Search Result

Pathways Recommended:	Anti-infection

Results for "

HBV infection

" in MedChemExpress (MCE) Product Catalog:

By Targets:	HBV (78) Akt (8) Apoptosis (2) Bacterial (4) Calcium Channel (8) Carboxylesterase (CES) (1) DNA/RNA Synthesis (8) Drug Derivative (1) Endogenous Metabolite (1) Ferroptosis (8) Fungal (2) HCV (2) HIV (5) HSV (3) IFNAR (3) Influenza Virus (2) Interleukin Related (1) Isotope-Labeled Compounds (6) JAK (1) NF-κB (2) Orthopoxvirus (1) Parasite (2) PI3K (8) Reactive Oxygen Species (ROS) (10) Reference Standards (4) Reverse Transcriptase (1) SARS-CoV (1) Small Interfering RNA (siRNA) (2) STING (1) Tau Protein (1) Toll-like Receptor (TLR) (4) VZV (3)
By Research Areas:	Cancer (4) Cardiovascular Disease (1) Infection (76) Inflammation/Immunology (8) Metabolic Disease (7) Neurological Disease (4)
Oligonucleotides:	Adenosine (1) Guanosine (1) Nucleoside Analogs (3) Thymidine (1) siRNA drugs (3) Antisense Oligonucleotides (2) siRNAs (3)

Inhibitors & Agonists

Screening Libraries

Peptides

Inhibitory Antibodies

Natural
Products

Isotope-Labeled Compounds

Oligonucleotides

Targets Recommended: HBV

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-P3465

Bulevirtide 5+ Cited Publications Myrcludex B	HBV	Infection
Bulevirtide (Myrcludex B) is a NTCP inhibitor, a linear lipopeptide of 47 amino acids. Bulevirtide inhibits HBV and HDV entry into liver cells, blocks HBV infection in hepatocytes, and participates in HBV transcriptional suppression. Bulevirtide can be used in HDV infection and compensated cirrhosis research .

HY-113308

Taurolithocholic acid 5+ Cited Publications	Calcium Channel Ferroptosis PI3K Akt HBV Reactive Oxygen Species (ROS)	Cardiovascular Disease Infection Inflammation/Immunology
Taurolithocholic acid is an orally active bile acid and antiviral agent. Taurolithocholic acid upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis (Ferroptosis), viral replication and viral entry of *HBV/HDV, while reducing the release of IL-1β, lipid ROS* and LDH. While exerting antiviral protective effects, Taurolithocholic acid also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic acid serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic acid shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic acid not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis .

HY-109168

Bersacapavir 2 Publications Verification JNJ-6379; JNJ-56136379	HBV DNA/RNA Synthesis	Infection
Bersacapavir (JNJ-6379) is an *HBV* capsid assembly modulator. Bersacapavir exerts a dual mechanism of action against both early and late stages of *HBV* infection by forming complete genome-free empty capsids and inhibiting de novo synthesis of cccDNA. Bersacapavir inhibits *HBV* replication. Bersacapavir can be used in the research of hepatitis B .

HY-109137

Selgantolimod 1 Publications Verification GS-9688	Toll-like Receptor (TLR) HBV	Infection
Selgantolimod (GS-9688) is an orally active, potent and selective toll-like receptor 8 (TLR8) agonist for the treatment of hepatitis B virus (HBV) and human immunodeficiency virus (HIV) infection .

HY-113308A

Taurolithocholic acid sodium salt 5+ Cited Publications	Calcium Channel Ferroptosis PI3K Reactive Oxygen Species (ROS) Akt HBV	Metabolic Disease
Taurolithocholic acid sodium salt is an orally active bile acid and antiviral agent. Taurolithocholic acid sodium salt upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis, viral replication and viral entry of *HBV/HDV, while reducing the release of IL-1β, lipid ROS* and LDH. While exerting antiviral protective effects, Taurolithocholic acid sodium salt also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic acid sodium salt serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic acid sodium salt shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic acid sodium salt not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis .

HY-17426

Famciclovir 1 Publications Verification BRL 42810	VZV HSV HBV	Infection
Famciclovir (BRL 42810) is an orally active nucleoside analogue. Famciclovir is an antiviral agent with potent activities against HBV, HSV and VZV. Famciclovir can be used for the research of herpesvirus infection .

