammonium

    ORI-9020 ammonium; SB-9000 ammonium

    		 HBV Infection Inflammation/Immunology
    Inarigivir (ORI-9020) ammonium is a dinucleotide antiviral drug that can significantly reduce liver HBV DNA in transgenic mice expressing hepatitis B virus. Inarigivir (ORI-9020) ammonium acts as a RIG-I (Retinoic acid-inducible gene-I) agonist to activate cellular innate immune responses .
    Inarigivir ammonium
  • HY-B1067A
    Antazoline

    Phenazoline

    		 Histamine Receptor Neurological Disease Endocrinology
    Antazoline (Phenazoline) is a histamine H1 receptor antagonist with anticholinergic and antiviral properties. Antazoline can prevent histamine from acting on target cells through a reversible competition effect on histamine receptor sites of these cells. Antazoline can exert an antiallegic effect and prevent the occurrence of physiological reactions from the effect of blocking as well as inhibiting H1 receptor. Antazoline can effectively reduce HBV DNA in the extracellular supernatant in a dose-dependent manner, with EC50 of 2.910 μmol/L in HepAD38 cells. Antazoline also has a significant inhibitory effect on HBV DNA in the extracellular supernatant of Huh7 cells (EC50 = 2.349 μmol/L). Antazoline has anti-arrhythmic effect in acute myocardial infarctions. Antazoline can be studied in research for cardiovascular diseases, and HBV .
    Antazoline
  • HY-146394
    HBV-IN-22

    		HBV DNA/RNA Synthesis Infection
    HBV-IN-22 (Compound LC5f) is an inhibitor of HBV DNA replication with IC50 values of 0.71 μM and 0.84 μM against wild-type and agent resistant HBV strains, respectively .
    HBV-IN-22
  • HY-P99608
    Exbivirumab

    		HBV Infection
    Exbivirumab is a monoclonal antibody directed against highly conserved HBsAg epitopes. Exbivirumab enhances the antiviral activity of hepatitis B immunoglobulin (HBIG). Exbivirumab combined with Libivirumab (HY-P99703) decreases circulating HBsAg and hepatitis B virus (HBV) DNA levels in a chronically infected chimpanzee. Exbivirumab can be used for HBV re-infection in liver transplant .
    Exbivirumab
  • HY-N8107
    Matairesinol monoglucoside
    2 Publications Verification

    		 STING IFNAR HBV Infection
    Matairesinol monoglucoside is a STING activator. Matairesinol monoglucoside modulates the STING-TBK1-IRF3 signaling axis, promotes STING transcriptional expression, increases TBK1 and IRF3 phosphorylation. Matairesinol monoglucoside induces IFN-α and IFN-β production, reduces HBV DNA, HBsAg, and HBeAg expression. Matairesinol monoglucoside can be used for the research of hepatitis b virus (hbv) infection .
    Matairesinol monoglucoside
  • HY-19447A
    Besifovir Dipivoxil maleate

    LB80380 maleate

    		 HBV Infection
    Besifovir Dipivoxil maleate (LB80380 maleate) is an oral proagent of LB80317. Besifovir Dipivoxil maleate (LB80380 maleate) is effective in hepatitis B virus (HBV) DNA suppression for both treatment-naive and lamivudine-resistant chronic hepatitis B (CHB) patients in preliminary studies [2]
    Besifovir Dipivoxil maleate
  • HY-126970
    HBF-0259

    		HBV Infection
    HBF-0259 is a potent and selective inhibitor of hepatitis B virus (HBV) surface antigen (HBsAg) secretion, with an EC50 of 1.5 μM in HepG2.2.15 cells. HBF-0259 has no effect on HBV DNA synthesis .
    HBF-0259
  • HY-148201
    Oleana-2,12-dien-28-oic acid

    		HBV Infection
    Oleana-2,12-dien-28-oic acid is an HBV-DNA inhibitor, HBsAg and HBeAg inhibitor. Oleana-2,12-dien-28-oic acid can be used in hepatitis B virus infection disease research .
    Oleana-2,12-dien-28-oic acid
  • HY-149357
    Yhhu6669

    		HBV Infection
    Yhhu6669 is an anti-HBV agent. Yhhu6669 inhibits HBV DNA. Yhhu6669 inhibits HBV replication by inducing the formation of DNA-free capsids. Yhhu6669 decreases HBV DNA and HBcAg in AAV/HBV-infected mice. Yhhu6669 has favorable PK properties .
    Yhhu6669
  • HY-146395
    HBV-IN-23

