Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
100 Results for "
RNA oligonucleotide
" in MedChemExpress (MCE) Product Catalog:
Products (100)
100 Results for "RNA oligonucleotide" in MCE Product Catalog:
6
6 Publications Verification
Target:
Research Areas:
Nusinersen is an antisense oligonucleotide active molecule. Nusinersen modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen improves spinal muscular atrophy .
6
6 Publications Verification
Cat. No.: HY-112980A
Purity: 98.91%
Target:
Research Areas:
Nusinersen sodium is an antisense oligonucleotide active molecule. Nusinersen sodium modifies the pre-messenger RNA splicing of the SMN2 gene, thereby promoting the production of full-length SMN protein. Nusinersen sodium improves spinal muscular atrophy .
5
4
Category:
Anti-parasitic Disease Research Antibacterial Other Antibiotics Infection Microorganisms Plant Cell Culture Antibiotics Resistance Selection Mammalian Cell Culture Disease Research Fields
Target:
1
1 Cited Publications
Cat. No.: HY-D0150
CAS No.: 107091-89-4
1
1 Cited Publications
Cat. No.: HY-D2171A
1
1 Cited Publications
Cat. No.: HY-W039442
CAS No.: 64183-27-3
Target:
2′-Deoxy-2′-fluoroadenosine is a fluorinated deoxyadenosine with antitumor and antiviral activity, able to interfere with viral or cancer cell replication by being incorporated into DNA. 2′-Deoxy-2′-fluoroadenosine can be used for the synthesis of 2′-Deoxy-2′-fluoro-modified oligonucleotides hybridized with RNA. 2′-Deoxy-2′-fluoroadenosine can be cleaved efficiently by E. coli purine nucleoside phosphorylase (PNP) to the toxic agent 2-fluoroadenine (FAde). 2′-Deoxy-2′-fluoroadenosine shows excellent in vivo activity against tumors expressing E. coli PNP .
1
1 Cited Publications
Synonyms: N3-Methyluridine
Target:
1
Target:
Research Areas:
Emapticap pegol (NOX-E36) is a inhibitor of pro-inflammatory chemokine C-C motif-ligand 2 (CCL2). Emapticap pegol is a 40-nucleotide oligonucleotide aptamer, displays different Spiegelmers (L-RNA aptamer) isform in human (NOX-E36) and mouse (mNOX-E36). mNOX-E36 is a murine-specific analogue of NOX-E36, an anti-MCP-1 L-RNA aptamer that was previously shown to attenuate liver fibrosis in mice .
1
Emapticap pegol sodium is a inhibitor of pro-inflammatory chemokine C-C motif-ligand 2 (CCL2). Emapticap pegol sodium is a 40-nucleotide oligonucleotide aptamer, displays different Spiegelmers (L-RNA aptamer) isform in human (NOX-E36) and mouse (mNOX-E36) .
Research Areas:
5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite is a potent nucleic acid analog. 5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite blongs to modified antisense oligonucleotide. 5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite allows the formation of a specific conformation of the furanose ring of the oligonucleotide through the introduction of a cEt modification, enhancing the ability to hybridize to complementary RNA. 5'-ODMT cEt N-Bzm5 C Phosphoramidite Amidite is mainly used in the research of regulation of gene expression related to metabolic diseases, cardiovascular diseases, cancers and the development of antisense compounds .
Research Areas:
5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) is a nucleoside phosphoramidite monomer used to synthesize locked nucleic acid (LNA) analog oligonucleotides. It can be used as a building block of antisense oligonucleotides (ASOs) to target complementary RNA sequences. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) locks the furanose ring into an N-type conformation through 2',4'-constrained ethyl (cEt) modification, enhancing hybridization affinity and mismatch discrimination with RNA, while significantly improving the resistance of oligonucleotides to exonuclease digestion. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) mediates RNase H-dependent mRNA degradation or inhibits translation by forming a stable hybrid with RNA, thereby achieving gene expression regulation. 5'-ODMT cEt N-Bz A Phosphoramidite (Amidite) is mainly used in the development of antisense drugs, gene function research and oligonucleotide synthesis related to disease treatment .
Cat. No.: HY-21997
CAS No.: 136834-22-5
Synonyms: ISIS 505358
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Synonyms: ISIS-420915 sodium
Target:
Research Areas:
Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
Synonyms: ISIS 505358 sodium
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
Research Areas:
2'-F-Bz-dC Phosphoramidite can be used in the synthesis of oligoribonucleotide (such as DNA and RNA). 2'-F-Bz-dC Phosphoramidite also used for synthesis antiviral agent to inhibit the replication of virus. 2'-F-Bz-dC Phosphoramidite contains a phosphorothioate backbone, to synthesise antisense oligonucleotide analogs to induce apoptosis in cancer cells .
Synonyms: Kyndrisa; GSK2402968A; PRO051
Target:
Research Areas:
Drisapersen (Kyndrisa) is a 2 '-O-methyl phosphorothioate RNA antisense oligonucleotide that induces exon 51 skipping. Drisapersen induces skipping of exon 51 during Dystrophin pre-mRNA splicing, allowing the synthesis of partially functional Dystrophin. Drisapersen can be used in research related to Duchenne muscular dystrophy .
Synonyms: GRN163L
Target:
Research Areas:
Imetelstat (GRN163L) is a 13-mer oligonucleotide and competitive Telomerase inhibitor. Imetelstat binds with high affinity to the template region of the RNA component of human telomerase. Imetelstat induces Apoptosis. Imetelstat is capable of selectively eliminating myelofibrosis hematopoietic stem cells. Imetelstat leads to the loss of a cancer cell's ability to maintain telomere length, resulting in the inhibition of cell proliferation .
Cat. No.: HY-W048488
CAS No.: 163759-49-7
Target:
Research Areas:
2'-O-MOE-5-Me-rU is a dual chemically modified ribonucleoside, which is a key modifying unit in the development of RNA drug preparations (such as antisense oligonucleotides ASO, siRNA). Its core function is to significantly enhance the stability, target affinity and drugability of nucleic acid drugs.
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
