2. Search Result
Search Result
Results for "

RNA oligonucleotide

" in MedChemExpress (MCE) Product Catalog:

65

Inhibitors & Agonists

7

Fluorescent Dyes

3

Biochemical Assay Reagents

1

Peptides

5

Natural
Products

2

Click Chemistry

46

Oligonucleotides

Targets Recommended:
Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-112980
    Nusinersen
    4 Publications Verification

    		 DNA/RNA Synthesis Neurological Disease
    Nusinersen is an antisense oligonucleotide active molecule. Nusinersen modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen improves spinal muscular atrophy .
    Nusinersen
  • HY-B0956
    Paromomycin sulfate
    4 Publications Verification

    Aminosidine sulfate

    		 Antibiotic Parasite Bacterial Infection
    Paromomycin (Aminosidine) sulfate, a neomycin (HY-B0470) derivative, is a broad spectrum aminoglycoside antibiotic with amebicidal and bactericidal effects. Paromomycin sulfate prematures termination of translation of mRNA and inhibits protein synthesis by specifically binds to the RNA oligonucleotide at the A site of bacterial 30S ribosomes. Paromomycin sulfate can be used for the research of bacterial and parasitic infections .
    Paromomycin sulfate
  • HY-D0150
    Thiazole Orange
    1 Publications Verification

    		 Fluorescent Dye Others
    Thiazole Orange is an asymmetric anthocyanin dye that can be coupled with oligonucleotides (ONs) to prepare fluorescent hybridization probes. Thiazole Orange has been widely used in biomolecular detection and staining of DNA/ RNA in gels and can be used for reticulocyte analysis. Thiazole orange generates a significant fluorescence enhancement and high quantum yield when it binds with nucleic acids, especially RNA. Thiazole orange can permeate living cell membranes. Thiazole orange can use UV light for detection, but can also be detected with blue light. The excitation and emission of Thiazole orange are λex = 510 nm (488 nm and 470 nm also show strong excitation) and λem = 527 nm, respectively .
    Thiazole Orange
  • HY-112980A
    Nusinersen sodium
    4 Publications Verification

    		 DNA/RNA Synthesis Neurological Disease
    Nusinersen sodium is an antisense oligonucleotide active molecule. Nusinersen sodium modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen sodium improves spinal muscular atrophy .
    Nusinersen sodium
  • HY-148505
    5'-ODMT cEt N-Bzm5 C Phosphoramidite (Amidite)

    		Phosphoramidites Nucleoside Antimetabolite/Analog Cardiovascular Disease Infection Metabolic Disease Cancer
    5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite is a potent nucleic acid analog. 5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite blongs to modified antisense oligonucleotide. 5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite allows the formation of a specific conformation of the furanose ring of the oligonucleotide through the introduction of a cEt modification, enhancing the ability to hybridize to complementary RNA. 5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite is mainly used in the research of regulation of gene expression related to metabolic diseases, cardiovascular diseases, cancers and the development of antisense compounds .
    5'-ODMT cEt N-Bzm5 C Phosphoramidite (Amidite)
  • HY-D0093
    Ethidium homodimer
    4 Publications Verification

    EthD-1

    		 DNA Stain Others
    Ethidium homodimer (EthD-1) is a high-affinity fluorescent nucleic acid dye commonly used to stain mammals, bacteria, yeast, and fungi. Ethidium homodimer binds to DNA or RNA, enhancing fluorescence more than 30 times. The Ethidium homodimer has a strong positive charge, so it cannot cross cell membranes and stain living cells; But the Ethidium homodimer can cross the disordered region of the dead cell membrane to reach the nucleus and embed the DNA double strand to produce red fluorescence. Therefore, Ethidium homodimer is a relatively sensitive nucleic acid stain that can accurately detect nucleic acids in solution or in decomposing cells. Ethidium homodimer binds DNA, Ex/Em=528/617 nm .
    Ethidium homodimer
  • HY-148503
    5'-ODMT cEt N-Bz A Phosphoramidite (Amidite)

    		Phosphoramidites Nucleoside Antimetabolite/Analog Others
    5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) is a nucleoside phosphoramidite monomer used to synthesize locked nucleic acid (LNA) analog oligonucleotides. It can be used as a building block of antisense oligonucleotides (ASOs) to target complementary RNA sequences. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) locks the furanose ring into an N-type conformation through 2',4'-constrained ethyl (cEt) modification, enhancing hybridization affinity and mismatch discrimination with RNA, while significantly improving the resistance of oligonucleotides to exonuclease digestion. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) mediates RNase H-dependent mRNA degradation or inhibits translation by forming a stable hybrid with RNA, thereby achieving gene expression regulation. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) is mainly used in the development of antisense drugs, gene function research and oligonucleotide synthesis related to disease treatment .
    5'-ODMT cEt N-Bz A Phosphoramidite (Amidite)
  • HY-21997
    DMT-2'fluoro-da(bz) amidite