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all *HBV* messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium	HBV	Infection
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all *HBV* messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-N0444

Rubiadin	Reactive Oxygen Species (ROS) NF-κB HBV Apoptosis Bacterial Fungal Parasite	Infection Neurological Disease Metabolic Disease Inflammation/Immunology Cancer
Rubiadin is an orally active free radical scavenger that inhibits the activation of the NF-κB pathway. Rubiadin inhibits osteoclast formation, bone resorption, lipid peroxidation, *HBV* DNA replication and cancer cell proliferation; reduces pro-inflammatory cytokine levels; induces cancer cell apoptosis; and possesses antifungal, antimalarial, antibacterial and anticonvulsant activities. Rubiadin can be used in the research of osteoporosis, acute inflammation, chronic inflammation, carbon tetrachloride-induced liver injury, Alzheimer's disease, breast cancer, iron overload disorders, hepatitis B virus infection, colon cancer, liver cancer, T-lymphocytic leukemia, cervical cancer, diabetic nephropathy, epileptic seizures, fungal infections, malaria and bacterial infections .

HY-147255

Canocapavir ZM-H1505R	HBV	Infection
Canocapavir (ZM-H1505R) is an orally active *HBV* core protein-targeting antiviral agent. Canocapavir binds to the hydrophobic pocket at the dimer-dimer interface of HBV core protein (HBc), stimulating intracellular accumulation of nonfunctional HBV capsids, disrupting viral replication. Canocapavir interferes with the interaction between HBc and HBV large surface protein, resulting in diminished production of empty virionsis. Canocapavir can be used for the research of hepatitis B virus (HBV) infection .

HY-13859

Clevudine 1 Publications Verification L-FMAU	HBV DNA/RNA Synthesis Orthopoxvirus	Infection
Clevudine (L-FMAU), a nucleoside analog of the unnatural L-configuration, has potent *anti-HBV* activity with long half-life, low toxicity. Clevudine is a non-competitive inhibitor that is not incorporated into the viral DNA but rather binds to the polymerase. Clevudine is active against cowpox virus respiratory infection in mice .

HY-109195

Vebicorvir 2 Publications Verification ABI-H0731	HBV	Infection Inflammation/Immunology
Vebicorvir (ABI-H0731) is a first-generation *hepatitis B virus (HBV) core protein* inhibitor. Vebicorvir (ABI-H0731) suppresses covalently closed circular DNA (cccDNA) formation in two de novo infection models with EC₅₀s from 1.84 μM to 7.3 μM .

HY-145638A

Xalnesiran sodium RO7445482 sodium	HBV	Infection
Xalnesiran (RO7445482) sodium is a small interfering RNA molecule that targets a conserved region of the hepatitis B virus (HBV) genome . Xalnesiran sodium can be used for the research of chronic hepatitis B infection .

HY-148560A

trans-ccc_R08	HBV DNA/RNA Synthesis	Infection
trans-ccc_R08 (Compound 1-B) is a cccDNA inhibitor with anti-HBV activity, with an IC₅₀ of 0.14 μM for HBeAg and an IC₅₀ of 0.08 μM for HBsAg in in vitro assays. trans-ccc_R08 inhibits covalently closed circular DNA (cccDNA). trans-ccc_R08 is applicable to research related to hepatitis B virus infection .

HY-148560

ccc_R08 1 Publications Verification	HBV DNA/RNA Synthesis	Infection
ccc_R08 is a non-cytotoxic and orally active cccDNA inhibitor that reduces cccDNA levels in the liver of HBV-infected mice. ccc_R08 can be used in the study of HBV virus (hepatitis B virus) infection .

HY-147266

Elebsiran sodium VIR-2218 sodium	Small Interfering RNA (siRNA) HBV	Infection
Elebsiran (VIR-2218) sodium is a siRNA that targets and degrades hepatitis B virus (HBV) and hepatitis D virus (HDV) RNA transcripts. Elebsiran sodium leads to a significant decrease in HBV surface antigen (HBsAg) and a reduction in viral load. Elebsiran sodium binds to the sialic acid-depleted glycoprotein receptor (ASGPR) on the surface of liver cells through the GalNAc ligand, achieving liver-targeted delivery and demonstrating improved liver safety. Elebsiran sodium can be used for the study of chronic HBV/HDV infections .

HY-107902

RIG-1 modulator 1	HBV HCV HIV Influenza Virus	Infection
RIG-1 modulator 1 (Compound of claim 13) is an anti-viral compound which can be used against viral infections including influenza virus, *HBV, HCV* and HIV .

HY-P3601

Brain Derived Basic Fibroblast Growth Factor (1-24) FGF basic (1-24)	Bacterial HBV	Infection Inflammation/Immunology
Brain Derived Basic Fibroblast Growth Factor (1-24) (FGF basic 1-24) is a synthetic peptide, shows anti-bacterial and anti-HBV activities. Brain Derived Basic Fibroblast Growth Factor (1-24) can be used in infection disease and immune disease research .

HY-145592

Ruzotolimod RO7020531; RG7854	Toll-like Receptor (TLR) SARS-CoV HBV	Infection
Ruzotolimod (RO7020531) is an orally active TLR7 agonist. Ruzotolimod inhibits WHV viral replication and, in combination with RO-7049389 (HY-145579), inhibits *AAV-HBV* viral load. Ruzotolimod can be used to study infection with COVID-19 or SARS-CoV-2 .

HY-W352344

2'-Deoxy-L-adenosine	HBV	Infection
2'-Deoxy-L-adenosine is an orally active synthon for modified oligodeoxyribonucleotides. 2'-Deoxy-L-adenosine is a potent, specific and selective inhibitor of the replication of hepatitis B virus (HBV) as well as the closely related duck and woodchuck hepatitis viruses (WHV) .

HY-148560B

cis-ccc_R08	HBV	Infection
cis-ccc_R08 (compound 1) is a flavonoid derivative that can be used in the study of hepatitis B virus (HBV) infection. cis-ccc_R08 is a cccDNA (covalently closed circular DNA) inhibitor .

HY-16680

Helioxanthin 8-1 Helioxanthin analogue 8-1	HBV	Infection
Helioxanthin 8-1(Helioxanthin analogue 8-1) is an anti-HBV agent. Helioxanthin 8-1 exhibits anti-hepatitis B virus activity in both in vitro human hepatitis B virus models and animal models. Helioxanthin 8-1 inhibits the synthesis of duck hepatitis B virus (DHBV) DNA, covalently closed circular DNA, RNA and proteins, thereby blocking DHBV replication. Helioxanthin 8-1 shows higher cytotoxicity in virus-induced cells than in non-induced cells. Helioxanthin 8-1 can be used in studies related to hepatitis B virus infection .

HY-147266A

Elebsiran VIR-2218	HBV Small Interfering RNA (siRNA)	Infection
Elebsiran (VIR-2218) is a siRNA that targets and degrades hepatitis B virus (HBV) and hepatitis D virus (HDV) RNA transcripts. Elebsiran leads to a significant decrease in HBV surface antigen (HBsAg) and a reduction in viral load. Elebsiran binds to the sialic acid-depleted glycoprotein receptor (ASGPR) on the surface of liver cells through the GalNAc ligand, achieving liver-targeted delivery and demonstrating improved liver safety. Elebsiran can be used for the study of chronic HBV/HDV infections .

HY-N0855

Alisol G Alisol-G; 25-Anhydroalisol A	Carboxylesterase (CES) Bacterial HBV	Infection Cancer
Alisol G (25-Anhydroalisol A) is a human carboxylesterase 2 (hCES2) inhibitor with an IC₅₀ of 3.85 μM. Alisol G exhibits cytotoxic activity against human cancer cells, antibacterial activity against Gram-positive strains, and anti-hepatitis B virus activity. Alisol G can be used in research related to lung cancer, breast cancer, prostate cancer, bacterial infections, and HBV infections .

HY-113308S1

Taurolithocholic acid-d4	Isotope-Labeled Compounds Calcium Channel Ferroptosis PI3K Reactive Oxygen Species (ROS) Akt HBV	Others
Taurolithocholic acid-d₄ is deuterium labeled Taurolithocholic acid. Taurolithocholic acid is an orally active bile acid and antiviral agent. Taurolithocholic acid upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis, viral replication and viral entry of *HBV/HDV, while reducing the release of IL-1β, lipid ROS* and LDH. While exerting antiviral protective effects, Taurolithocholic acid also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic acid serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic acid shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic acid not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis .

HY-148781

HBV-IN-30	HBV	Infection
HBV-IN-30 (ex44), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-30 has the potential for the research of HBV infection .

HY-P99608

Exbivirumab	HBV	Infection
Exbivirumab is a monoclonal antibody directed against highly conserved HBsAg epitopes. Exbivirumab enhances the antiviral activity of hepatitis B immunoglobulin (HBIG). Exbivirumab combined with Libivirumab (HY-P99703) decreases circulating HBsAg and hepatitis B virus (HBV) DNA levels in a chronically infected chimpanzee. Exbivirumab can be used for HBV re-infection in liver transplant .

HY-145638

Xalnesiran RO7445482	HBV	Infection
Xalnesiran (RO7445482) is a small interfering RNA molecule that targets a conserved region of the hepatitis B virus (HBV) genome. Xalnesiran can be used for the research of chronic hepatitis B infection .

HY-N8107

Matairesinol monoglucoside 2 Publications Verification	STING IFNAR HBV	Infection
Matairesinol monoglucoside is a STING activator. Matairesinol monoglucoside modulates the STING-TBK1-IRF3 signaling axis, promotes STING transcriptional expression, increases TBK1 and IRF3 phosphorylation. Matairesinol monoglucoside induces IFN-α and IFN-β production, reduces HBV DNA, HBsAg, and HBeAg expression. Matairesinol monoglucoside can be used for the research of hepatitis b virus (hbv) infection .

HY-111003

Isothiafludine NZ-4	HBV	Infection
Isothiafludine is an orally active non-nucleosidic anti-HBV compound. Isothiafludine inhibits hepatitis B virus replication by blocking pregenomic RNA encapsidation .

HY-113308AR

Taurolithocholic acid sodium salt (Standard)	Reference Standards Calcium Channel Ferroptosis PI3K Reactive Oxygen Species (ROS) Akt HBV	Metabolic Disease
Taurolithocholic acid (sodium salt) (Standard) is the analytical standard of Taurolithocholic acid (sodium salt). This product is intended for research and analytical applications. Taurolithocholic acid sodium salt is an orally active bile acid and antiviral agent. Taurolithocholic acid sodium salt upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis, viral replication and viral entry of *HBV/HDV, while reducing the release of IL-1β, lipid ROS* and LDH. While exerting antiviral protective effects, Taurolithocholic acid sodium salt also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic acid sodium salt serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic acid sodium salt shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic acid sodium salt not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis .

HY-172835

Rapavir JH-B10	HBV	Infection
Rapavir (JH-B10) is a selective and potent sodium taurocholate cotransporting polypeptide (NTCP) inhibitor with an IC₅₀ value of 1.8 nM for the uptake of taurocholic acid-d4 (TCA-d4). Rapavir exerts antiviral activity by directly binding to NTCP and blocking the entry of the virus into cells during the HBV infection phase. Rapavir is promising for research of HBV infections .

HY-131596

Emtricitabine triphosphate (-)-Emtricitabine triphosphate	HIV	Infection
Emtricitabine triphosphate ((-)-Emtricitabine triphosphate) is the phosphorylated anabolite of Emtricitabine (HY-17427). Emtricitabine is a nucleoside reverse transcriptase inhibitor. Emtricitabine is antiretroviral agent for HIV and HBV infection .

HY-174819

VNRX-9945	HBV	Infection
VNRX-9945 is a potent, broadly and orally active HBV CAM (capsid assembly modulator) with an EC₅₀ of 2.6 nM. VNRX-9945 exhibits excellent and broad antiviral activity against multiple HBV genotypes in vitro, along with favorable pharmacokinetic profiles across multiple species. VNRX-9945 demonstrates robust antiviral efficacy in the adeno-associated virus mice models of HBV (AAV-HBV) infection .

HY-137453B

(1R)-Tenofovir amibufenamide (1R)-HS-10234	HBV HIV	Infection
(1R)-Tenofovir amibufenamide ((1R)-HS-10234) is the isomer of Tenofovir amibufenamide, is an orally active antiviral agent. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) is a HIV infection inhibitor and *HBV* infection inhibitor. (1R)-Tenofovir amibufenamide ((1R)-HS-10234) can be used for HIV infections, hepatitis B research .

HY-17426R

Famciclovir (Standard) BRL 42810 (Standard)	Reference Standards VZV HSV HBV	Infection
Famciclovir (Standard) is the analytical standard of Famciclovir. This product is intended for research and analytical applications. Famciclovir (BRL 42810) is an orally active nucleoside analogue. Famciclovir is an antiviral agent with potent activities against HBV, HSV and VZV. Famciclovir can be used for the research of herpesvirus infection .

HY-111073

Bentysrepinine Y101	HBV	Infection Inflammation/Immunology
Bentysrepinine (Y101) is an orally active *HBV* inhibitor with anti-hepatitis B virus infection activity. Bentysrepinine exhibits favorable pharmacokinetic characteristics, with absolute bioavailability of 44.9%, 43.1%, and 19.2% in rats, dogs, and monkeys, respectively, and it does not accumulate in monkeys after 90 days of oral administration. Bentysrepinine is under research in the antiviral and hepatitis fields .

HY-177300

TLR7/8 agonist 13	Toll-like Receptor (TLR) HBV IFNAR Interleukin Related	Infection Inflammation/Immunology
TLR7/8 agonist 13 is an orally active dual agonist of TLR7 (lowest effective concentrations (LEC) [hTLR7] = 1.6 μM) and TLR8 (LEC [hTLR8] = 1.6 μM). TLR7/8 agonist 13 exhibits agonistic activity against human peripheral blood mononuclear cells (hPBMCs) (LEC [hPBMC] = 0.5 μM). TLR7/8 agonist 13 induces endogenous IFNα, activating myeloid dendritic cells and monocytes toward a TH1 phenotype in mice and cynomolgus monkeys. TLR7/8 agonist 13 reduces viral load and *HBV* surface antigen expression in a mouse model of chronic AAV-HBV infection. TLR7/8 agonist 13 has the potential to indirectly induce IFNγ, which may promote HBV antigen-specific CD8 T cell-mediated responses. TLR7/8 agonist 13 can be used to study hepatitis B virus .

HY-N0444R

Rubiadin (Standard)	Reference Standards Reactive Oxygen Species (ROS) Apoptosis Fungal Parasite NF-κB HBV Bacterial	Infection Neurological Disease Metabolic Disease Inflammation/Immunology Cancer
Rubiadin (Standard) is the analytical standard of Rubiadin (HY-N0444). This product is intended for research and analytical applications. Rubiadin is an orally active free radical scavenger that inhibits the activation of the NF-κB pathway. Rubiadin inhibits osteoclast formation, bone resorption, lipid peroxidation, *HBV* DNA replication and cancer cell proliferation; reduces pro-inflammatory cytokine levels; induces cancer cell apoptosis; and possesses antifungal, antimalarial, antibacterial and anticonvulsant activities. Rubiadin can be used in the research of osteoporosis, acute inflammation, chronic inflammation, carbon tetrachloride-induced liver injury, Alzheimer's disease, breast cancer, iron overload disorders, hepatitis B virus infection, colon cancer, liver cancer, T-lymphocytic leukemia, cervical cancer, diabetic nephropathy, epileptic seizures, fungal infections, malaria and bacterial infections.

HY-19869

VRX-480773	HIV Reverse Transcriptase	Infection
VRX-480773 is an efficient non-nucleoside reverse transcriptase inhibitor (NNRTI), used for HIV infection. VRX-480773 has high specificity for HIV-1, with an EC₅₀ for wild-type HIV-1 being 0.14 nM. VRX-480773 does not inhibit HIV-2, HBV or HCV, and has no effect on human DNA polymerase α/β. VRX-480773 retains inhibitory activity against Efavirenz (HY-10572) resistant strains, with EC₅₀s mostly < 1 nM. VRX-480773 can be used for research on AIDS .

HY-113308AS1

Taurolithocholic Acid-d5 sodium salt	Isotope-Labeled Compounds Calcium Channel Ferroptosis PI3K Reactive Oxygen Species (ROS) Akt HBV	Metabolic Disease
Taurolithocholic Acid-d₅ (sodium) is the deuterium labeled Taurolithocholic acid sodium salt. Taurolithocholic Acid sodium salt is an orally active bile acid and antiviral agent. Taurolithocholic Acid sodium salt upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis, viral replication and viral entry of *HBV/HDV, while reducing the release of IL-1β, lipid ROS* and LDH. While exerting antiviral protective effects, Taurolithocholic Acid sodium salt also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic Acid sodium salt serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic Acid sodium salt shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic Acid sodium salt not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis .

HY-W676876

Oxynitidine	HBV	Infection
Oxynitidine is an *HBV* inhibitor (ID₅₀=30.8 µg/mL), which can effectively inhibit the DNA replication activity of HBV. Oxynitidine can be used in the study of viral infections .

HY-147255A

(S)-Canocapavir (S)-ZM-H1505R	HBV	Infection
(S)-Canocapavir is the isomer of Canocapavir (HY-147255A). Canocapavir (ZM-H1505R) is an orally active *HBV* core protein-targeting antiviral agent. Canocapavir binds to the hydrophobic pocket at the dimer-dimer interface of HBV core protein (HBc), stimulating intracellular accumulation of nonfunctional HBV capsids, disrupting viral replication. Canocapavir interferes with the interaction between HBc and HBV large surface protein, resulting in diminished production of empty virionsis. Canocapavir can be used for the research of hepatitis B virus (HBV) infection .

HY-N8168

LPRP-Et-97543	HBV	Infection
LPRP-Et-97543 is a potent *anti-HBV* agent. LPRP-Et-97543 reduces Core, S, and preS but not X promoter activities. LPRP-Et-97543 can be used for acute and chronic HBV infections research .

HY-144047

HBV-IN-16	HBV DNA/RNA Synthesis	Infection
HBV-IN-16 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-16 is a quinoline derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2019121357A1, compound 1) .

HY-144046

HBV-IN-15	HBV DNA/RNA Synthesis	Infection
HBV-IN-15 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-15 is a flavone derivative. HBV-IN-16 has the potential for the research of HBV infection (extracted from patent WO2020052774A1, compound 2) .

HY-144045

HBV-IN-14	HBV DNA/RNA Synthesis	Infection
HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5) .

HY-114956

AT-61	HBV	Infection
AT-61 is a non nucleoside *HBV* replication inhibitor. AT-61 prevents the capsid formation of pre genomic RNA, resulting in the production of empty capsids. AT-61 has the activity of drug-resistant mutant strains. AT-61 can be used for research on hepatitis B virus infection .

HY-179265

D-CAM-14	HBV	Infection
D-CAM-14 is a potent HBV capsid assembly modulator with potent *anti-HBV* activity (EC₅₀ = 0.1 nM, EC₉₀ = 9 nM in HepAD38 cells). D-CAM-14 suppresses HBeAg, and HBcAg in HBV-infected HepG2-NTCP cells, with EC₅₀ values of 98 and 67 nM, respectively. D-CAM-14 has distinct impacts on capsid radii and the morphology of preassembled capsids. D-CAM-14 can be used for HBV infection disease research .

HY-168045

HBV-IN-48	HBV DNA/RNA Synthesis	Infection
HBV-IN-48 is an *HBV* inhibitor. HBV-IN-48 has antiviral activity against HBV in HepDE19 cells, with an EC₅₀ value of 0.005 μM. HBV-IN-48 can reduce serum HBV DNA levels in mouse models of HBV infection .

Cat. No.	Product Name

HY-L027

Antiviral Compound Library

1,189 compounds

Viruses are much simpler organisms than bacteria, and they are made from protein substances and nucleic acid. Despite the fact that the exact mechanism of infection is extremely specific to each type of virus, the general scheme of infection can be represented in the following manner: A virus is absorbed at the surface of a host cell and then permeates through the membrane, where it releases nucleic acid from its protein protection. Then the viral nucleic acid begins to replicate, and transcription of the viral genome takes place either in the cytoplasm, or in the nucleus of the host cell. As a result of these events, a large amount of viral nucleic acid and protein are made to make new generations of virions. Therefore, one mechanism of action of antiviral drugs is to interfere with the ability of a virus to get into a target cell. A second mechanism of action is to target the processes that synthesize virus components after a virus invades a cell, such as nucleotide or nucleoside analogs.

MCE designs a unique collection of 1,189 anti-virus compounds that target several viruses, including SARS-CoV, HBV, HCV, HIV, HSV and Influenza Virus. It’s an effective tool for anti-virus drug discovery.

Cat. No.	Product Name	Target	Research Area

HY-P3465

Bulevirtide 5+ Cited Publications Myrcludex B	HBV	Infection
Bulevirtide (Myrcludex B) is a NTCP inhibitor, a linear lipopeptide of 47 amino acids. Bulevirtide inhibits HBV and HDV entry into liver cells, blocks HBV infection in hepatocytes, and participates in HBV transcriptional suppression. Bulevirtide can be used in HDV infection and compensated cirrhosis research .

HY-P3601

Brain Derived Basic Fibroblast Growth Factor (1-24) FGF basic (1-24)	Bacterial HBV	Infection Inflammation/Immunology
Brain Derived Basic Fibroblast Growth Factor (1-24) (FGF basic 1-24) is a synthetic peptide, shows anti-bacterial and anti-HBV activities. Brain Derived Basic Fibroblast Growth Factor (1-24) can be used in infection disease and immune disease research .

Cat. No.	Product Name	Target	Research Area	Image

HY-P99608

Exbivirumab	HBV	Infection
Exbivirumab is a monoclonal antibody directed against highly conserved HBsAg epitopes. Exbivirumab enhances the antiviral activity of hepatitis B immunoglobulin (HBIG). Exbivirumab combined with Libivirumab (HY-P99703) decreases circulating HBsAg and hepatitis B virus (HBV) DNA levels in a chronically infected chimpanzee. Exbivirumab can be used for HBV re-infection in liver transplant .

HY-P992458

SBT8230	Toll-like Receptor (TLR) HBV	Infection
SBT8230 is an ASGR1-targeted TLR8 agonist and an ASGR1-TLR8 immune TAC conjugate. SBT8230 achieves liver enrichment via conjugation with an anti-ASGR1 antibody, activates myeloid cells and induces anti-HBV immune responses. SBT8230 is applicable to research on chronic hepatitis B infection. The corresponding isotype control is: Human lgG1 kappa,lsotype Control (HY-P99001) .

HY-108839

Peginterferon alfa-2a Ro 25-8310/000	IFNAR	Infection
Peginterferon alfa-2a is a PEG-modified interferon (IFN) alpha-2a. Peginterferon alfa-2a can be used for research of chronic hepatitis C virus (HCV) and hepatitis B virus (HBV) infection .

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-113308A

Taurolithocholic acid sodium salt 5+ Cited Publications	Structural Classification Animals Classification of Application Fields Metabolic Disease Disease Research Fields Steroids Source Classification	Calcium Channel Ferroptosis PI3K Reactive Oxygen Species (ROS) Akt HBV
Taurolithocholic acid sodium salt is an orally active bile acid and antiviral agent. Taurolithocholic acid sodium salt upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis, viral replication and viral entry of *HBV/HDV, while reducing the release of IL-1β, lipid ROS* and LDH. While exerting antiviral protective effects, Taurolithocholic acid sodium salt also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic acid sodium salt serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic acid sodium salt shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic acid sodium salt not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis .

HY-N0444

Rubiadin	Quinones Structural Classification Classification of Application Fields Anthraquinones Rubiaceae Phenols Polyphenols Plants Morinda officinalis How Inflammation/Immunology Disease Research Fields Source Classification	Reactive Oxygen Species (ROS) NF-κB HBV Apoptosis Bacterial Fungal Parasite
Rubiadin is an orally active free radical scavenger that inhibits the activation of the NF-κB pathway. Rubiadin inhibits osteoclast formation, bone resorption, lipid peroxidation, *HBV* DNA replication and cancer cell proliferation; reduces pro-inflammatory cytokine levels; induces cancer cell apoptosis; and possesses antifungal, antimalarial, antibacterial and anticonvulsant activities. Rubiadin can be used in the research of osteoporosis, acute inflammation, chronic inflammation, carbon tetrachloride-induced liver injury, Alzheimer's disease, breast cancer, iron overload disorders, hepatitis B virus infection, colon cancer, liver cancer, T-lymphocytic leukemia, cervical cancer, diabetic nephropathy, epileptic seizures, fungal infections, malaria and bacterial infections .

HY-N0855

Alisol G Alisol-G; 25-Anhydroalisol A	Triterpenes Structural Classification Alisma plantago-aquatica Linn. Classification of Application Fields Terpenoids Other Diseases Alismataceae Plants Disease Research Fields Source Classification	Carboxylesterase (CES) Bacterial HBV
Alisol G (25-Anhydroalisol A) is a human carboxylesterase 2 (hCES2) inhibitor with an IC₅₀ of 3.85 μM. Alisol G exhibits cytotoxic activity against human cancer cells, antibacterial activity against Gram-positive strains, and anti-hepatitis B virus activity. Alisol G can be used in research related to lung cancer, breast cancer, prostate cancer, bacterial infections, and HBV infections .

HY-N8107

Matairesinol monoglucoside 2 Publications Verification	Structural Classification Monophenols other families Classification of Application Fields Lignans Other Diseases Phenols Phenylpropanoids Plants Disease Research Fields Source Classification	STING IFNAR HBV
Matairesinol monoglucoside is a STING activator. Matairesinol monoglucoside modulates the STING-TBK1-IRF3 signaling axis, promotes STING transcriptional expression, increases TBK1 and IRF3 phosphorylation. Matairesinol monoglucoside induces IFN-α and IFN-β production, reduces HBV DNA, HBsAg, and HBeAg expression. Matairesinol monoglucoside can be used for the research of hepatitis b virus (hbv) infection .

HY-113308AR

Taurolithocholic acid sodium salt (Standard)	Structural Classification Animals Steroids Source Classification	Reference Standards Calcium Channel Ferroptosis PI3K Reactive Oxygen Species (ROS) Akt HBV
Taurolithocholic acid (sodium salt) (Standard) is the analytical standard of Taurolithocholic acid (sodium salt). This product is intended for research and analytical applications. Taurolithocholic acid sodium salt is an orally active bile acid and antiviral agent. Taurolithocholic acid sodium salt upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis, viral replication and viral entry of *HBV/HDV, while reducing the release of IL-1β, lipid ROS* and LDH. While exerting antiviral protective effects, Taurolithocholic acid sodium salt also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic acid sodium salt serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic acid sodium salt shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic acid sodium salt not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis .

HY-N0444R

Rubiadin (Standard)	Quinones Structural Classification Anthraquinones Rubiaceae Phenols Polyphenols Plants Morinda officinalis How Source Classification	Reference Standards Reactive Oxygen Species (ROS) Apoptosis Fungal Parasite NF-κB HBV Bacterial
Rubiadin (Standard) is the analytical standard of Rubiadin (HY-N0444). This product is intended for research and analytical applications. Rubiadin is an orally active free radical scavenger that inhibits the activation of the NF-κB pathway. Rubiadin inhibits osteoclast formation, bone resorption, lipid peroxidation, *HBV* DNA replication and cancer cell proliferation; reduces pro-inflammatory cytokine levels; induces cancer cell apoptosis; and possesses antifungal, antimalarial, antibacterial and anticonvulsant activities. Rubiadin can be used in the research of osteoporosis, acute inflammation, chronic inflammation, carbon tetrachloride-induced liver injury, Alzheimer's disease, breast cancer, iron overload disorders, hepatitis B virus infection, colon cancer, liver cancer, T-lymphocytic leukemia, cervical cancer, diabetic nephropathy, epileptic seizures, fungal infections, malaria and bacterial infections.

HY-W676876

Oxynitidine	Alkaloids Other Alkaloids Rutaceae Zanthoxylum nitidum (Roxb.) DC. Plants Source Classification	HBV
Oxynitidine is an *HBV* inhibitor (ID₅₀=30.8 µg/mL), which can effectively inhibit the DNA replication activity of HBV. Oxynitidine can be used in the study of viral infections .

HY-N8168

LPRP-Et-97543	Infection Flavonoids Liliaceae Classification of Application Fields Phenols Polyphenols Plants Disporopsis aspera (Hua) Engl. Disease Research Fields Isoflavones Source Classification	HBV
LPRP-Et-97543 is a potent *anti-HBV* agent. LPRP-Et-97543 reduces Core, S, and preS but not X promoter activities. LPRP-Et-97543 can be used for acute and chronic HBV infections research .

HY-N19941

Schisanwilsonin K	Structural Classification Lignans Phenylpropanoids Schisandra bicolor Cheng Plants Schisandraceae Source Classification	HBV
Schisanwilsonin K is a dibenzocyclooctane lignan found in the stems of Schisandra wilsoniana with weak anti-HBV activity.Schisanwilsonin K can be used for the research of hepatitis B virus infection .

Cat. No.	Product Name	Chemical Structure

HY-113308S1

Taurolithocholic acid-d4

Taurolithocholic acid-d₄ is deuterium labeled Taurolithocholic acid. Taurolithocholic acid is an orally active bile acid and antiviral agent. Taurolithocholic acid upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis, viral replication and viral entry of HBV/HDV, while reducing the release of IL-1β, lipid ROS and LDH. While exerting antiviral protective effects, Taurolithocholic acid also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic acid serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic acid shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic acid not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis .

HY-113308AS1

Taurolithocholic Acid-d5 sodium salt

Taurolithocholic Acid-d₅ (sodium) is the deuterium labeled Taurolithocholic acid sodium salt. Taurolithocholic Acid sodium salt is an orally active bile acid and antiviral agent. Taurolithocholic Acid sodium salt upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis, viral replication and viral entry of HBV/HDV, while reducing the release of IL-1β, lipid ROS and LDH. While exerting antiviral protective effects, Taurolithocholic Acid sodium salt also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic Acid sodium salt serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic Acid sodium salt shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic Acid sodium salt not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis .

HY-17426S1

Famciclovir-d6
Famciclovir-d₆ (BRL 42810-d₆) is deuterium labeled Famciclovir. Famciclovir (BRL 42810) is an orally active nucleoside analogue. Famciclovir is an antiviral agent with potent activities against HBV, HSV and VZV. Famciclovir can be used for the research of herpesvirus infection .

HY-113308AS

Taurolithocholic acid-d4 sodium

Taurolithocholic acid-d₄ (sodium) is the deuterium labeled Taurolithocholic acid (sodium salt). Taurolithocholic acid sodium is an orally active bile acid and antiviral agent. Taurolithocholic acid sodium upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis, viral replication and viral entry of HBV/HDV, while reducing the release of IL-1β, lipid ROS and LDH. While exerting antiviral protective effects, Taurolithocholic acid sodium also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic acid sodium serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic acid sodium shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic acid sodium not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis .

HY-113308AS2

Taurolithocholic acid-d4-1 sodium

Taurolithocholic acid-d₄-1 (sodium) is the deuterium labeled Taurolithocholic acid. Taurolithocholic acid sodium is an orally active bile acid and antiviral agent. Taurolithocholic acid sodium upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis, viral replication and viral entry of HBV/HDV, while reducing the release of IL-1β, lipid ROS and LDH. While exerting antiviral protective effects, Taurolithocholic acid sodium also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic acid sodium serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic acid sodium shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic acid sodium not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis .

HY-113308S

Taurolithocholic acid-d5

Taurolithocholic acid-d₅ is deuterium labeled Taurolithocholic acid. Taurolithocholic acid is an orally active bile acid and antiviral agent. Taurolithocholic acid upregulates FADS2 by activating the TGR5-PI3K/AKT-SREBP2 signaling axis, inhibits SFTSV-induced ferroptosis, viral replication and viral entry of HBV/HDV, while reducing the release of IL-1β, lipid ROS and LDH. While exerting antiviral protective effects, Taurolithocholic acid also stimulates the recycling of hepatocellular membrane transporters, impairs canalicular bile acid secretion function, and induces hepatocyte cholestasis, apoptosis and acute hepatocellular injury. Taurolithocholic acid serves as an experimental model compound for hepatocellular cholestasis. At concentrations ≤200 μM, Taurolithocholic acid shows no cytotoxicity and does not activate the interferon pathway. Taurolithocholic acid not only protects mice from lethal SFTSV infection but also is suitable for studies related to severe fever with thrombocytopenia syndrome and cholestasis .

Cat. No.	Product Name		Classification