    		HBV DNA/RNA Synthesis Apoptosis Infection Cancer
    HBV-IN-23 (Compound 5k) is an inhibitor of HBV DNA replication with an IC50 of 0.58 μM. HBV-IN-23 inhibits HBV DNA replication in both agent sensitive and resistant HBV strains. HBV-IN-23 shows anti-hepatocellular carcinoma cell (HCC) activities. HBV-IN-23 induces HepG2 cells apoptosis .
    HBV-IN-23
  • HY-109969
    Z060228

    		HBV Infection
    Z060228 is a capsid-targeting anti-HBV agent that inhibits HBV DNA replication in the supernatant of the HepG2.2.15 cell .
    Z060228
  • HY-156702
    HBV-IN-38

    		HBV Infection
    HBV-IN-38 (Example 193) is an HBV DNA inhibitor (EC50≤100nM). HBV-IN-38 can be used to study viral infections .
    HBV-IN-38
  • HY-144319
    SHR5133

    		HBV Infection
    SHR5133 is a highly potent, orally active HBV capsid assembly modulator. SHR5133 displays HBV DNA reduction (EC50=26.6 nM) .
    SHR5133
  • HY-123767
    HEC72702

    		HBV Infection
    HEC72702 is a potent and orally active hepatitis B virus capsid inhibitor with an EC50 values of 0.039 µM. HEC72702 dose-dependently reduced HBV DNA in both the plasma and livers .
    HEC72702
  • HY-131343
    HBV-IN-4
    1 Publications Verification

    		 HBV DNA/RNA Synthesis Infection
    HBV-IN-4, a phthalazinone derivative, is a potent and orally active HBV DNA replication inhibitor with an IC50 of 14 nM. HBV-IN-4 induces the formation of genome-free capsids and has potent anti-HBV potencies .
    HBV-IN-4
  • HY-155547
    HBV-IN-34

    		HBV Infection
    HBV-IN-34 (compound 17i) is a potent HBsAg production inhibitor. HBV-IN-34 exhibits excellent in vitro anti-HBV potency, with an EC50 of 0.018 μM and 0.044 μM for HBV DNA and HBsAg, respectively .
    HBV-IN-34
  • HY-177378
    HBV-IN-53

    		HBV DNA/RNA Synthesis Infection
    HBV-IN-53 (Compound 1) is an HBV inhibitor. HBV-IN-53 reduces the level of HBV DNA in serum. The inhibitory activity of HBV-IN-53 in combination with Tenofovir disoproxil fumarate (HY-13782) exhibits an additive effect on HBV inhibition .
    HBV-IN-53
  • HY-146011
    HBV-IN-21

    		HBV DNA/RNA Synthesis Infection
    HBV-IN-21 (Compound II-8b) is an HBV DNA replication inhibitor with an IC50 of 2.2 µM. HBV-IN-21 can interact HBV 4 capsid protein with good affinity (KD = 60.0 μM) .
    HBV-IN-21
  • HY-168045
    HBV-IN-48

    		HBV DNA/RNA Synthesis Infection
    HBV-IN-48 is an HBV inhibitor. HBV-IN-48 has antiviral activity against HBV in HepDE19 cells, with an EC50 value of 0.005 μM. HBV-IN-48 can reduce serum HBV DNA levels in mouse models of HBV infection .
    HBV-IN-48
  • HY-145052
    HBV-IN-9

    		HBV Infection
    HBV-IN-9 is a potent HBsAg (HBV Surface antigen) inhibitor (IC50=10 nM) and HBV DNA production inhibitor (IC50=0.15 nM in HepG2.2.15 cells) . From patent WO2018001952A1, example 20.
    HBV-IN-9
  • HY-N10404
    Junceellolide C

    		HBV Inflammation/Immunology
    Junceellolide C is a transcription inhibitor of cccDNA. Junceellolide C inhibits HBV DNA replication and significantly decreases the level of supernatant HBV RNA with EC50 values of 5.19, 3.52 μM respectively in HepAD38 cells. Junceellolide C is a potent anti-HBV agent .
    Junceellolide C
  • HY-170605
    BA-AZT1

    		HBV Infection
    BA-AZT1 is the inhibitor for HBV polymerase and sodium taurocholate cotransporting polypeptide (NTCP). BA-AZT1 inhibits the secretion of viral capsid protein HBsAg and HBeAg with IC50 of 0.65 µM and 13.42 µM, inhibits the HBV DNA replication with an IC50 of 0.70 µM .
    BA-AZT1
  • HY-145059
    HBV-IN-12

    		HBV Infection
    HBV-IN-12 is a potent hepatitis B surface antigen (HBsAg) inhibitor (0.001 μM< EC50 ≤0.05 μM). HBV-IN-12 shows anti-HBV DNA activity (0.001 μM＜EC50 ≤0.02 μM). From patent WO2021204252A1, compound 15 .
    HBV-IN-12
  • HY-B1067AR
    Antazoline (Standard)