    		Phosphoramidites DNA/RNA Synthesis Drug Intermediate Others
    DMT-2'fluoro-da(bz) amidite is a key intermediate for synthesizing antisense oligonucleotides with high nuclease resistance, high RNA binding affinity, and maintained base-pair specificity .
    DMT-2'fluoro-da(bz) amidite
  • HY-147217
    Bepirovirsen

    ISIS 505358

    		 HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-132608
    Inotersen sodium

    ISIS-420915 sodium

    		 Transthyretin (TTR) Neurological Disease
    Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
    Inotersen sodium
  • HY-147217A
    Bepirovirsen sodium

    ISIS 505358 sodium

    		 HBV Infection
    Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-D2171A
    AF488 DBCO ditriethylamine
    1 Publications Verification

    		 Fluorescent Dye Others
    AF488 DBCO ditriethylamineis a fluorescent dye and also a click chemistry reagent that can label azide-containing biomolecules. AF488 DBCO ditriethylaminemediates the coupling reaction with azide-modified 2'-OMe RNA oligonucleotides. DBCO is a bioorthogonal partner of azides and enables covalent coupling without copper (Ex/Em = 470/520 nm) .
    AF488 DBCO ditriethylamine
  • HY-138577
    2'-F-Bz-dC Phosphoramidite

    		Phosphoramidites DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Cancer
    2'-F-Bz-dC Phosphoramidite can be used in the synthesis of oligoribonucleotide (such as DNA and RNA). 2'-F-Bz-dC Phosphoramidite also used for synthesis antiviral agent to inhibit the replication of virus. 2'-F-Bz-dC Phosphoramidite contains a phosphorothioate backbone, to synthesise antisense oligonucleotide analogs to induce apoptosis in cancer cells .
    2'-F-Bz-dC Phosphoramidite
  • HY-W039442
    2′-Deoxy-2′-fluoroadenosine
    1 Publications Verification

    		 Nucleoside Antimetabolite/Analog Infection Cancer
    2′-Deoxy-2′-fluoroadenosine is a fluorinated deoxyadenosine with antitumor and antiviral activity, able to interfere with viral or cancer cell replication by being incorporated into DNA. 2′-Deoxy-2′-fluoroadenosine can be used for the synthesis of 2′-Deoxy-2′-fluoro-modified oligonucleotides hybridized with RNA. 2′-Deoxy-2′-fluoroadenosine can be cleaved efficiently by E. coli purine nucleoside phosphorylase (PNP) to the toxic agent 2-fluoroadenine (FAde). 2′-Deoxy-2′-fluoroadenosine shows excellent in vivo activity against tumors expressing E. coli PNP .
    2′-Deoxy-2′-fluoroadenosine
  • HY-113138
    3-Methyluridine
    1 Publications Verification

    N3-Methyluridine

    		 Endogenous Metabolite Metabolic Disease
    3-Methyluridine (m 3U; N3-Methyluridine) is a methylated nucleotide present in ribosomal RNA (rRNA), mainly targeting specific base sites of RNA molecules such as 23S rRNA. 3-Methyluridine can introduce a methyl group at the N3 position of uracil, affecting the secondary structure stability and base pairing ability of RNA, and regulating ribosome function. For example, it affects ribosomal subunit binding and tRNA interaction. 3-Methyluridine is often used as a key raw material for the synthesis of modified nucleotides, and is used to construct RNA oligonucleotides containing methylation modifications to study the effects of RNA methylation on gene expression and drug resistance .
    3-Methyluridine
  • HY-145724
    Drisapersen

    Kyndrisa; GSK2402968A; PRO051

    		 DNA/RNA Synthesis Dystrophin Neurological Disease
    Drisapersen (Kyndrisa) is a 2 '-O-methyl phosphorothioate RNA antisense oligonucleotide that induces exon 51 skipping. Drisapersen induces skipping of exon 51 during Dystrophin pre-mRNA splicing, allowing the synthesis of partially functional Dystrophin. Drisapersen can be used in research related to Duchenne muscular dystrophy .
    Drisapersen
  • HY-148100
    Emapticap pegol
    1 Publications Verification

