Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
105 Results for "
Methoxyethyl
" in MedChemExpress (MCE) Product Catalog:
Products (105)
105 Results for "Methoxyethyl" in MCE Product Catalog:
7
7 Publications Verification
Target:
Research Areas:
Nusinersen is an antisense oligonucleotide active molecule. Nusinersen modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen improves spinal muscular atrophy .
4
Target:
Research Areas:
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
2
2 Cited Publications
Synonyms: BIIB067; ISIS-SOD1Rx; ISIS 333611
Target:
Research Areas:
Tofersen (BIIB067) is an antisense oligonucleotide and SOD1 mRNA inhibitor with an IC50 of 320 pM. Tofersen mediates RNase H-dependent degradation of SOD1 mRNA to reduce SOD1 protein levels in cerebrospinal fluid and serum. Tofersen downregulates cerebrospinal fluid neurofilament light chain, neurofilament heavy chain, amyloid-beta 1-40, amyloid-beta 1-42, neuropeptide Y, ubiquitin C-terminal hydrolase L1, neuropentraxins 1, 2, R, corticotropin-releasing hormone, IL-15, and serum neurofilament light chain, neurofilament heavy chain. Tofersen can be used for the research of superoxide dismutase 1-associated amyotrophic lateral sclerosis .
2
2 Cited Publications
Synonyms: OGX-427 sodium
Apatorsen (OGX-427) sodium is a 2'-methoxyethyl-modified antisense oligonucleotide and also a Hsp27 inhibitor. Apatorsen sodium reduces Hsp27 mRNA and protein levels, impairs stress-induced cytoprotective functions, induces cell apoptosis, inhibits tumor growth and prevents metastasis. Apatorsen sodium is applicable to research related to non-small cell lung cancer, castration-resistant prostate cancer, breast cancer, ovarian cancer and bladder cancer .
2
Apatorsen is a 2'-methoxyethyl-modified antisense oligonucleotide and also a Hsp27 inhibitor. Apatorsen reduces Hsp27 mRNA and protein levels, impairs stress-induced cytoprotective functions, induces cell apoptosis, inhibits tumor growth and prevents metastasis. Apatorsen is applicable to research related to non-small cell lung cancer, castration-resistant prostate cancer, breast cancer, ovarian cancer and bladder cancer .
1
1 Cited Publications
Target:
Research Areas:
1
1 Cited Publications
Cat. No.: HY-148089
CAS No.: 1637600-16-8
Target:
Research Areas:
Eplontersen is a triantennary N-acetyl galactosamine (GalNAc3-7a)-conjugated antisense oligonucleotide targeting transthyretin (TTR) mRNA to inhibit production of both variant and wild-type TTR protein. Misfolded TTR induces amyloid fibrils formation in the heart and peripheral nerves, leads to amyloid TTR (ATTR) amyloidosis diseases .
1
Target:
Research Areas:
Ulefnersen (ION363) is an Antisense Oligonucleotide (ASO) directed against the 6th intron of the fused-in sarcoma (FUS) transcript to silence FUS in a non-allele-specific manner. Ulefnersen can reduce postnatal levels of FUS protein in the brain and spinal cord in disease-relevant mouse model of ALS-FUS , delaying motor neuron degeneration. Ulefnersen can be used in the research of Amyotrophic Lateral Sclerosis (ALS) .
1
Research Areas:
Tadnersen (BIIB078), an antisense oligonucleotide (ASO), selectively targets C9ORF72 transcript variants 1 and 3 that carry the expansion .
Synonyms: ISIS-420915 sodium
Target:
Research Areas:
Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
Synonyms: ISIS 505358
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Synonyms: ISIS 304801
Target:
Research Areas:
Volanesorsen (ISIS 304801) is an antisense oligonucleotide inhibitor of apolipoprotein CIII (apo-CIII) mRNA that reduces triglyceride levels and improves insulin resistance. Volanesorsen is being studied in the treatment of hypertriglyceridemia, familial chylosiderosis syndrome, and type 2 diabetes .
Cat. No.: HY-145725A
CAS No.: 1698048-23-5
Synonyms: ISIS 598769; IONIS 598769; BIIB 065; ISIS-DMPK-2.5Rx
Target:
Research Areas:
Baliforsen (ISIS 5987690) is an antisense oligonucleotide (ASO) that inhibits DMPK mRNA. Baliforsen binds within exon 9 of the human DMPK transcript to promote RNase H1-mediated degradation Baliforsen can be used for the research of myotonic dystrophy type 1 .
Cat. No.: HY-W048491
CAS No.: 168427-74-5
Target:
Research Areas:
2′-O-(2-Methoxyethyl)adenosine is an ATP (HY-B2176) derivative. 2′-O-(2-Methoxyethyl)adenosine can be used for oligonucleotide synthesis .
Cat. No.: HY-W048495
CAS No.: 223777-15-9
Target:
Research Areas:
2'-O-(2-Methoxyethyl)-uridine is a synthetic oligonucleotide conversed from uridine. 2'-O-(2-Methoxyethyl)-uridine has the potential for chemotherapeutic agents development .
Synonyms: RG6042; IONIS-HTTRx
Target:
Research Areas:
Tominersen (RG6042) is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen can be used for the research of Huntington’s disease (HD) .
Cat. No.: HY-23789
CAS No.: 473278-54-5
Synonyms: 2'-O-MOE-rG
0 Images
DNA, d(P-thio)([2′-O-(2-methoxyethyl)]m5rU-[2′-O-(2-methoxyethyl)]m5rC-(3′→4′)-[2′,5′-anhydro-6′-deoxy-4′-C-(hydroxymethyl)-α-L-mannofurano]m5C-(3′→4′)-[2′,5′-anhydro-6′-deoxy-4′-C-(hydroxymethyl)-α-L-mannofurano]m5C-G-A-A-T-G-T-m5C-m5C-(3′→4′)-[2′,5′-anhydro-6′-deoxy-4′-C-(hydroxymethyl)-α-L-mannofurano]G-(3′→4′)-[2′,5′-anhydro-6′-deoxy-4′-C-(hydroxymethyl)-α-L-mannofurano]A-[2′-O-(2-methoxyethyl)]m5rC-[2′-O-(2-methoxyethyl)]rA), sodium salt (1:15)
Synonyms: IONIS 598769 sodium; ISIS 598769 sodium
Cat. No.: HY-145726
CAS No.: 250755-32-9
Target:
Research Areas:
ISIS 104838 is an antisense oligonucleotide targeting TNF-α. ISIS 104838 specifically binds to human TNF-α mRNA via Watson-Crick base pairing to form a DNA:RNA hybrid duplex, thereby recruiting the ubiquitously expressed intracellular enzyme RNase H to degrade the target mRNA and inhibit TNF-α protein synthesis at the transcriptional level. ISIS 104838 induces moderate, self-limiting thrombocytopenia in cynomolgus monkeys. ISIS 104838 can be used for the study of inflammatory diseases .
Cat. No.: HY-132579A
Purity: 97.36%
Synonyms: RG6042 sodium; IONIS-HTTRx sodium
Target:
Research Areas:
Tominersen sodium is a second-generation 2′-O-(2-methoxyethyl) antisense oligonucleotide that targets huntingtin protein (HTT) mRNA and potently suppresses HTT production. Tominersen improves survival and reduces brain atrophy in mice. Tominersen sodium can be used for the research of Huntington’s disease (HD) .
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
