Scientific Reviews
Product Guides
Blogs
Topics
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!2025-02-06
92 Results for "
HBV infection
" in MedChemExpress (MCE) Product Catalog:
Products (92)
92 Results for "HBV infection" in MCE Product Catalog:
8
6
Research Areas:
Taurolithocholic acid is an orally active bile acid and antiviral agent. Taurolithocholic acid upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis (Ferroptosis), viral replication and viral entry of HBV/HDV, while reducing the release of IL-1β, lipid ROS and LDH. While exerting antiviral protective effects, Taurolithocholic acid also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic acid serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic acid shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic acid not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis .
6
6 Cited Publications
2
2 Cited Publications
Synonyms: JNJ-6379; JNJ-56136379
Target:
Research Areas:
Bersacapavir (JNJ-6379) is an HBV capsid assembly modulator. Bersacapavir exerts a dual mechanism of action against both early and late stages of HBV infection by forming complete genome-free empty capsids and inhibiting de novo synthesis of cccDNA. Bersacapavir inhibits HBV replication. Bersacapavir can be used in the research of hepatitis B .
2
Target:
Research Areas:
Selgantolimod (GS-9688) is an orally active, potent and selective toll-like receptor 8 (TLR8) agonist for the treatment of hepatitis B virus (HBV) and human immunodeficiency virus (HIV) infection .
2
Target:
Research Areas:
Vebicorvir (ABI-H0731) is a first-generation hepatitis B virus (HBV) core protein inhibitor. Vebicorvir (ABI-H0731) suppresses covalently closed circular DNA (cccDNA) formation in two de novo infection models with EC50s from 1.84 μM to 7.3 μM .
2
2 Cited Publications
Cat. No.: HY-N8107
CAS No.: 34446-06-5
1
Famciclovir (BRL 42810) is an orally active nucleoside analogue. Famciclovir is an antiviral agent with potent activities against HBV, HSV and VZV. Famciclovir can be used for the research of herpesvirus infection .
1
Target:
Research Areas:
Clevudine (L-FMAU), a nucleoside analog of the unnatural L-configuration, has potent anti-HBV activity with long half-life, low toxicity. Clevudine is a non-competitive inhibitor that is not incorporated into the viral DNA but rather binds to the polymerase. Clevudine is active against cowpox virus respiratory infection in mice .
1
1 Cited Publications
Target:
Research Areas:
ccc_R08 is a non-cytotoxic and orally active cccDNA inhibitor that reduces cccDNA levels in the liver of HBV-infected mice. ccc_R08 can be used in the study of HBV virus (hepatitis B virus) infection .
Synonyms: ISIS 505358
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
Synonyms: ISIS 505358 sodium
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .
Synonyms: ZM-H1505R
Canocapavir (ZM-H1505R) is an orally active HBV core protein-targeting antiviral agent. Canocapavir binds to the hydrophobic pocket at the dimer-dimer interface of HBV core protein (HBc), stimulating intracellular accumulation of nonfunctional HBV capsids, disrupting viral replication. Canocapavir interferes with the interaction between HBc and HBV large surface protein, resulting in diminished
production of empty virionsis. Canocapavir can be used for the research of hepatitis B virus (HBV) infection .
production of empty virionsis. Canocapavir can be used for the research of hepatitis B virus (HBV) infection .
Synonyms: RO7445482 sodium
Xalnesiran (RO7445482) sodium is a small interfering RNA molecule that targets a conserved region of the
hepatitis B virus (HBV) genome . Xalnesiran sodium can be used for the research of chronic hepatitis B infection .
hepatitis B virus (HBV) genome . Xalnesiran sodium can be used for the research of chronic hepatitis B infection .
Target:
Research Areas:
trans-ccc_R08 (Compound 1-B) is a cccDNA inhibitor with anti-HBV activity, with an IC50 of 0.14 μM for HBeAg and an IC50 of 0.08 μM for HBsAg in in vitro assays. trans-ccc_R08 inhibits covalently closed circular DNA (cccDNA). trans-ccc_R08 is applicable to research related to hepatitis B virus infection .
Cat. No.: HY-147266
Purity: 95.83%
Synonyms: VIR-2218 sodium
Target:
Research Areas:
Elebsiran (VIR-2218) sodium is a siRNA that targets and degrades hepatitis B virus (HBV) and hepatitis D virus (HDV) RNA transcripts. Elebsiran sodium leads to a significant decrease in HBV surface antigen (HBsAg) and a reduction in viral load. Elebsiran sodium binds to the sialic acid-depleted glycoprotein receptor (ASGPR) on the surface of liver cells through the GalNAc ligand, achieving liver-targeted delivery and demonstrating improved liver safety. Elebsiran sodium can be used for the study of chronic HBV/HDV infections .
Target:
Research Areas:
RIG-1 modulator 1 (Compound of claim 13) is an anti-viral compound which can be used against viral infections including influenza virus, HBV, HCV and HIV .
Cat. No.: HY-P3601
CAS No.: 211362-85-5
Synonyms: FGF basic (1-24)
Research Areas:
Synonyms: RO7020531; RG7854
Target:
Research Areas:
Ruzotolimod (RO7020531) is an orally active TLR7 agonist. Ruzotolimod inhibits WHV viral replication and, in combination with RO-7049389 (HY-145579), inhibits AAV-HBV viral load. Ruzotolimod can be used to study infection with COVID-19 or SARS-CoV-2 .
-
-
Protocols
Targeted therapy! The Capetin Prize winning "Click Chemistry" can be used like this!Targeted therapy! The Nobel Prize winning "Click Chemistry" can be used like this!A suitable model is crucial in drug screening experiments. Organs can mimic the three-dimensional functional structure of internal organs, have similar spatial organization to corresponding organs, maintain some key characteristics, and reproduce some physiological functions. They are widely used for modeling and personalized drug screening physiological functions.2025-02-06