    NOX-E36

    		 CCR Inflammation/Immunology Cancer
    Emapticap pegol (NOX-E36) is a inhibitor of pro-inflammatory chemokine C-C motif-ligand 2 (CCL2). Emapticap pegol is a 40-nucleotide oligonucleotide aptamer, displays different Spiegelmers (L-RNA aptamer) isform in human (NOX-E36) and mouse (mNOX-E36). mNOX-E36 is a murine-specific analogue of NOX-E36, an anti-MCP-1 L-RNA aptamer that was previously shown to attenuate liver fibrosis in mice .
    Emapticap pegol
  • HY-12854
    Imetelstat

    GRN163L

    		 Telomerase Apoptosis Cardiovascular Disease Cancer
    Imetelstat (GRN163L) is a 13-mer oligonucleotide and competitive Telomerase inhibitor. Imetelstat binds with high affinity to the template region of the RNA component of human telomerase. Imetelstat induces Apoptosis. Imetelstat is capable of selectively eliminating myelofibrosis hematopoietic stem cells. Imetelstat leads to the loss of a cancer cell's ability to maintain telomere length, resulting in the inhibition of cell proliferation .
    Imetelstat
  • HY-W048488
    2'-O-MOE-5-Me-rU

    		DNA/RNA Synthesis Drug Intermediate Others
    2'-O-MOE-5-Me-rU is a dual chemically modified ribonucleoside, which is a key modifying unit in the development of RNA drug preparations (such as antisense oligonucleotides ASO, siRNA). Its core function is to significantly enhance the stability, target affinity and drugability of nucleic acid drugs.
    2'-O-MOE-5-Me-rU
  • HY-160230
    ssRNA41 sodium

    		Toll-like Receptor (TLR) Infection
    ssRNA41 sodium is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. It derives from ssRNA40 by replacement of all U nucleotides with adenosine. ssRNA41 sodium is unable to induce the production of type IFNs, and therefore can be used as a negative control for ssRNA40 .
    ssRNA41 sodium
  • HY-D2171
    AF488 DBCO

    		Fluorescent Dye Others
    AF488 DBCO is a fluorescent dye and also a click chemistry reagent that can label azide-containing biomolecules. AF488 DBCO mediates the coupling reaction with azide-modified 2'-OMe RNA oligonucleotides. DBCO is a bioorthogonal partner of azides and enables covalent coupling without copper (Ex/Em = 470/520 nm) .
    AF488 DBCO
  • HY-150145
    Cy5-UTP

    		Nucleoside Antimetabolite/Analog Fluorescent Dye Others
    Cy5-UTP is a fluorescently labeled ribonucleotide triphosphate that can be used as a substrate for terminal deoxynucleotidyl transferase (TdT). Cy5-UTP can be employed to label RNA probes generated in vitro (Ex/Em: 650/665 nm). Cy5-UTP can be applied in FISH, multi-color fluorescence analysis, especially in dual-color expression arrays that combine with Cy5-UTP .
    Cy5-UTP
  • HY-W570888
    2'-O,4'-C-Methylenecytidine

    LNA-C(Bz)

    		 Nucleoside Antimetabolite/Analog Cancer
    2'-O,4'-C-Methylenecytidine (LNA-C(Bz)) is a bicyclic nucleoside analogue with fixed N-type conformation. 2'-O,4'-C-Methylenecytidine can be used to synthesize oligonucleotides. 2'-O,4'-C-Methylenecytidine forms duplexes with complementary DNA and RNA strands .
    2'-O,4'-C-Methylenecytidine
  • HY-P0229
    Ribonuclease T1, Aspergillus oryzae

    RNAse T1

    		 DNA/RNA Synthesis Others
    Ribonulease T1, Aspergillus oryzae (Rnase T1), is commonly used in biochemical research. Ribonuclease T1 is an endonuclease that can specifically degrade single stranded RNA. Ribonuclease T1 can form nucleoside 2 ', 3 '-cyclic phosphoric acid intermediates to cut the phosphodiester bond between 3' -guanosine residues and adjacent nucleoside 5 '-OH groups to produce 3' -GMP terminal oligonucleotides .
    Ribonuclease T1, Aspergillus oryzae
  • HY-145726
    ISIS 104838

    		TNF Receptor Cardiovascular Disease Inflammation/Immunology
    ISIS 104838 is an antisense oligonucleotide targeting TNF-α. ISIS 104838 specifically binds to human TNF-α mRNA via Watson-Crick base pairing to form a DNA:RNA hybrid duplex, thereby recruiting the ubiquitously expressed intracellular enzyme RNase H to degrade the target mRNA and inhibit TNF-α protein synthesis at the transcriptional level. ISIS 104838 induces moderate, self-limiting thrombocytopenia in cynomolgus monkeys. ISIS 104838 can be used for the study of inflammatory diseases .
    ISIS 104838
  • HY-160231
    ssRNA42 sodium

    		Toll-like Receptor (TLR) Inflammation/Immunology
    ssRNA42 (sodium) is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. ssRNA42 (sodium) derives from ssRNA40 by replacement of all G nucleotides with adenosine. ssRNA42 activated human PBMCs to secrete IFN-α, TNF-a, IL- 12p40, and IL-6, but ssRNA42 failed to stimulated murine pDCs and PBMCs.
    ssRNA42 sodium
  • HY-148100A
    Emapticap pegol sodium
    1 Publications Verification

    NOX-E36 sodium

    		 CCR Cancer
    Emapticap pegol sodium is a inhibitor of pro-inflammatory chemokine C-C motif-ligand 2 (CCL2). Emapticap pegol sodium is a 40-nucleotide oligonucleotide aptamer, displays different Spiegelmers (L-RNA aptamer) isform in human (NOX-E36) and mouse (mNOX-E36) .
    Emapticap pegol sodium
  • HY-78574
    N-Benzoylcytidine

    		Nucleoside Antimetabolite/Analog Others
    N-Benzoylcytidine is a modified cytidine analogue that can be phosphorylated by uracil-cytidine kinase (UCK1 and UCK2). N-Benzoylcytidine can be used to synthesize 2-OH protective groups for solid-phase RNA synthesis, as well as synthetic oligonucleotides for UV induction and targeted gene silencing in zebrafish embryos .
    N-Benzoylcytidine
  • HY-164582
    DMTr-2'-O-C22-rC(Ac)-3'-CE-Phosphoramidite

    		Phosphoramidites DNA/RNA Synthesis Others
    DMTr-2'-O-C22-rC (Ac)-3'-CE-Phosphoramidite is an RNA phosphoramidite monomer. DMTr-2'-O-C22-rC (Ac)-3'-CE-Phosphoramidite enables site-specific introduction of 2'-O-C22 lipophilic modification at cytidine positions during oligonucleotide synthesis, which is used to construct double-stranded RNA (dsRNA) molecules with extrahepatic delivery capability. DMTr-2'-O-C22-rC (Ac)-3'-CE-Phosphoramidite supports target gene silencing in skeletal muscle, cardiac muscle and adipose tissue by enhancing the lipophilicity and tissue uptake efficiency of dsRNA. Construction and mechanism study of DMTr-2'-O-C22-rC (Ac)-3'-CE-Phosphoramidite nucleic acid silencing molecules .
    DMTr-2'-O-C22-rC(Ac)-3'-CE-Phosphoramidite
  • HY-W042357
    Ac-rC Phosphoramidite

    		Phosphoramidites DNA/RNA Synthesis Others
    Ac-rC Phosphoramidite is a cytosine phosphoramidite used in the chemical synthesis of RNA oligonucleotides. Ac-rC Phosphoramidite enables the incorporation of cytidine nucleotides into synthetic RNA strands, and its unique protecting groups ensure the structural integrity of the molecule throughout complex synthetic processes .
    Ac-rC Phosphoramidite
  • HY-177454
    Basivarsen linker

    		ADC Linker Others
    Basivarsen linker is a linker used in HY-177452 Zeleciment basivarsen for coupling a TfR1-binding Fab (HY-P990780 Zeleciment) and an antisense oligonucleotide. Zeleciment basivarsen is an antibody-oligonucleotide conjugate (AOC) designed to target mutant nuclear myotonic dystrophy protein kinase (DMPK) RNA for RHase H-mediated degradation to correct splicing. It is used for the study of myotonic dystrophy type 1 (DM1).
    Basivarsen linker
  • HY-21286
    N2-Isobutyryl-2'-O-methylguanosine

    		Drug Intermediate Others
    N2-Isobutyryl-2'-O-methylguanosine is a nucleic acid synthesis intermediate (e.g., used in antisense oligonucleotides, mRNA modification), for example, it is a key monomer for the synthesis of 2'-O-methyl oligoribonucleotides. N2-Isobutyryl-2'-O-methylguanosine enables the final product to form stable double strands with complementary RNA and is not easily degraded by nucleases. N2-Isobutyryl-2'-O-methylguanosine is mainly used in molecular biology research, and can be used to prepare RNA hybridization probes or participate in related biochemical research such as pre-mRNA splicing mechanisms .
    N2-Isobutyryl-2'-O-methylguanosine
  • HY-145726A
    ISIS 104838 sodium

    		TNF Receptor Cardiovascular Disease Inflammation/Immunology
    ISIS 104838 sodium is an antisense oligonucleotide targeting TNF-α. ISIS 104838 sodium specifically binds to human TNF-α mRNA via Watson-Crick base pairing to form a DNA:RNA hybrid duplex, thereby recruiting the ubiquitously expressed intracellular enzyme RNase H to degrade the target mRNA and inhibit TNF-α protein synthesis at the transcriptional level. ISIS 104838 sodium induces moderate, self-limiting thrombocytopenia in cynomolgus monkeys. ISIS 104838 sodium can be used for the study of inflammatory diseases .
    ISIS 104838 sodium
  • HY-164581
    DMTr-2'-O-C22-rG(ibu)-3'-CE-Phosphoramidite

    		Phosphoramidites DNA/RNA Synthesis Others
    DMTr-2'-O-C22-rG (ibu)-3'-CE-Phosphoramidite is an RNA phosphoramidite monomer for oligonucleotide synthesis. DMTr-2'-O-C22-rG (ibu)-3'-CE-Phosphoramidite enables site-specific introduction of 2'-O-C22 lipophilic modification at guanosine positions to construct double-stranded RNA (dsRNA) molecules with extrahepatic delivery capability. DMTr-2'-O-C22-rG (ibu)-3'-CE-Phosphoramidite supports target gene silencing in skeletal muscle, cardiac muscle and adipose tissue by enhancing the lipid solubility and tissue uptake efficiency of dsRNA. DMTr-2'-O-C22-rG (ibu)-3'-CE-Phosphoramidite can be used for the construction and mechanism research of nucleic acid silencing molecules .
    DMTr-2'-O-C22-rG(ibu)-3'-CE-Phosphoramidite
  • HY-139099
    Diguanosine 5′-triphosphate

    Gp3G

    		 Nucleoside Antimetabolite/Analog DNA/RNA Synthesis Cancer
    Diguanosine 5′-triphosphate (Gp3G) is a dinucleoside triphosphates. Diguanosine 5′-triphosphate also is a virus-specific oligonucleotide. Diguanosine 5′-triphosphate is needed for the synthesis of RNA during the transcription process .
    Diguanosine 5′-triphosphate
  • HY-W892781
    DMTr-TNA A(Bz)-amidite

    		Biochemical Assay Reagents Others
    DMTr-TNA A(Bz)-amidite is a nucleoside building block that has been used in the synthesis of oligonucleotides for the study of prebiotic RNA evolution .
    DMTr-TNA A(Bz)-amidite
  • HY-145980
    m7GpppUpG

    		Nucleoside Antimetabolite/Analog Others
    m7GpppUpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppUpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures .
    m7GpppUpG
  • HY-145982
    m7GpppCmpG

    		Nucleoside Antimetabolite/Analog Others
    m7GpppCmpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppCmpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures .
    m7GpppCmpG
  • HY-145979
    m7GpppUmpG

    		Nucleoside Antimetabolite/Analog Others
    m7GpppUmpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppUmpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures .
    m7GpppUmpG
  • HY-145981
    m7GpppCpG

    		Nucleoside Antimetabolite/Analog Others
    m7GpppCpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppCpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures .
    m7GpppCpG
  • HY-W073825
    N2-iso-Butyryl-2'-O-(2-methoxyethyl)guanosine

    		Nucleoside Antimetabolite/Analog Cancer
    N2-iso-Butyryl-2'-O-(2-methoxyethyl)guanosine is a 2’-0-(2-methoxyethyl) guanosine derivative. 2’-0-methoxyethyl nucleoside derivatives can enhance the affinity with RNA and increase the resistance of oligonucleotides to nucleases.
    N2-iso-Butyryl-2'-O-(2-methoxyethyl)guanosine
  • HY-D1409
    DMTr-4'-F-U-CED-TBDMS phosphoramidite