    Phenazoline (Standard)

    		 Reference Standards Histamine Receptor Neurological Disease Endocrinology
    Antazoline (Phenazoline) (Standard) is the analytical standard of Antazoline. This product is intended for research and analytical applications. Antazoline is a histamine H1 receptor antagonist with anticholinergic and antiviral properties. Antazoline can prevent histamine from acting on target cells through a reversible competition effect on histamine receptor sites of these cells. Antazoline can exert an antiallegic effect and prevent the occurrence of physiological reactions from the effect of blocking as well as inhibiting H1 receptor. Antazoline can effectively reduce HBV DNA in the extracellular supernatant in a dose-dependent manner, with EC50 of 2.910 μmol/L in HepAD38 cells. Antazoline also has a significant inhibitory effect on HBV DNA in the extracellular supernatant of Huh7 cells (EC50 = 2.349 μmol/L). Antazoline has anti-arrhythmic effect in acute myocardial infarctions. Antazoline can be studied in research for cardiovascular diseases, and HBV .
    Antazoline (Standard)
  • HY-B1067R
    Antazoline hydrochloride (Standard)

    Phenazoline hydrochloride (Standard)

    		 Reference Standards Histamine Receptor HBV Neurological Disease Endocrinology
    Antazoline (hydrochloride) (Standard) is the analytical standard of Antazoline (hydrochloride). This product is intended for research and analytical applications. Antazoline hydrochloride is a histamine H1 receptor antagonist with anticholinergic and antiviral properties. Antazoline hydrochloride can prevent histamine from acting on target cells through a reversible competition effect on histamine receptor sites of these cells. Antazoline hydrochloride can exert an antiallegic effect and prevent the occurrence of physiological reactions from the effect of blocking as well as inhibiting H1 receptor. Antazoline hydrochloride can effectively reduce HBV DNA in the extracellular supernatant in a dose-dependent manner, with EC50 of 2.910 μmol/L in HepAD38 cells. Antazoline hydrochloride also has a significant inhibitory effect on HBV DNA in the extracellular supernatant of Huh7 cells (EC50 = 2.349 μmol/L). Antazoline hydrochloride has anti-arrhythmic effect in acute myocardial infarctions. Antazoline hydrochloride can be studied in research for cardiovascular diseases, and HBV .
    Antazoline hydrochloride (Standard)
  • HY-B1067BR
    Antazoline phosphate (Standard)

    Phenazoline phosphate (Standard)

    		 Reference Standards Histamine Receptor Neurological Disease Endocrinology
    Antazoline (phosphate) (Standard) is the analytical standard of Antazoline (phosphate). This product is intended for research and analytical applications. Antazoline phosphate is a histamine H1 receptor antagonist with anticholinergic and antiviral properties. Antazoline phosphate can prevent histamine from acting on target cells through a reversible competition effect on histamine receptor sites of these cells. Antazoline phosphate can exert an antiallegic effect and prevent the occurrence of physiological reactions from the effect of blocking as well as inhibiting H1 receptor. Antazoline phosphate can effectively reduce HBV DNA in the extracellular supernatant in a dose-dependent manner, with EC50 of 2.910 μmol/L in HepAD38 cells. Antazoline phosphate also has a significant inhibitory effect on HBV DNA in the extracellular supernatant of Huh7 cells (EC50 = 2.349 μmol/L). Antazoline phosphate has anti-arrhythmic effect in acute myocardial infarctions. Antazoline phosphate can be studied in research for cardiovascular diseases, and HBV .
    Antazoline phosphate (Standard)
  • HY-147863
    HBV-IN-24

    		HBV Infection Neurological Disease
    HBV-IN-24 (compound (2ʹS, 6S)-1a) is a potent HBV inhibitor. HBV-IN-24 exhibits potent inhibition activity against HBV DNA, HBsAg, and HBeAg, with EC50 values of 0.6, 0.6, and 4.6 nM, respectively. HBV-IN-24 shows excellent antiviral activity, could have improved neurotoxicity .
    HBV-IN-24
  • HY-B1067B
    Antazoline phosphate

    Phenazoline phosphate

    		 Histamine Receptor Neurological Disease Endocrinology
    Antazoline phosphate is an H1 receptor antagonist that affects the activity of the central nervous system, has a potent antiarrhythmic effect . Antazoline phosphate is a histamine H1 receptor antagonist with anticholinergic and antiviral properties. Antazoline phosphate can prevent histamine from acting on target cells through a reversible competition effect on histamine receptor sites of these cells. Antazoline phosphate can exert an antiallegic effect and prevent the occurrence of physiological reactions from the effect of blocking as well as inhibiting H1 receptor. Antazoline phosphate can effectively reduce HBV DNA in the extracellular supernatant in a dose-dependent manner, with EC50 of 2.910 μmol/L in HepAD38 cells. Antazoline phosphate also has a significant inhibitory effect on HBV DNA in the extracellular supernatant of Huh7 cells (EC50 = 2.349 μmol/L). Antazoline phosphate has anti-arrhythmic effect in acute myocardial infarctions. Antazoline phosphate can be studied in research for cardiovascular diseases, and HBV .
    Antazoline phosphate
  • HY-B1826S2
    Adefovir-d4

    GS-0393-d4; PMEA-d4

    		 Isotope-Labeled Compounds HBV Reverse Transcriptase Infection
    Adefovir-d4 is the deuterium labeled Adefovir. Adefovir (GS-0393) is an adenosine monophosphate analog antiviral agent that after intracellular conversion to Adefovir diphosphate inhibits HBV DNA polymerase. Adefovir has an IC50 of 0.7 μM against HBV in the HepG2.2.15 cell line. Adefovir has good antiviral activity against several viruses, including HBV and herpesviruses .
    Adefovir-d4
  • HY-183260
    HBV-IN-57

    		HBV Cytochrome P450 Infection
    HBV-IN-57 is an orally active HBV inhibitor with pan-genotypic efficacy against HBV genotypes B/C. HBV-IN-57 inhibits HBV DNA replication and HBV capsid assembly. HBV-IN-57 can be used for the research of chronic hepatitis B .
    HBV-IN-57
  • HY-126970R
    HBF-0259 (Standard)

    		HBV Infection
    HBF-0259 (Standard) is the analytical standard of HBF-0259. This product is intended for research and analytical applications. HBF-0259 is a potent and selective inhibitor of hepatitis B virus (HBV) surface antigen (HBsAg) secretion, with an EC50 of 1.5 μM in HepG2.2.15 cells. HBF-0259 has no effect on HBV DNA synthesis .
    HBF-0259 (Standard)
  • HY-101954AR
    Inarigivir ammonium (Standard)

    ORI-9020 ammonium (Standard); SB-9000 ammonium (Standard)

    		 Reference Standards HBV Infection Inflammation/Immunology
    Inarigivir ammonium (Standard) is the analytical standard of Inarigivir ammonium (HY-101954A). This product is intended for research and analytical applications. Inarigivir (ORI-9020) ammonium is a dinucleotide antiviral drug that can significantly reduce liver HBV DNA in transgenic mice expressing hepatitis B virus. Inarigivir (ORI-9020) ammonium acts as a RIG-I (Retinoic acid-inducible gene-I) agonist to activate cellular innate immune responses .
    Inarigivir ammonium (Standard)
  • HY-19009B
    Propagermanium

    		CCR Metabolic Disease Inflammation/Immunology Cancer
    Propagermanium is an orally active and selective CCR2 inhibitor. Propagermanium enhances IFN-γ, IL-2, 2',5'-oligoadenylate synthetase, and unspecified cytokine production, and induces mature cytolytic NK cell subsets. Propagermanium reduces HBe antigen and HBV DNA polymerase levels, promotes HBV clearance and lowers serum ALT. Propagermanium downregulates STAT1, inhibits pro-inflammatory microglia polarization, pro-inflammatory cytokine release, and monocyte/macrophage infiltration. Propagermanium can be used for the research of chronic hepatitis B, atherosclerosis, breast cancer, non-alcoholic steatohepatitis, insulin resistance, refractory gastric cancer, multiple myeloma, type 2 diabetes .
    Propagermanium
  • HY-180524
    CAB7-3

    		HBV Infection
    CAB7-3 is an orally active HBV capsid assembly modulator (CAM). CAB7-3 exhibits an exceptional antiviral efficacy reducing HBV DNA with an EC50 = 70 nM, CC50 = 32.3 μM in HepDES19 cells. CAB7-3 exhibits significant anti-HBV activity in HBV-integrated HepDES19 (EC50 = 70 nM), HepAD38 (EC50 = 1 nM) and HBV-infected HLCZ01 cells (EC50 = 2 nM), respectively. CAB7-3 effectively reduces Hepatic HBV core protein levels and suppresses viral replication in vivo. CAB7-3 demonstrates a favorable drug-like and safety profile. CAB7-3 can be used for Hepatitis B Virus (HBV) research .
    CAB7-3

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

  

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

  

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: