Search Result

Results for "

Methoxyethyl

" in MedChemExpress (MCE) Product Catalog:

By Targets:	Amino Acid Derivatives (1) Angiotensin Receptor (2) Apolipoprotein (3) Apoptosis (1) Biochemical Assay Reagents (2) DNA/RNA Synthesis (7) Drug Derivative (1) Drug Intermediate (1) Drug Metabolite (1) Endogenous Metabolite (1) GCGR (2) Glucocorticoid Receptor (2) HBV (1) HCV (2) HSP (2) Huntingtin (3) Isotope-Labeled Compounds (7) MicroRNA (1) Nucleoside Antimetabolite/Analog (57) Orthopoxvirus (1) Phosphoramidites (8) Ras (1) Reactive Oxygen Species (ROS) (1) Reference Standards (6) Ser/Thr Kinase (1) SOD (1) TNF Receptor (1) Transthyretin (TTR) (3) Vasopressin Receptor (1) Virus Protease (1)
By Research Areas:	Cancer (47) Cardiovascular Disease (4) Endocrinology (2) Infection (4) Inflammation/Immunology (3) Metabolic Disease (8) Neurological Disease (12)
Click Chemistry:	Azide (3)
Oligonucleotides:	Adenosine (14) Guanosine (6) Thymine (1) Nucleoside Analogs (49) Adenine (1) Uridine (19) Inosine (5) Cytosine (4) Phosphoramidites (8) Antisense Oligonucleotides (28) Guanine (2) Cytidine (5)

105

Inhibitors & Agonists

Fluorescent Dyes

Biochemical Assay Reagents

Peptides

Natural
Products

Isotope-Labeled Compounds

Click Chemistry

Oligonucleotides

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-108764

Mipomersen sodium 2 Publications Verification ISIS 301012	Apolipoprotein HCV	Metabolic Disease
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .

HY-134124

*Glutathione ethyl* ester**	Reactive Oxygen Species (ROS)	Metabolic Disease
Glutathione ethyl ester is a cell-permeable GSH donor and provides an efficient supply of GSH to the oocyte. Glutathione ethyl ester shows positive effect on the in vitro production of embryos by enhancement of the antioxidative defense .

HY-112980

Nusinersen 4 Publications Verification	DNA/RNA Synthesis	Neurological Disease
Nusinersen is an antisense oligonucleotide active molecule. Nusinersen modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen improves spinal muscular atrophy .

HY-132580

Tofersen 2 Publications Verification BIIB067; ISIS-SOD1Rx; ISIS 333611	SOD	Neurological Disease
Tofersen (BIIB067) is an antisense oligonucleotide and SOD1 mRNA inhibitor with an IC₅₀ of 320 pM. Tofersen mediates RNase H-dependent degradation of SOD1 mRNA to reduce SOD1 protein levels in cerebrospinal fluid and serum. Tofersen downregulates cerebrospinal fluid neurofilament light chain, neurofilament heavy chain, amyloid-beta 1-40, amyloid-beta 1-42, neuropeptide Y, ubiquitin C-terminal hydrolase L1, neuropentraxins 1, 2, R, corticotropin-releasing hormone, IL-15, and serum neurofilament light chain, neurofilament heavy chain. Tofersen can be used for the research of superoxide dismutase 1-associated amyotrophic lateral sclerosis .

HY-132608

Inotersen sodium ISIS-420915 sodium	Transthyretin (TTR)	Neurological Disease
Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-148089

Eplontersen 1 Publications Verification	Transthyretin (TTR)	Neurological Disease
Eplontersen is a triantennary N-acetyl galactosamine (GalNAc₃-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases .

HY-145722

Apatorsen sodium 1 Publications Verification OGX-427 sodium	HSP	Cancer
Apatorsen (OGX-427) sodium is a 2'-methoxyethyl-modified antisense oligonucleotide and also a Hsp27 inhibitor. Apatorsen sodium reduces Hsp27 mRNA and protein levels, impairs stress-induced cytoprotective functions, induces cell apoptosis, inhibits tumor growth and prevents metastasis. Apatorsen sodium is applicable to research related to non-small cell lung cancer, castration-resistant prostate cancer, breast cancer, ovarian cancer and bladder cancer .

HY-147410

Ulefnersen 1 Publications Verification ION-363	DNA/RNA Synthesis	Neurological Disease
Ulefnersen (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .

HY-145727

Volanesorsen ISIS 304801	Apolipoprotein	Endocrinology
Volanesorsen (ISIS 304801) is an antisense oligonucleotide inhibitor of apolipoprotein CIII (apo-CIII) mRNA that reduces triglyceride levels and improves insulin resistance. Volanesorsen is being studied in the treatment of hypertriglyceridemia, familial chylosiderosis syndrome, and type 2 diabetes .

HY-132581

Tadnersen 1 Publications Verification BIIB078; IONIS-C9Rx	Ras Others	Neurological Disease
Tadnersen (BIIB078), an antisense oligonucleotide (ASO), selectively targets *C9ORF72* transcript variants 1 and 3 that carry the expansion .

HY-145725A

Baliforsen ISIS 598769; IONIS 598769; BIIB 065; ISIS-DMPK-2.5Rx	Ser/Thr Kinase	Neurological Disease
Baliforsen (ISIS 5987690) is an antisense oligonucleotide (ASO) that inhibits DMPK mRNA. Baliforsen binds within exon 9 of the human DMPK transcript to promote RNase H1-mediated degradation Baliforsen can be used for the research of myotonic dystrophy type 1 .

HY-132579

Tominersen RG6042; IONIS-HTTRx	Huntingtin	Neurological Disease
Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD) .

HY-W048491

*2′-O-(2-Methoxyethyl)adenosine*	DNA/RNA Synthesis Drug Derivative	Others
2′-O-(2-Methoxyethyl)adenosine is an ATP (HY-B2176) derivative. 2′-O-(2-Methoxyethyl)adenosine can be used for oligonucleotide synthesis .

HY-W048495

*2'-O-(2-Methoxyethyl)-uridine*	Nucleoside Antimetabolite/Analog	Cancer
2'-O-(2-Methoxyethyl)-uridine is a synthetic oligonucleotide conversed from uridine. 2'-O-(2-Methoxyethyl)-uridine has the potential for chemotherapeutic agents development .

HY-23789

*2′-O-(2-Methoxyethyl)guanosine* 2'-O-MOE-rG	Nucleoside Antimetabolite/Analog DNA/RNA Synthesis	Others
2′-O-(2-Methoxyethyl)guanosine (2'-O-MOE-rG) is a 2'-O-methoxyethyl-modified nucleoside analogue and an important intermediate in the synthesis of nucleic acid drugs. 2′-O-(2-Methoxyethyl)guanosine neither effectively phosphorylated by cytosolic nucleoside kinases, nor are they incorporated into cellular DNA or RNA .

HY-145722A

Apatorsen 1 Publications Verification OGX-427	HSP	Cancer
Apatorsen is a 2'-methoxyethyl-modified antisense oligonucleotide and also a Hsp27 inhibitor. Apatorsen reduces Hsp27 mRNA and protein levels, impairs stress-induced cytoprotective functions, induces cell apoptosis, inhibits tumor growth and prevents metastasis. Apatorsen is applicable to research related to non-small cell lung cancer, castration-resistant prostate cancer, breast cancer, ovarian cancer and bladder cancer .

HY-145726

ISIS 104838	TNF Receptor	Cardiovascular Disease Inflammation/Immunology
ISIS 104838 is an antisense oligonucleotide targeting TNF-α. ISIS 104838 specifically binds to human TNF-α mRNA via Watson-Crick base pairing to form a DNA:RNA hybrid duplex, thereby recruiting the ubiquitously expressed intracellular enzyme RNase H to degrade the target mRNA and inhibit TNF-α protein synthesis at the transcriptional level. ISIS 104838 induces moderate, self-limiting thrombocytopenia in cynomolgus monkeys. ISIS 104838 can be used for the study of inflammatory diseases .

HY-W570885

2'-O-MOE-rC	Phosphoramidites DNA/RNA Synthesis	Others
2'-O-MOE-rC is a 2'-O-MOE modified nucleoside. 2'-O-MOE-rC can be used for synthesis of DNA .

HY-132579A

Tominersen sodium RG6042 sodium; IONIS-HTTRx sodium	Huntingtin	Neurological Disease
Tominersen sodium is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen sodium can be used for the research of Huntington’s disease (HD) .

HY-147412

Ultevursen QR-421a	Nucleoside Antimetabolite/Analog DNA/RNA Synthesis	Neurological Disease
Ultevursen (QR-421a) is a splice-modulating antisense oligonucleotide targeting exon 13 of the USH2A gene, which restores the functional expression of Usherin protein by inducing exon skipping. Ultevursen binds to USH2A pre-mRNA and modulates the splicing process to specifically skip exon 13 carrying the pathogenic mutation c.2299delG, generating an in-frame transcript and a truncated yet functionally normal protein. Ultevursen exhibits concentration-dependent exon skipping activity in human cells and retinal organoid models, and restores Usherin expression and retinal function in zebrafish and gene-edited mouse models. Ultevursen can be used for related research on type 2 Usher syndrome and non-syndromic retinitis pigmentosa .

HY-13040

*N-Benzoyl-5'-O-dmtr-2'-O-(2-methoxyethyl)-adenosine*	Nucleoside Antimetabolite/Analog	Cancer
N-Benzoyl-5'-O-dmtr-2'-O-(2-methoxyethyl)-adenosine is an adenosine analog. Adenosine analogs mostly act as smooth muscle vasodilators and have also been shown to inhibit cancer progression. Its popular products are adenosine phosphate, Acadesine (HY-13417), Clofarabine (HY-A0005), Fludarabine phosphate (HY-B0028) and Vidarabine (HY-B0277) .

HY-151123

Pelacarsen AKCEA-APO(a)-LRx; ISIS 681257; TQJ230	Apolipoprotein DNA/RNA Synthesis	Metabolic Disease
Pelacarsen (ISIS 681257) is a GalNAc3-conjugated 2′-MOE-modified antisense oligonucleotide. Pelacarsen reduces apo (a) .

HY-W048496

*2'-O-(2-Methoxyethyl)-cytidine*	Nucleoside Antimetabolite/Analog	Cancer
2'-O-(2-Methoxyethyl)-cytidine is a synthetic oligonucleotide derived from uridine. 2'-O-(2-Methoxyethyl)-cytidine has good hybridization properties and high stability, and can be used in the research of oligonucleotide chemotherapeutic agents .

HY-152493

*3’-O-(2-Methoxyethyl)guanosine*	Nucleoside Antimetabolite/Analog	Others
3’-O-(2-Methoxyethyl)guanosine is a guanosine analogue. Some guanosine analogs have immunostimulatory activity. In some animal models, they also induce type I interferons, producing antiviral effects. Studies have shown that the functional activity of guanosine analogs is dependent on the activation of Toll-like receptor 7 (TLR7) .

HY-143230

Custirsen OGX-011	Apoptosis	Cancer
Custirsen (OGX-011) is an antisense oligonucleotide that targets clusterin mRNA. Custirsen induces apoptosis by activating Bax, triggering mitochondrial translocation and cytochrome c release. Custirsen acts as a chemosensitizer, radiosensitizer and hormone sensitizer. Custirsen can be used in research related to prostate cancer, non-small cell lung cancer and metastatic breast cancer .

HY-147406

Tonlamarsen ION-904	Angiotensin Receptor	Cardiovascular Disease
Tonlamarsen (ION-904) is a GalNAc-conjugated antisense oligonucleotide and Angiotensinogen synthesis inhibitor. Tonlamarsen specifically reduces the production of Angiotensinogen in the liver and plasma, and exhibits extremely low activity in the kidneys. Tonlamarsen can be used in research related to hypertension and heart failure .

HY-159695A

IONIS-GCCRRx sodium ISIS 426115 sodium	Glucocorticoid Receptor	Metabolic Disease
IONIS-GCCRRx (ISIS 426115) sodium, a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .

HY-W073825

*N2-iso-Butyryl-2'-O-(2-methoxyethyl)guanosine*	Nucleoside Antimetabolite/Analog	Cancer
N2-iso-Butyryl-2'-O-(2-methoxyethyl)guanosine is a 2’-0-(2-methoxyethyl) guanosine derivative. 2’-0-methoxyethyl nucleoside derivatives can enhance the affinity with RNA and increase the resistance of oligonucleotides to nucleases.

HY-154285

*3’-O-(2-Methoxyethyl) uridine*	Nucleoside Antimetabolite/Analog	Cancer
3’-O-(2-Methoxyethyl) uridine is a uridine analog. Uridine has potential antiepileptic effects, and its analogs can be used to study anticonvulsant and anxiolytic activities, as well as to develop new antihypertensive agents .

HY-152516

*2’-O-(2-Methoxyethyl) inosine*	Nucleoside Antimetabolite/Analog	Cancer
2’-O-(2-Methoxyethyl) inosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-154434

*3’-O-(2-Methoxyethyl)-5-methyluridine*	Nucleoside Antimetabolite/Analog	Cancer
3’-O-(2-Methoxyethyl)-5-methyluridine is a thymidine analog. Analogs of this series have insertional activity towards replicated DNA. They can be used to label cells and track DNA synthesis .

HY-152549

*2’-O-(2-Methoxyethyl)-2-aminoadenosine*	Nucleoside Antimetabolite/Analog	Others
2’-O-(2-Methoxyethyl)-2-aminoadenosine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-152646

*3’-O-(2-Methoxyethyl)-2-aminoadenosine*	Nucleoside Antimetabolite/Analog	Cancer
3’-O-(2-Methoxyethyl)-2-aminoadenosine is an adenosine analog. Adenosine analogs mostly act as smooth muscle vasodilators and have also been shown to inhibit cancer progression. Its popular products are adenosine phosphate, Acadesine (HY-13417), Clofarabine (HY-A0005), Fludarabine phosphate (HY-B0028) and Vidarabine (HY-B0277) .

HY-42084

*4-(2-Methoxyethyl)phenol* p-Hydroxyphenethyl methyl ether	Biochemical Assay Reagents	Others
4-(2-Methoxyethyl)phenol is a biochemical reagent that can be used as a biological material or organic compound for life science related research.

HY-WAA0006

*5-(2-Methoxyethyl)-7-methyl-2,5,7-triazaspiro[3.4]octan-6-one hydrochloride*	Drug Intermediate	Others
5-(2-Methoxyethyl)-7-methyl-2,5,7-triazaspiro[3.4]octan-6-one hydrochloride is a drug intermediate for synthesis of various active compounds.

HY-152498

*3’-O-(2-Methoxyethyl)adenosine*	Nucleoside Antimetabolite/Analog	Others
3’-O-(2-Methoxyethyl)adenosine is an adenosine analogue. Adenosine analogs mostly act as smooth muscle vasodilators and have also been shown to inhibit cancer progression. The popular products in this series are adenosine phosphate, Acadesine (HY-13417), Clofarabine (HY-A0005), Fludarabine phosphate (HY-B0028) and Vidarabine (HY-B0277) .

HY-152444

*5-Hydroxymethyl-2’-O-(2-methoxyethyl)uridine*	Nucleoside Antimetabolite/Analog	Others
5-Hydroxymethyl-2’-O-(2-methoxyethyl)uridine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-152503

*N6-Benzoyl-3’-O-(2-methoxyethyl)adenosine*	Nucleoside Antimetabolite/Analog	Others
N6-Benzoyl-3’-O-(2-methoxyethyl)adenosine is a purine nucleoside analogue. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-132600

RG-101 Temavirsen	MicroRNA HCV	Infection
RG-101 is a hepatocyte targeted N-acetylgalactosamine conjugated oligonucleotide that antagonises miR-122. miR-122 is an important host factor for hepatitis C virus (HCV) replication .

HY-154353

*5’-O-(4,4’-Dimethoxytrityl)-2’-O-(2-methoxyethyl) adenosine*	Nucleoside Antimetabolite/Analog	Cancer
5’-O-(4,4’-Dimethoxytrityl)-2’-O-(2-methoxyethyl) adenosine is an adenosine analog. Adenosine analogs mostly act as smooth muscle vasodilators and have also been shown to inhibit cancer progression. Its popular products are adenosine phosphate, Acadesine (HY-13417), Clofarabine (HY-A0005), Fludarabine phosphate (HY-B0028) and Vidarabine (HY-B0277) .

HY-147267

Evazarsen ISIS-757456	Angiotensin Receptor	Cardiovascular Disease Endocrinology
Evazarsen is an angiotensinogen synthesis inhibitor and possesses antihypertensive properties .

HY-159695

IONIS-GCCRRx ISIS 426115	Glucocorticoid Receptor	Metabolic Disease
IONIS-GCCRRx (ISIS 426115), a glucocorticoid receptor antagonist, is a 2'-O-methoxyethyl (2'-MOE) antisense oligonucleotide (ASO) .

HY-P10828

MAPI	Virus Protease	Infection Inflammation/Immunology
MAPI is a polypeptide irreversible 3C cysteine protease (SV3CP) inhibitor. MAPI inhibits SV3CP by covalently binding its C-terminal Michael-acceptor extension to the active site thiol of SV3CP Cys 139. MAPI is promising for research of noroviruses infection .

HY-W013849R

*Bis(2-methoxyethyl) phthalate (Standard)* Phthalic acid bis(2-Methoxyethyl) ester (Standard)	Reference Standards
Bis(2-methoxyethyl) phthalate (Standard) is the analytical standard of Bis(2-methoxyethyl) phthalate. This product is intended for research and analytical applications.

HY-W013849S

*Bis(2-methoxyethyl) phthalate-3,4,5,6-d4*	Isotope-Labeled Compounds	Others
Bis(2-methoxyethyl) phthalate-3,4,5,6-d₄ is the deuterium labeled Bis(2-methoxyethyl) phthalate .

HY-152577

*3’-O-(2-Methoxyethyl) inosine*	Nucleoside Antimetabolite/Analog	Cancer
3’-O-(2-Methoxyethyl) inosine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-152480

*3’-O-(2-Methoxyethyl)-5-methylcytidine*	Nucleoside Antimetabolite/Analog	Cancer
3’-O-(2-Methoxyethyl)-5-methylcytidine is a cytidine analog. Cytidine analogs have a mechanism of inhibiting DNA methyltransferases (such as Zebularine, HY-13420), and have potential anti-metabolic and anti-tumor activities .

HY-152482

*3’-O-(2-Methoxyethyl)-2-thiouridine*	Nucleoside Antimetabolite/Analog	Cancer
3’-O-(2-Methoxyethyl)-2-thiouridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc .

HY-W033132

*N-(2-Methoxyethyl)-N-methylglycine*	Amino Acid Derivatives	Others
N-(2-Methoxyethyl)-N-methylglycine is a glycine derivative that can be used for compound synthesis .

Cat. No.	Product Name	Type

HY-23789

*2′-O-(2-Methoxyethyl)guanosine* 2'-O-MOE-rG	Biochemical Assay Reagents
2′-O-(2-Methoxyethyl)guanosine (2'-O-MOE-rG) is a 2'-O-methoxyethyl-modified nucleoside analogue and an important intermediate in the synthesis of nucleic acid drugs. 2′-O-(2-Methoxyethyl)guanosine neither effectively phosphorylated by cytosolic nucleoside kinases, nor are they incorporated into cellular DNA or RNA .

HY-42084

*4-(2-Methoxyethyl)phenol* p-Hydroxyphenethyl methyl ether	Biochemical Assay Reagents
4-(2-Methoxyethyl)phenol is a biochemical reagent that can be used as a biological material or organic compound for life science related research.

HY-42084R

*4-(2-Methoxyethyl)phenol (Standard)* p-Hydroxyphenethyl methyl ether (Standard)	Biochemical Assay Reagents
4-(2-Methoxyethyl)phenol (Standard) is the analytical standard of 4-(2-Methoxyethyl)phenol. This product is intended for research and analytical applications. 4-(2-Methoxyethyl)phenol is a biochemical reagent that can be used as a biological material or organic compound for life science related research.

Cat. No.	Product Name	Target	Research Area

HY-134124

*Glutathione ethyl* ester**	Reactive Oxygen Species (ROS)	Metabolic Disease
Glutathione ethyl ester is a cell-permeable GSH donor and provides an efficient supply of GSH to the oocyte. Glutathione ethyl ester shows positive effect on the in vitro production of embryos by enhancement of the antioxidative defense .

HY-P3066

SKF 100398 d(CH2)5Tyr(Et)VAVP	Vasopressin Receptor	Metabolic Disease
SKF 100398 (d(CH2)5Tyr(Et)VAVP), an arginine vasopressin (AVP) analogue, is a specific antagonist of the antidiuretic effect of exogenous and endogenous AVP .

HY-P10828

MAPI	Virus Protease	Infection Inflammation/Immunology
MAPI is a polypeptide irreversible 3C cysteine protease (SV3CP) inhibitor. MAPI inhibits SV3CP by covalently binding its C-terminal Michael-acceptor extension to the active site thiol of SV3CP Cys 139. MAPI is promising for research of noroviruses infection .

HY-W033132

*N-(2-Methoxyethyl)-N-methylglycine*	Amino Acid Derivatives	Others
N-(2-Methoxyethyl)-N-methylglycine is a glycine derivative that can be used for compound synthesis .

HY-P4756

*N-(2-Carbamoyl-ethyl)-Val-Leu-anilide*	Peptides	Others
N-(2-Carbamoyl-ethyl)-Val-Leu-anilide is a polypeptide that can be found by peptide screening. Peptide screening is a research tool that pools active peptides primarily by immunoassay. Peptide screening can be used for protein interaction, functional analysis, epitope screening, especially in the field of agent research and development .

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-147406

Tonlamarsen ION-904	Cardiovascular Disease Structural Classification Natural Products Classification of Application Fields Endogenous metabolite Disease Research Fields Source Classification	Angiotensin Receptor
Tonlamarsen (ION-904) is a GalNAc-conjugated antisense oligonucleotide and Angiotensinogen synthesis inhibitor. Tonlamarsen specifically reduces the production of Angiotensinogen in the liver and plasma, and exhibits extremely low activity in the kidneys. Tonlamarsen can be used in research related to hypertension and heart failure .

HY-113291R

5'-Deoxyadenosine (Standard)	Structural Classification Natural Products Human Gut Microbiota Metabolites Microorganisms Endogenous metabolite Source Classification	Reference Standards Endogenous Metabolite Orthopoxvirus
4-(2-Methoxyethyl)phenol (Standard) is the analytical standard of 4-(2-Methoxyethyl)phenol. This product is intended for research and analytical applications. 4-(2-Methoxyethyl)phenol is a biochemical reagent that can be used as a biological material or organic compound for life science related research.

HY-N1871

*4-(2-Hydroxy-1-methoxyethyl)-1,2-benzenediol*	Oleaceae Syringa reticulata Polyphenols Plants Source Classification	Others
4-(2-Hydroxy-1-methoxyethyl)-1,2-benzenediol is a phenylethanoid isolated from the stem bark of Syringa reticulate (Bl.) Hara (Oleaceae) with expectorant and antiasthmatic activity .

Cat. No.	Product Name	Chemical Structure

HY-W013849S

*Bis(2-methoxyethyl) phthalate-3,4,5,6-d4*
Bis(2-methoxyethyl) phthalate-3,4,5,6-d₄ is the deuterium labeled Bis(2-methoxyethyl) phthalate .

HY-W336012S

Metoprolol EP impurity O-d7 hydrochloride
Metoprolol EP impurity O-d₇ (hydrochloride) is the deuterium labeled 3,3'-(Isopropylazanediyl)bis(1-(4-(2-methoxyethyl)phenoxy)propan-2-ol) .

HY-W724365

1-Bromo-2-methoxyethane-d3
1-Bromo-2-methoxyethane-d₃ (2-Methoxyethyl Bromide-d₃) is the deuterium labeled 1-Bromo-2-methoxyethane,98%(stabilized with Na2CO3).

HY-W714698

Dimethachlor ethane sulfonic acid sodium salt-d6
Dimethachlor ethane sulfonic acid sodium salt-d₆ is the deuterium labeled Sodium 2-((2,6-dimethylphenyl)(2-methoxyethyl)amino)-2-oxoethane-1-sulfonate (HY-W714703).

HY-W714228S

*2-(2-Hydroxy-N-(2-(methoxy-d3)ethyl)acetamido)-3-methylbenzoic acid*
2-(2-Hydroxy-N-(2-(methoxy-d₃)ethyl)acetamido)-3-methylbenzoic acid is deuterium labeled 2-(2-Hydroxy-N-(2-methoxyethyl)acetamido)-3-methylbenzoic acid .

HY-W714702S

*2-((2,6-Dimethylphenyl)(2-(methoxy-d3)ethyl)amino)-2-oxoacetic acid*
2-((2,6-Dimethylphenyl)(2-(methoxy-d₃)ethyl)amino)-2-oxoacetic acid is deuterium labeled 2-((2,6-Dimethylphenyl)(2-methoxyethyl)amino)-2-oxoacetic acid .

HY-W714703S

*Sodium 2-((2,6-dimethylphenyl)(2-(methoxy-d3)ethyl)amino)-2-oxoethane-1-sulfonate*
Sodium 2-((2,6-dimethylphenyl)(2-(methoxy-d₃)ethyl)amino)-2-oxoethane-1-sulfonate is deuterium labeled Sodium 2-((2,6-dimethylphenyl)(2-methoxyethyl)amino)-2-oxoethane-1-sulfonate .

Cat. No.	Product Name		Classification

HY-154386

*5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)-5-methyluridine*		Azide
5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)-5-methyluridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc . 5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)-5-methyluridine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

HY-152525

*5-(Azidomethyl)-2’-O-(2-methoxyethyl)uridine*		Azide
5-(Azidomethyl)-2’-O-(2-methoxyethyl)uridine is a thymidine analogue. Analogs of this series have insertional activity towards replicated DNA. They can be used to label cells and track DNA synthesis . 5-(Azidomethyl)-2’-O-(2-methoxyethyl)uridine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

HY-154383

*5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)uridine*		Azide
5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)uridine is a purine nucleoside analog. Purine nucleoside analogs have broad antitumor activity targeting indolent lymphoid malignancies. Anticancer mechanisms in this process rely on inhibition of DNA synthesis, induction of apoptosis, etc . 5’-Azido-5’-deoxy-2’-O-(2-methoxyethyl)uridine is a click chemistry reagent, it contains an Azide group and can undergo copper-catalyzed azide-alkyne cycloaddition reaction (CuAAc) with molecules containing Alkyne groups. It can also undergo strain-promoted alkyne-azide cycloaddition (SPAAC) reactions with molecules containing DBCO or BCN groups.

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社重松貿易株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:

Methoxyethyl

Inhibitors & Agonists

Fluorescent Dyes

Biochemical Assay Reagents

Peptides

NaturalProducts

Isotope-Labeled Compounds

Click Chemistry

Oligonucleotides

Natural
Products