    DMTr-4'-F-uridine-CED-TBDMS phosphoramidite

    		 DNA Stain Phosphoramidites Cardiovascular Disease
    DMTr-4'-F-U-CED-TBDMS phosphoramidite (DMTr-4'-F-uridine-CED-TBDMS phosphoramidite), a dye reagent for oligonucleotide labeling, can be used for the research of applications in RNA therapeutics, RNA aptamers, and ribozymes for elucidating RNA structure. DMTr-4'-F-U-CED-TBDMS phosphoramidite represents a probe with wide utility for elucidation of RNA structure .
    DMTr-4'-F-U-CED-TBDMS phosphoramidite
  • HY-W115309
    DMT-2'-F-iBu-G

    5'-DMT-2'-F-ibu-dG

    		 Phosphoramidites Nucleoside Antimetabolite/Analog Others
    DMT-2'-F-iBu-G (5'-DMT-2'-F-ibu-dG) is a modified oligonucleotide. 2'-deoxy-2'-fluoro-modified oligonucleotides shows high nuclease resistant and retained exceptional binding affinity to the RNA targets .
    DMT-2'-F-iBu-G
  • HY-139099B
    Diguanosine 5′-triphosphate triammonium

    Gp3G triammonium

    		 Nucleoside Antimetabolite/Analog DNA/RNA Synthesis Cancer
    Diguanosine 5′-triphosphate (Gp3G) triammonium is a dinucleoside triphosphates. Diguanosine 5′-triphosphate triammonium also is a virus-specific oligonucleotide. Diguanosine 5′-triphosphate triammonium is needed for the synthesis of RNA during the transcription process .
    Diguanosine 5′-triphosphate triammonium
  • HY-157091
    Uridine, 5'-P,P',P'',P''-tetrahydrogen imidotriphosphate

    		Nucleoside Antimetabolite/Analog Others
    Uridine, 5'-(P,P',P'',P''-tetrahydrogen imidotriphosphate) is a non-hydrolyzable nucleotide that can synthesize RNA oligonucleotides .
    Uridine, 5'-P,P',P'',P''-tetrahydrogen imidotriphosphate
  • HY-D1408
    DMTr-4'-Me-U-CED-TBDMS phosphoramidite

    DMTr-4'-Methyluridine-CED-TBDMS phosphoramidite

    		 DNA Stain Phosphoramidites Cardiovascular Disease
    DMTr-4'-Me-U-CED-TBDMS phosphoramidite (DMTr-4'-Methyluridine-CED-TBDMS phosphoramidite), a dye reagent for oligonucleotide labeling, can be used for the research of applications in RNA therapeutics, RNA aptamers, and ribozymes for elucidating RNA structure. DMTr-4'-Me-U-CED-TBDMS phosphoramidite represents a probe with wide utility for elucidation of RNA structure .
    DMTr-4'-Me-U-CED-TBDMS phosphoramidite
  • HY-171618
    Morpholino U subunit

    		Nucleoside Antimetabolite/Analog Others
    Morpholino U subunit is one of the basic units that make up morpholino oligonucleotides. Morpholino U subunit can pair with adenine in the target RNA .
    Morpholino U subunit
  • HY-139099A
    Diguanosine 5′-triphosphate lithium

    Gp3G lithium

    		 DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Cancer
    Diguanosine 5′-triphosphate (Gp3G) lithium is a dinucleoside triphosphates. Diguanosine 5′-triphosphate lithium also is a virus-specific oligonucleotide. Diguanosine 5′-triphosphate lithium is needed for the synthesis of RNA during the transcription process .
    Diguanosine 5′-triphosphate lithium
  • HY-D1411
    DMTr-4'-CF3-5-Me-U-CED phosphoramidite

    DMTr-4'-CF3-5-Methyluridine-CED phosphoramidite

    		 DNA Stain Phosphoramidites Others
    DMTr-4'-CF3-5-Me-U-CED phosphoramidite (DMTr-4'-CF3-5-Methyluridine-CED phosphoramidite), the modified oligodeoxynucleotide (ODN), is a dye reagent for oligonucleotide labeling, can be used for the research of applications in RNA research .
    DMTr-4'-CF3-5-Me-U-CED phosphoramidite
  • HY-153836
    Anivamersen

    		Factor Xa Others
    Anivamersen is an RNA aptamer to reverse the anticoagulant effect of the parenteral factor IXa inhibitor pegnivacogin. REG1 is a novel anticoagulation system consisting of pegnivacogin, an RNA aptamer inhibitor of coagulation factor IXa, and anivamersen, a complementary sequence reversal oligonucleotide.
    Anivamersen

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

  

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

  

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: